A novel aptasensor based on 3D-reduced graphene oxide modified gold nanoparticles for determination of arsenite

Author’s Accepted Manuscript A novel aptasensor based on 3D-reduced graphene oxide modified gold nanoparticles for determination of arsenite Ali A. Ensafi, F. Akbarian, E. Heydari-Soureshjani, B. Rezaei www.elsevier.com/locate/bios

PII: DOI: Reference:

S0956-5663(18)30724-3 https://doi.org/10.1016/j.bios.2018.09.034 BIOS10774

To appear in: Biosensors and Bioelectronic Received date: 8 July 2018 Revised date: 6 September 2018 Accepted date: 9 September 2018 Cite this article as: Ali A. Ensafi, F. Akbarian, E. Heydari-Soureshjani and B. Rezaei, A novel aptasensor based on 3D-reduced graphene oxide modified gold nanoparticles for determination of arsenite, Biosensors and Bioelectronic, https://doi.org/10.1016/j.bios.2018.09.034 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

A novel aptasensor based on 3D-reduced graphene oxide modified gold nanoparticles for determination of arsenite Ali A. Ensafi*, F. Akbarian, E. Heydari-Soureshjani, B. Rezaei

Department of Chemistry, Isfahan University of Technology, Isfahan 84156–83111, Iran

E–mail: [email protected], [email protected]; [email protected].

*Corresponding author: Fax: +98–31–33912350; Tel.: +98–31–33913269;

Abstract In this study, a sensitive aptasensor based on three-dimensional reduced graphene oxidemodified gold nanoparticles (3D-rGO/AuNPs) was fabricated for the determination of arsenite (As(III)). The 3D-rGO/AuNPs was fully characterized with various techniques. The 5′-thiolate aptamer was first self-assembled on a glassy carbon electrode (GCE) that it’s modified with 3D-rGO/AuNPs via Au-S covalent bonding. In the presence of As(III), the Gquadruplex interaction was formed between a single-stranded DNA and the target, which produced a hindrance for electron transfer. Consequently, the electrochemical impedance spectroscopy signals of a GCE modified with 3D-rGO/AuNPs was increased. In order to improve the response of the designing aptasensor, the effect of the various parameters was optimized. Under the optimal conditions, the aptasensor has an extraordinarily low detection limit of 1.4 × 10–7 ng mL–1 toward As(III) with a dynamic range of 3.8 × 10–7 ‒ 3.0 × 10–4 ng mL-1. The 3D-rGO/AuNPs aptasensor displayed superior selectivity and reproducibility with an acceptable recovery for determination of As(III) in real water samples. 1

Graphical abstract

Keywords:

Aptasensor;

Three-dimensional

reduced

Electrochemical impedance spectroscopy; Gold nanoparticles. 2

graphene

oxide;

Arsenite;

1. Introduction Arsenic is a common heavy metal and toxic, which is found in soil, water, rain and a variety of foodstuffs similar vegetables and cereals (Shrivas et al., 2015). In nature, arsenic exists in both organic and inorganic kinds. Inorganic arsenic exists as arsenite (As(III)) and arsenate (As(V)). Amongst these states, As(III) is 60 times more toxic than As(V) or organic As compounds (Cui et al., 2012; Ensafi et al., 2016; Song et al., 2016). Arsenic contamination of drinking and ground waters is considered as a serious environmental problem and has a serious health problems for humans, including skin damage, heart disease, lung and bladder cancer (Pooja et al., 2017; Shrivas et al., 2015; Vadahanambi et al., 2013; Wen et al., 2017). Thus, it is highly necessary to determine trace As (III) in water samples with high specificity and sensitivity. Various analytical methods including atomic absorption spectrometry (Hassanpoor et al., 2015; Rabieh et al., 2013), high performance liquid chromatography (Yang et al., 2009), atomic fluorescence spectrometry (Zhang et al., 2011), and electrochemical methods (H. Wang et al., 2015; Wen et al., 2017; Zhang et al., 2017) have been introduced for detection of As(III). Meanwhile, electrochemical methods have attracted remarkable attention in the expansion of aptasensors owing to its high sensitivity, good portability, fast response and low-cost. Aptamers, are single-stranded DNA or RNA oligonucleotides, with affinity for a desired target, selected from a large oligonucleotide library through a process called SELEX, which stands for sequential evolution of ligands by exponential enrichment (Chen et al., 2015; Taghdisi et al., 2018; Zhang et al., 2008). Aptamers have many advantages such as high affinity, sensitivity, simple synthesis, and high-temperature stability (Cui et al., 2016; Wen et al., 2017). The ability of aptamers to replicate the behaviour of antibodies has led to 3

excitement about the potential of the use of aptamers in biosensor applications and disease diagnosis (Divsar et al., 2015; Hu et al., 2014). Finally, it’s important to provide the best substrate for infixing of aptamers on it, which leads to an increment of surface area and response of aptasensors. Therefore, among them, the carbon substrates are a good option. Graphene is a two-dimensional (2D) building block of carbon atoms that possess unique electrical conductivity, mechanical and thermal activities (Niu et al., 2018). GO is commonly provided by oxidation of graphite powder with powerful oxidants such as a combination of concentrated sulfuric acid and potassium permanganate (Tang et al., 2010). Usually, the reduction of graphene oxide (GO) used to produce graphene on a large scale (Tang et al., 2010). Owing to the excellent electrochemical efficiency, reduced graphene oxide (rGO) has numerous potential for usage in the electrochemical sensor (Fakhari et al., 2014; Hashemi et al., 2017). Unfortunately, the stacking of graphene nanosheets, which it’s created by the aggregation in solution diminishes its electron transport and restricts application. Therefore, to dominate this problem, recently three dimensional (3D) graphene structures was reported (Niu et al., 2018; Qiu et al., 2017). The porous structure, ultra-low mass density and the large active plane of 3D graphene can provide a wide available surface area which makes to enhance electron transfer speed and electrical conductivity (Song et al., 2017; Zhang et al., 2018). In this study, a novel electrochemical aptasensor based on 3D-rGO modified with gold nanoparticles (3D-rGO/AuNPs) was developed and employed for the detection of As(III). The synthesized 3D-rGO/AuNPs nanocomposite was characterized with FE-SEM, EDS, TEM and XRD. 3D-rGO/AuNPs can’t only raise the ability of the electron transfer but also used as immobilization platform for 5'-thiolate-labelled aptamer via Au–S covalent banding. Under optimal experimental conditions, the proposed electrochemical aptasensor for arsenite

4

detection showed excellent sensitivity and selectivity, and perhaps provide a promising application for environmental monitoring.

2. Experimental section 2.1. Materials and chemicals All chemicals were in analytical grade (without any further purification) and deionized doubly distilled (DI) water was used in all assays. All metal ion salts and potassium ferricyanide (K3[Fe(CN)6]), potassium ferrocyanide (K4[Fe(CN)6]), glucose (C6H12O6) were purchased from Sigma-Aldrich (London, UK). Chloroauric acid (HAuCl4•4H2O), potassium chloride (KCl) and potassium nitrate (KNO3) were purchased from Merck company (Darmstadt, Germany). Phosphate buffer solution (PBS, 0.1 mol L–1, pH 7.4) was prepared by mixing the appropriate amount of NaH2PO4 and Na2HPO4. Stock standard solution (1.5 × 105 ng mL–1) of As(III) was prepared by dissolving an appropriate amount of As2O3 (Merck) in 2.0 mL of 1.0 mol L–1 NaOH (Merck). Then, 5.0 mL of 0.5 mol L–1 HCl (Merck) was added to the solution, and the total volume of the solution was made up to 250 mL with water. Thiolated

arsenic-binding

aptamer

with

a

sequence

(5′GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAA CCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT-3′)

was

synthesized and purified in Takapu Zist Institute (Tehran, Iran). The oligonucleotide was diluted with DI water and kept as a stock solution in a freezer.

2.2. Apparatus All

electrochemical

experiments

were

recorded

using

potentiostat/galvanostat

PGSTAT302N (Netherlands) with the software of FRA, and a conventional three-electrode cell was applied. A GCE modified with 3D-rGO/AuNPs served as a working electrode; an Ag/AgCl (saturated KCl) electrode as a reference electrode, and a platinum wire as an 5

auxiliary electrode. The transmission electron microscopy (TEM) was carried out with a Philips CM30 300 kV TEM. Field emission scanning electron microscopy (FE-SEM) and energy-dispersive X-ray spectroscopy (EDS) were applied with a Phillips XL-30 microscope. Metrohm pH–meter (Model 827) with a glass electrode (Corning) was used to set up the pH. X-ray diffractometry (XRD: Asenware AW-DX300, anode: copper, 1.54184 A, voltage: 40 kV and current: 30 mA) was used for structural characterization of the nanocomposite.

2.3. Synthesis of 3D-rGO/AuNPs First, the GO was synthesized using Hummer’s method via oxidation of natural graphite (Ensafi et al., 2015). Then, 35 mg from the synthesized GO was first dispersed in 35 mL water. Followed by, 10 mg of HAuCl4 and 1.75 g of glucose were added to the above solution under magnetic stirring at room temperature for 30 min. Next, the solution was dropped into a Teflon-lined autoclave (40 mL) and heated at 120

ᵒ

C for 12 h. The resulting 3D-

rGO/AuNPs was rinsed and dried by freeze drying.

2.4. Preparation of the Aptamer/3D-rGO/AuNPs/GCE The GCE was firstly polished carefully with 0.3 and 0.05 μm alumina powder for 3 min, respectively. Followed by sonication in a 1:1 mixture of ethanol and ultrapure water. The homogenous ink was prepared by dispersion of 3D-rGO/AuNPs (2.5 mg) in 1.0 mL H2O. After pretreatment of GCE, 5.0 μL of 3D-rGO/AuNPs was cast on the GCE surface and dried at room temperature. Subsequently, 10 μL of the Aptamer was dropped on the pretreated electrode and then incubated for 2 h in a humid chamber at room temperature. The surface was then rinsed with water to remove the unbinding thiolated aptamer and dried in air; the Aptamer/3D-rGO/AuNPs/GCE modified electrode was obtained.

6

2.5. Electrochemical measurement of As(III) For the determination of As(III), the Aptamer/3D-rGO/AuNPs/GCE was immersed into a sample vial containing As(III) in 0.1 mol L–1 PBS (pH 7.4) for 30 min. After proper incubation time, the electrochemical impedance spectroscopy (EIS), with an amplitude of 10 mV and frequency range of 0.01 ‒ 105 Hz, was performed in 10.0 mmol L–1 [Fe(CN)6]3–/4– containing 0.1 mol L–1 KCl for the determination of As(III) at a potential of +0.18 V. After the measurement, the modified electrode was polished on emery paper using alumina (0.03 and 0.05 µm, respectively) for 3 min and then it was sonicated in a 50:50 solution of H2O:EtOH for 5 min. After that, the electrode rinsed and dried at room temperature (RT).

3. Results and discussion 3.1. Structural and physical characterization of 3D-rGO/AuNPs For the investigation of the surface morphology of 3D-rGO/AuNPs nanocomposites, FESEM and TEM were used. As can be seen in Fig. 1A, the porous structure of 3D-rGO/AuNPs nanocomposites is clearly evident. The EDS elemental analysis was applied, and the results are shown in Table S-1. According to the result, the presence of Au, C and O in the nanocomposite are approved, and the percentage of AuNPs on the surface of the electrode was 0.79%. Finally, the formation of 3D-rGO/AuNPs is proven. The percentage of AuNPs are important in many ways. More dispersed AuNPs leads to appear more sites for the interaction of thiolated aptamer and AuNPs, which ultimately increases the sensitivity of the aptasensor toward determination of As(III). On the other hand, higher concentration of the gold causes aggregation of AuNPs at the surface of 3D-rGO, and filling the holes of the 3D-rGO (Tang et al., 2010). Therefore, a suitable amount of AuNPs has a critical role in the formation of 3D structure of graphene, whereas in the absence of

7

AuNPs, 3D-rGO could not form. Finally, an appropriate amount of 10 mg of gold salt was used during the synthesis of 3D-rGO/AuNPs. The FE-SEM image of the bare GCE was obtained (Fig. S1-A, Supporting information). The images don’t show anything excepted at the surface of GCE. Fig. 1A shows the FE-SEM images of 3D-rGO/AuNPs nanocomposites. According to these images, the 3D structure has a porous morphology and the AuNPs clear on its.

Fig. 1 (A): SEM, and (B): TEM micrographs of 3D-rGO/AuNPs at different magnifications. (C): Nyquist plots of (a): the bare GCE, (b): 3D-rGO/AuNPs/GCE, (c): Aptamer/3DrGO/AuNPs/GCE, and (d): As(Ш)/Aptamer/3D-rGO/AuNPs/GCE. Conditions: in a solution 8

containing 5.0 mmol L–1 [Fe(CN)6]3–/4– and 0.1 mol L–1 KCl at the potential of +0.18 V). (D): XRD pattern of the 3D-rGO/AuNPs. Fig. 1B, display the TEM images of 3D-rGO/AuNPs nanocomposites. These images show the uniformly dispersed of AuNPs on the transparent graphene layers. Individually, the AuNPs adjoined onto the rGO sheet, and they could act as an active site for immobilization of the aptamer. Finally, this structure creates a large plane area of porous 3D-rGO/AuNPs nanocomposites that can provide excellent electron transfer in the 3D-rGO. After immobilization of the aptamer on the modified electrode, the FE-SEM images (with different magnitude) of Aptamer/3D-rGO/AuNPs/GCE were taken and are shown in Fig. S1B (Supporting information). The obtained images become ‘more crowed’ compared with the 3D-rGO/AuNPs/GCE (Zhu et al., 2015). EIS is highly an efficient method for illustration of surface changes on the modified electrodes. As shown in Fig. 1D, after the modification of GCE with 3D-rGO/AuNPs, the value of the charge transfer resistance (Rct) decreased (Fig. 1D-b) compared with GCE (Fig. 1D-a). It can be imputed to the verity that the presence of rGO and AuNPs in 3D-rGO/AuNPs structure have a great conducting ability and raise the electron transfer rate. After immobilization of the aptamer at the 3D-rGO/AuNPs/GCE surface, Rct value dramatically increased (Fig. 1D-c). This change can be attributed to the repulsion between the negatively charged phosphate backbones of the aptamer and the negatively charged of [Fe(CN)6]4–3–. Also, after incubation of the aptasensor with As(Ш), the Rct value significantly increased too (Fig. 1D-d), which is due to the As(Ш) capturing onto the reaction sites in the apta-sensing layer (aptamer stands). These studies demonstrated that 3D-rGO/AuNPs was successfully attached to the GCE. For further investigation, AFM images of the aptasensor were taken at each preparation steps. The porous structure of 3DrGO/AuNPs/GCE is clearly observed in the 3D-AFM image 9

(Fig. 2A). Also, according to 2D-AFM image (Fig. S-2, Supporting information), the thickness of the immobilized materials at the electrode surface are approximately 50 nm. After immobilization of the aptamer (Fig. 2B), the thickness of the of the immobilized materials at the electrode surface increased, but the surface roughness (porosity) decreased. When the aptasensor contact with As(Ш) (Fig. 2C), this thickness increased again. Also, the surface roughness (porosity) of the electrode was increased due to the interaction of As(Ш) with the Aptamer/3DrGO/AuNPs/GCE.

Fig. 2 AFM images of (A): 3D-rGO/AuNPs/GCE, (B): Aptamer/3D-rGO/AuNPs/GCE, and (C): As(Ш)/Aptamer/3D-rGO/AuNPs/GCE.

For

further

composite

and

structural

characteristics

of

the

3D-rGO/AuNPs

nanocomposite, XRD measurement was done. The XRD pattern of the 3D-rGO/AuNPs nanocomposite emphasis on the formation and presence of Au nanoparticles. As shown in Fig. 1C, the XRD pattern of the 3D-rGO/AuNPs corresponds to the JCPDS card No. 00-0040784.

3.2. Optimization of analytical conditions To attain the optimal response of the aptasensor, the analytical parameters, such as the concentration of the aptamer and incubation time of aptamer with As(Ш) were optimized. The effect of the immobilization aptamer concentration was inquired by varying it’s from 0.1 10

nmol L–1 to 1.0 × 10–5 mol L–1 in the presence of a constant concentration of As(Ш). As can be seen in Fig. 3 (A and B), the Rct value gradually increases as aptamer concentration went rise to 1.0 × 10–6 mol L–1 and level off at higher concentrations. By increasing the aptamer concentration to 1.0 × 10–6 mol L–1, the whole active site of the modified electrode with 3DrGO/AuNPs is filled, and after that, the electrode's saturation level is appearing with increasing the aptamer concentration. Therefore, 1.0 × 10–6 mol L–1 was chosen as the optimum concentration of the aptamer.

11

Fig. 3 (A): Nyquist plots and (B): relative response of the electrochemical aptasensor after interaction with different concentrations of As(III): 1.5 ×10–2, 1.5 × 10–1,1.5, 1.5 × 101, 1.5 × 102 and 1.5 × 103 ng mL–1 (from a to f). Conditions: in a solution containing 5.0 mmol L–1 [Fe(CN)6]3–/4– and 0.1 mol L–1 KCl at a potential of +0.18 V). (C): Nyquist plots, and (D): Relative response of the electrochemical aptasensor after incubation time of the biosensor with different concentrations of As(III): 10, 30, 60, 90 and 120 min (from a to e). Conditions: in a solution containing 5.0 mmol L–1 [Fe(CN)6]3–/4– and 0.1 mol L–1 KCl at a potential of +0.18 V).

For investigation of incubation time of As(Ш) on the Aptamer/3D-rGO/AuNPs/GCE, the EIS response was recorded in the presence of fix concentration of the aptamer (1.0 × 10–6 mol L–1) and different incubation time of As(Ш). As can be seen in Fig. 3 (C and D), the EIS response increased with the enhancement of the incubation time until 30 min, and after that, the Rct value reached a plateau. By increasing the incubation time to 30 min, the Gquadruplex interaction was created between As(III) and the aptamer on the surface of 3DrGOAuNPs/GCE. As a result, Rct was strengthened, and then the surface of Aptamer/3DrGO/AuNPs/GCE is saturated with As(Ш). Therefor, 30 min was selected as an optimal incubation time for the determination of As(Ш).

3.3. Analytical performance of electrochemical aptasensor Under the optimal conditions, the analytical determination of As(III) by Aptamer/3DrGO/AuNPs/GCE was studied using EIS in the [Fe(CN)6]3–/4–. As shown in Fig. 4A, the corresponding ΔRct of the 3D-rGO/AuNPs aptasensor increased with the enhancement of As(III) concentration from 3.8×10–7 to 3.0×10–4 ng mL–1. Moreover, the electrochemical aptasensor showed a good linear relationship between the variations of ΔRct values vs. the 12

logarithm value of As(III) concentration with a correlation equation of ΔRct = 2.07(Log CAs(III)) + 13.9, with a correlation coefficient of 0.9827 (Fig. 4B). Finally, the mechanism reaction of this apta-sensor was illustrated in Fig. 4C.

Fig. 4 (A): EIS responses of the electrochemical aptasensor with different concentrations of As(III) as: 0.4 × 10–6, 1.1 × 10–6, 3.0 × 10–6, 1.1 × 10–5, 3.0 × 10–5, 1.1 × 10–4, 3.0 × 10–4 ng mL–1 (from a to g). (B): Calibration plot of the electrochemical aptasensor. (C): The mechanism reaction of the proposed aptasensor. 13

The detection limit (S/N = 3) toward the As(III) was calculated as 1.4 × 10–7 ng mL–1, which is much lower than the World Health Organization guideline 10 ng mL–1 (Ensafi et al., 2016). The proposed electrochemical aptasensor for determination of As(III) was superior to some previously reported As(III) experiment (Cui et al., 2016; Majid et al., 2006; VegaFigueroa et al., 2018). The active surface area and dispersion of AuNPs on the substrate are important for the preparation of the aptasensor. When the AuNPs were synthesized without any substrate or electrodeposited on the surface of the electrode, the agglomeration of AuNPs can occur. Even if the AuNPs don’t accumulate together, it’s likely that the long chain of the aptamers interfere with each other because they are close together. In results, the active surface area of AuNPs is reduced. So, the binding of long-chain aptamer to the AuNPs is difficult. To solve this problem, in this paper a 3D structure of rGO was used as a suitable substrate for the decoration of AuNPs. This structure has a high porosity that caused the AuNPs to decorate without any agglomeration. Hereupon, a higher percentage of the aptamers interact with the surface without interfering with each other. Therefore, the sensitivity of this proposed aptamer is higher than is that of the other aptasensor (Cui et al., 2016; Majid et al., 2006; Vega-Figueroa et al., 2018). The comparison results are summarized in Table 1. Also, long-term stability of the Aptamer/3D-rGO/AuNPs/GCE was checked. In that way, the aptasensor was prepared and the signal of the aptasensor (ΔRc) was recorded for 3 different times. In the second step, for investigation of the long-term stability of proposed aptasensor, the aptamer/3D-rGO/AuNPs/GCE was prepared and kept in the closed beaker glass on a refrigerator at 4 oC for 2 consequent weeks. After reaching the electrode temperature to RT, the signal of the aptasensor was obtained. The results confirmed that 4.5% of the efficiency of the aptasensor was lost.

14

Table 1. Comparison between the proposed aptasensor and other reported methods. Method

Linear range (ng mL–1)

Detection limit (ng mL–1)

Reference

Electrochemical impedance spectrometry

7.5×10–4 -0.75

5.0 ×10–4

(Zhang et al., 2017)

Differential pulse voltammetry

0.1–200

7.5 ×10–2

(Wen et al., 2017)

Differential pulse voltammetry

0.01–7.5

1.1 ×10–2

(Cui et al., 2016)

Differential pulse voltammetry

0.6-56

0.1

(Gupta et al., 2016)

Differential pulse voltammetry

0.5-10

0.5

(Y. Wang et al., 2015)

Differential pulse anodic stripping voltammetry

4-1498

0.9

(Sakira et al., 2015)

Square wave voltammetry

1-5

0.8

(Moghimi et al., 2015)

Square wave voltammetry

0.01-1.0

9.7 ×10–4

(Cui et al., 2012)

Colorimetry

50-700

6.0

(Divsar et al., 2015)

Colorimetry

1.26-200

1.26

(Zhan et al., 2014)

Surface-enhanced Raman spectroscopy

0.5-10

0.1

(Song et al., 2016)

Surface-enhanced Raman spectroscopy

0.1-100.4

0.6

(Yang et al., 2015)

Fluorescence

0.15-37.5

0.34

(Taghdisi et al., 2018)

Fluorescence

7.5×10–4 –75

9.7×10–5

(Ensafi et al., 2016)

Electrochemical impedance spectrometry

3.8×10–7 –3.0×10–4

1.4×10–7

This work

3.4. Selectivity and reproducibility of the electrochemical aptasensor

15

To evaluate the selectivity of the 3D-rGO/AuNPs electrochemical aptasensor towards the other environmentally related metal ions, the response (ΔRct) of the 3D-rGO/AuNPs aptasensor was measured in solutions containing either As(III) with other environmentally related metal ions including Zn2+, Ag+, Cu2+, Hg2+, Co2+, Fe2+, Cr3+, Se(IV) and As(V). The results showed that Zn(II) at 381-fold (4.2×10–3 vs. 1.1×10–5 ng mL–1), Fe(II) at 355-fold (3.9×10–3 vs. 1.1×10–5 ng mL–1), Cr(III) at 509-fold (5.6×10–3 vs. 1.1×10–5 ng mL–1), Hg(II) at 436-fold (4.8×10–3 vs. 1.1×10–5 ng mL–1), Cu(II) at 309-fold (3.4×10–3 vs. 1.1×10–5 ng mL– 1

), Se(IV) at 191-fold (2.1×10–3 vs. 1.1×10–5 ng mL–1), Co(II) at 373-fold (4.1×10–3 vs.

1.1×10–5 ng mL–1), Ag(I) at 218-fold (2.4×10–3 vs. 1.1×10–5 ng mL–1), As(V) at 209-fold (2.3×10–3 vs. 1.1×10–5 ng mL–1) did not interferes for As(III) determination. The suggested 3D-rGOAuNPs aptasensor validated that the high selectivity for As(III) with the strong binding between As(III) and a single-stranded DNA. To survey of the reproducibility of the 3D-rGO/AuNPs electrochemical aptasensor, three different Aptamer/3D-rGO/AuNPs/GCEs were provided and used for analyzing a 1.1×10–5 ng mL–1 As(III). The admitted reproducibility with a relative standard deviation (RSD) of 2.0% was obtained.

3.5. Real samples analysis For further research on the practicability and reliability of the proposed electrochemical aptasensor in the environmental samples, the experiment was done into three types of water samples (tap water, river and wastewater) to determine any As (III). The real water samples were first filtered through a 0.2 μm membrane to remove large particles. As shown in Table 2, no As(III) was detected when the real water samples were analyzed, which demonstrate that the concentration of As(III) was acutely low and not discovered. Afterwards, a different amount of standard As(III) solution was spiked into water samples, respectively. The

16

recoveries ranging was obtained from 96% to 104%, and the RSDs were 1.2-2.5%. This result demonstrates that the developed electrochemical aptasensor based on 3D-rGO/AuNPs has good accuracy and this method can be successfully applied for the determination of As(III) in real samples.

Table 2. Detection of As(III) in different real samples using Aptamer/3D-rGO/AuNPs/GCE. Sample

Spike

Determineda

–1

–1

Recovery (%)

RSDb (%)

(ng mL )

(ng mL )

Tap water

7.5 × 10–5

7.3 × 10–5

98

1.19

River water

7.5 × 10–5

7.2 × 10–5

96

2.46

Waste water

7.5 × 10–5

7.8 × 10–5

104

1.49

a Mean of four measurements; b Relative standard deviation.

Conclusion In this research, a novel electrochemical aptasensor based on 3D-rGO/AuNPs has been reported for sensitive and selective determination of As(III). The electrochemical activity of 3D-rGO/AuNPs confirmed by EIS measurements and synthesized nanocomposite was characterized by various techniques such as FE-SEM, EDS, TEM, XRD and EIS methods. Where, a thiolated aptamer end immobilization on the AuNPs through the covalent bonding of S-Au and the electron transfer are hindered by its blockage effect, which is leading to increased Rct of the GCE electrode modified by 3D-rGO/AuNPs. In the presence of As(III), EIS signals of the Aptamer/3D-rGO/AuNPs/GCE were increased because of As(III) linking with the aptamer, which makes a hindrance for electron transfer. As well as, the suggested aptasensor based on 3D-rGO/AuNPs has a very low detection limit of 1.4×10–7 ng mL–1 toward As(III), within a high linear response and broad range from 3.8×10–7 - 3.0×10–4 ng

17

mL–1. Given that the impedimetric aptasensor represented high sensitivity and selectivity, it can use as a high potentially enforceable in environmental analysis.

18

References Chen, Z., Zhang, C., Li, X., Ma, H., Wan, C., Li, K., Lin, Y., 2015. Biosens. Bioelectron. 65, 232–237. Cui, H., Yang, W., Li, X., Zhao, H., Yuan, Z., 2012. Anal. Methods 4, 4176–4181. Cui, L., Wu, J., Ju, H., 2016. Biosens. Bioelectron. 79, 861–865. Divsar, F., Habibzadeh, K., Shariati, S., Shahriarinour, M., 2015. Anal. Methods 7, 4568– 4576. Ensafi, A.A., Heydari-Soureshjani, E., Jafari-Asl, M., Rezaei, B., Ghasemi, J.B., Aghaee, E., 2015. Anal. Chim. Acta 887, 82–91. Ensafi, A.A., Kazemifard, N., Rezaei, B., 2016. Biosens. Bioelectron. 77, 499–504. Fakhari, A.R., Sahragard, A., Ahmar, H., 2014. Electroanalysis 26, 2474–2483. Gupta, R., Gamare, J.S., Pandey, A.K., Tyagi, D., Kamat, J. V, 2016. Anal. Chem. 88, 2459– 2465. Hashemi, P., Bagheri, H., Afkhami, A., Ardakani, Y.H., Madrakian, T., 2017. Anal. Chim. Acta 996, 10–19. Hassanpoor, S., Khayatian, G., Azar, A.R.J., 2015. Microchim. Acta 182, 1957–1965. Hu, R., Wen, W., Wang, Q., Xiong, H., Zhang, X., Gu, H., Wang, S., 2014. Biosens. Bioelectron. 53, 384–389. Majid, E., Hrapovic, S., Liu, Y., Male, K.B., Luong, J.H.T., 2006. Anal. Chem. 78, 762–769. Moghimi, N., Mohapatra, M., Leung, K.T., 2015. Anal. Chem. 87, 5546–5552. Niu, X., Li, X., Chen, W., Li, X., Weng, W., Yin, C., Dong, R., Sun, W., Li, G., 2018. Mater. Sci. Eng. C 89, 230–236. Pooja, D., Saini, S., Thakur, A., Kumar, B., Tyagi, S., Nayak, M.K., 2017. J. Hazard. Mater. 328, 117–126. Qiu, H.-J., Guan, Y., Luo, P., Wang, Y., 2017. Biosens. Bioelectron. 89, 85–95. 19

Rabieh, S., Bagheri, M., Planer-Friedrich, B., 2013. Microchim. Acta 180, 415–421. Sakira, A.K., Somé, I.T., Ziemons, E., Dejaegher, B., Mertens, D., Hubert, P., Kauffmann, J., 2015. Electroanalysis 27, 309–316. Shrivas, K., Shankar, R., Dewangan, K., 2015. Sensors Actuators B Chem. 220, 1376–1383. Song, C., Yin, X., Han, M., Li, X., Hou, Z., Zhang, L., Cheng, L., 2017. Carbon 116, 50–58. Song, L., Mao, K., Zhou, X., Hu, J., 2016. Talanta 146, 285–290. Taghdisi, S.M., Danesh, N.M., Ramezani, M., Emrani, A.S., Abnous, K., 2018. Sensors Actuators B Chem. 256, 472–478. Tang, Z., Shen, S., Zhuang, J., Wang, X., 2010. Angew. Chemie - Int. Ed. 49, 4603–4607. Vadahanambi, S., Lee, S.-H., Kim, W.-J., Oh, I.-K., 2013. Environ. Sci. Technol. 47, 10510– 10517. Vega-Figueroa, K., Santillán, J., Ortiz-G me , ., rti - uiles, E. ., ui ones-Col n, .A., Castilla-Casadiego, D.A., Almod var,

.,

ayro,

. ., Rodr gue -Martínez, J.A.,

Nicolau, E., 2018. ACS omega 3, 1437. Wang, H., Yuan, X., Zeng, G., Wu, Y., Liu, Y., Jiang, Q., Gu, S., 2015. Adv. Colloid Interface Sci. 221, 41–59. Wang, Y., Wang, P., Wang, Y., He, X., Wang, K., 2015. Talanta 141, 122–127. Wen, S., Zhang, C., Liang, R., Chi, B., Yuan, Y., Qiu, J., 2017. Microchim. Acta 184, 4047– 4054. Yang, B., Chen, X., Liu, R., Liu, B., Jiang, C., 2015. RSC Adv. 5, 77755–77759. Yang, G.A.O., Xuan, C.A.O., Jing-Jing, Y.U., Sen-Chun, L.F., Xiao-Ru, W., 2009. Chinese J. Anal. Chem. 37, 1738–1742. Zhan, S., Yu, M., Lv, J., Wang, L., Zhou, P., 2014. Aust. J. Chem. 67, 813–818. Zhang, N., Fu, N., Fang, Z., Feng, Y., Ke, L., 2011. Food Chem. 124, 1185–1188. Zhang, S., Xia, J., Li, X., 2008. Anal. Chem. 80, 8382–8388.

20

Zhang, Y., Yan, X., Yan, Y., Chen, D., Huang, L., Zhang, J., Ke, Y., Tan, S., 2018. RSC Adv. 8, 4239–4248. Zhang, Z., Ji, H., Song, Y., Zhang, S., Wang, M., Jia, C., Tian, J.-Y., He, L., Zhang, X., Liu, C.-S., 2017. Biosens. Bioelectron. 94, 358–364. Zhu, Y., Zhou, C., Yan, X., Yan, Y., Wang, Q., 2015. Anal. Chim. Acta 883, 81–89.

21

Highlights 

An aptasensor based on three-dimensional rGO-modified gold-nanoparticles was fabricated.



G-quadruplex interaction was formed between the ss-DNA and As(III).



The prepared 3D-rGO/AuNPs was used as an electrochemical sensor for As(III) detection.



The aptasensor has an extraordinarily low detection limit of 0.9 fM toward As(III).

22