Bovine cytokine expression during different phases of bovine leukemia virus infection

Veterinary

Immunology and lmmunopathology 56 (1997) 39-51

Veterinary immunology and immunqMhokgy

Bovine cytokine expression during different phases of bovine leukemia virus infection Robert G. Keefe Department

*,

Yeon Choi, David A. Ferrick, Jeffrey L. Stott

of Veierinary Medicine: Pathology, Microbiology, & Immunology University of California at Davis Davis, CA 95616, USA Received 24 June 1996; accepted 24 June 1996

Abstract The potential role of aberrant cytokine production in the pathogenesis of bovine leukemia virus (BLV) was studied by analyzing cytokine mRNA expression in pokeweed-stimulated PBMLs of cows in different phases of disease progression. To analyze the mRNA, a semi-quantitative RT-PCR assay was developed. The RT-PCR assay was developed for detection of IL-2, -4, -6, -10, -12, IFN-y and actin using cDNA derived from phorbol-stimulated peripheral blood mononuclear leukocytes. Using a PCR specific for BLV tax, agar gel immunodiffusion and white blood cell counts, BLV-negative, BLV-positive aleukemic (AL), and BLV-positive persistently lymphocytotic (PL) cattle were identified. Peripheral blood lymphocytes cultured in vitro for 24 h in pokeweed mitogen were analyzed for cytokine production using the RT-PCR assay. Consistently elevated levels of IL-2 and IL- 12 in AL and PL cattle in pokeweed mitogen-stimulated cells was detected, while IFN-y was elevated in the AL but not the PL cattle. 0 1997 Elsevier Science B.V. Keywords: Bovine leukemia

virus; Cytokines;

RT-PCR; Polymerase

chain reaction

Abbreviations: BLV, Bovine leukemia virus; bp, Base pair; DEPC, Diethyl propionate carbonate; PBS, Fetal bovine serum; FITC, Flourescein isothiocyanate; IFWy, Interferon-gamma; IL, Interleukin; PBML, Peripheral blood mononuclear leukocyte; PMA, Phorbol myristic acetate; RT-PCR, Reverse transcriptase-polymerase chain reaction * Corresponding author. Tel: (916)752-2543; fax: (916)752-3349. e-mail: [email protected]. 0165-2427/97/$17.00 0 1997 Elsevier Science B.V. All rights reserved. PII SO165-2427(96)05727-3

40

R.G. Keefe et al. / Veterinary

Immunology

and Immunopathology

56 (1997) 39-51

1. Introduction

Bovine leukemia virus (BLV) is an oncogenic retrovirus and is the etiological agent responsible for the disease complex enzootic bovine leukosis (EBL). The disease causes significant economic problems for the dairy industry and is a relevant model for studying retroviral disease progression. BLV-infected cattle may remain clinically normal, classified as aleukemic (AL). Between 30 and 70% of infected cattle develop persistent lymphocytosis (PL), a polyclonal expansion of B-lymphocytes. Between 0.1 and 10% of infected cattle eventually develop lymphosarcoma (LS). The two latter phases, PL and LS, develop only after an extended latency period of 1 to 8 years (Burny et al., 1985; Thurmond et al., 1985). The mechanisms controlling maintenance of latency, lymphoproliferation in the PL phase, and initiation of tumorigenesis are unknown. There is little or no apparent virion production in vivo during disease progression (Kettman et al., 1982; Lagarias et al., 1989) and the virus contains no cellular oncogene that could drive proliferation. High levels of viral transcription and translation are obtained only upon placing infected cells in short term culture (Baliga et al., 1977; Burny et al., 1988; Powers et al., 1992). However, virus-specific antibody titres increase during the course of infection (Deshayes et al., 1980; Thurmond et al., 1985), suggesting ‘some’ viral antigen expression. Because BLV has no viral oncogene, and minimal viral antigen is being produced in vivo, alternative mechanisms, such as overproduction of B-cell growth promoting cytokines, could be central to the B-cell proliferation. Traditional analysis of cytokine gene expression has utilized bioassays, ELISAs, and Northern blotting, all of which suffer limitations due to lack of bovine-specific reagents in the bovine system and/or sensitivity. Semi-quantitative RT-PCR is an alternative method used to analyze cytokine gene expression (Dallman et al., 1991; Hutchinson et al., 1994; O’Garra et al., 1992; Covert et al,, 1995). We have developed an RT-PCR system that is semi-quantitative, based upon normalization of actin transcripts between samples. This normalization is made possible by determining at which cycle of the PCR amplification the plateau phase is reached, and performing subsequent PCRs at sub-plateau cycle number. Band intensity is then dependent upon original copy number of the target sequence. The volume of cDNA used in the actin PCR can be adjusted until relatively equal intensity bands are achieved on an agarose gel. This normalization process not only serves to confirm successful RNA extraction and reverse transcription, but also accounts for varying efficiencies inherent in these processes. Semi-quantitative PCR can compare relative levels of expression for a target gene between samples, without assessing absolute copy number, and does not require the use of radioisotopes or densitometry. The more qualitative nature of the assay is compensated for by the speed and wide range of application for any published sequence. The purpose of this study was to provide a functional phenotype of immune status by establishing a cytokine production profile in cells cultured from animals in different phases of BLV disease progression. This paper describes the application of the RT-PCR assay to determine the relative levels of cytokine mRNA in short term pokeweed-stimulated mononuclear leukocytes derived from noninfected (control) and BLV-infected (AL

R.G. Keefe et al./Veterinary

Immunology

and lmmunopathology

and PL) cattle. The possible contributions of such cytokine ment of persistent lymphocytosis is discussed.

56 (1997) 39-51

gene expression

41

to develop-

2. Materials and methods 2.1. Animals and flow cytometry Fifteen Holstein cows were included in the study: of these, five were seronegative for BLV, five were BLV positive-aleukemic (AL), and five were BLV positive-persistent lymphocytotic (PL). BLV infections was determined by serology: AGID test for the antibody specific for the BLV gp51 antigen as described (Thurmond et al., 1985), and identification of leukocyte-associated provirus by PCR. PCR primers specific for the tax region of the BLV genome were constructed spanning nucleotides 7734-808 1 (Sagata et al., 1985). BLV-positive cows were classified as AL or PL according to number of lymphocytes per ~1 of peripheral blood exceeding the 95% predicted number for a cow of that age (Thurmond et al., 1990). 2.2. Cell culture Peripheral blood mononuclear leukocytes were obtained in ACD vacutainer tubes and leukocyte subpopulations either analyzed by flow cytometry as described (Stott et al., 1991) or placed into culture. Percentages of mononuclear cell subsets were determined by staining with monoclonal antibodies as listed in Table 1. Samples were tagged with FITC-conjugated secondary antibodies and analyzed on a Becton-Dickinson FACStar Plus Flow cytometer at an excitation of 488 nm. Cells were cultured as previously described (Stott et al., 1991). Briefly, mononuclear cells were cultured at a density of 2 X lo6 ml-’ in MEM containing 10% FBS (Hyclone Inc., Logan, UT) for 18-24 h. Cells from each animal were initially cultured in PMA (10 ng ml-‘) and Ionomycin (400 ng ml-‘) for development of assay and use as a positive control, or in pokeweed mitogen (1 pg ml-‘) for the BLV study (Sigma, St. Louis, MO). Cells were harvested, washed twice in PBS, pelleted and supernatant aspirated prior to RNA extraction. 2.3. Reverse transcription-polymerase

chain reaction

Total RNA was extracted using RNAzol (TelTest Inc., Friendswood, TX). RNA pellets were resuspended in 0.5% SDS, and yield quantitated by measuring O.D. at 260 nm. cDNA was generated using the method of Reiner et al. (1993). Briefly, four pg of total RNA from each sample was resuspended in 9 ~1 of DEPC-treated water. Then 0.5 ~1 RNAsin @omega, Madison, WI) and 2 ~1 0.5 mg ml-’ random hexamer primer (Pharmacia, Upsala, Sweden) were added, and the mixture incubated at 65°C for 5 min, followed by 5 min on ice. This mixture was then added to a reaction mix containing 0.01 M DTT, 0.25 mM each dNTP (Boehringer-Mannheim, Indianapolis, IN), and 50 mM Tris-Cl pH 8.3, 75 mM KCl, 3 mM MgCl, (RT Buffer H, Gibco) and 200 units of Moloney-Murine Leukemia Virus Reverse Transcriptase (Gibco, Grand Island, NY), and

R.G. Keefe er al. / Veterinary immunology and Immunopathology 56 (1997) 39-51

42 Table

1

PCR Primers Cytokine

Size

Nucleotides

IL-2

457 bp

38-495

5’AGATACAACTC- 60 C/33 TTGTCTTGCC+ ) Anti-sense 5’AGTCATTGTTG-

IL-4

303 bp

129-432

Sense

IL-6

674 bp

51-725

Sense

IL-10

471 bp

23-504

Sense

IL-12

309 bp

320-629

Sense

IFN-),

184

Actin

390 bp 38-428

bp 296-480

Sequence

Annealing/ cycles

Sense

Sense

Sense

AGTAGATGC( -) 5’ CGTCCATGGACACAAGTGTGATA 5’ TTCCAAGAGGTCITTCAGCGTAC 5’ CCGCTTCACAAGCGCCTTCA 5’ CTGACCAGAGGAGGGAATGC 5’ GTTGCCTGGTCTTCCTGGCTG 5’ TATGTAGTTGATGAAGATGTC 5’AGGAAGATGGAATTTGGTCCA 5’ TCAATAAGCAGGCTCTCCTCA 5’ TTCAGAGCCAAATTGTCTCC 5’ CTGGATCTGCAGATCATCCA 5’ CCTTTTACAACGAGCTGCGTGTG 5’ACGTAGCAGAGCTTCTCCTTGATG

Reference

(Cerretti et al., 1986a)

55 C/38

(Heussler et al., 1992)

60 C/33

(Cludts et al., 1991)

60 C/30

(Hash et al., 1994)

60 C/33

(Zarlenga

65 C/3

65 C/29

1

et al., 1995)

(Cerretti et al., 1986b)

(Degen et al., 1983)

incubated at 37°C for 1.5 h. After reverse transcription, samples were incubated at 95°C for 4 min and the volume adjusted to 200 ~1 with TE buffer (pH 8). Plasmids for bovine actin (Genbank # KOO62) and IL-IO (UOO799) were kindly provided by Wendy Brown (Texas A&M University). Bovine IL-12 p40 (U11815) was kindly provided by Chris Howard (Institute for Animal Health, Compton, UK). IL-6 and 1FN-y were cloned into the T-A pcRI1 plasmid (Invitrogen, San Diego, CA) using PCR primers designed from published bovine sequences and sequenced with the Sequenase Kit (USB, Cleveland, OH) to confirm the identity as bovine. The plasmid controls were digested with EcoRI (Gibco) and agarose gel-purified using the QIAEX Kit (QIAGEN, Chatsworth, CA). Each 50 ~1 PCR contained l-10 ~1 of cDNA, 26.5-31.5 ~1 filter-sterilized deionized water, 50 mM KCl, 5mM MgCl,, 1OmM Tris-Cl pH 8.0 (Therm0 buffer, Promega), 0.2 n&l of each nucleotide, 50 pmol of each primer (Genset, San Diego, CA), and 2.5 units Tuq polymerase @omega). PCR were performed on a Perkin Elmer Thermocycler (Perkin Elmer, Norwalk, CT). Amplification conditions were 4 min at 95°C denaturation, followed by 35 cycles 1 min at 94” denaturation, 1 min at 65°C

R.G. Keefe et al. / Vererinary Immunology and Immunopathology

Table 2 Percentages

of mononuclear

43

56 (1997) 39-51

cell subsets a

Group

B-ceils (CD211 b

T-cells (CD2) ’

y8 T-cells *

Monocytes

Control BLV + AL BLV + PL

33% 43% 63%

42% 42% 23%

11% 6% 6%

5% 4% 5%

a Percentages determined by the average of five animals for each anti-CD21 monoclonal antibody CC21 (Naessens et al., 1990). kindly were stained using the anti-CD2 monoclonal antibody ILA-26 (Baldwin were stained using monoclonal antibody IL-A29 (Clevers et al., 1990). monoclonal antibody IL-A24 (Ellis et al., 1988).

’

group. b B-cells were stained using provided by Chris Howard. ’ T-cells et al., 1988). * Gamma-delta T-cells e Monocytes were stained using the

annealing, 1 min 30 s at 72°C extension followed by 7 min at 72°C extension. Annealing temperatures and cycle number varied according to cytokine, and are indicated in Table 2. 2.4. Southern hybridization Southern hybridizations were performed as described previously (Ferrick et al., 1989). Briefly, PCR samples were run on an 1.2% agarose gel, denatured for one hour (1.5 M NaCl, 0.5 M NaOH), and neutralized for 1 h (1.5 M NaCl, 0.5 M Tris-Cl). DNA was transferred by vacuum blotting (Vacugene XL, Pharmacia) to immobilon-N (Millipore, Bedford MA) in 10 X SSC for 1 h at 45 mm Hg. The membrane was prehybridized for 1 h at 65”C, and hybridized overnight at 65°C with a probe generated from bovine IL-12 p40. Probe was prepared with 45 ng EcoRI-digested, gel-purified insert and incubated 18 h at room temperature with 50 &i 32P dCTP (NEN/duPONT, Boston) and 17.2 units of KLENOW Fragment (G&co).

3. Results 3.1. The RT-PCR assay identifies multiple cytokine transcripts PCR primers specific for bovine sequences were designed from published sequences and conditions for annealing temperature and sub-plateau cycle number determined as listed in Table 1. To demonstrate the ability of the RT-PCR system to detect transcripts for multiple cytokines, and for use as a positive control, cDNA from PMA/Ionomycinstimulated peripheral blood mononuclear leukocytes was analyzed under maximum cycle number. Fig. 1 illustrates the RT-PCR assay in the PMA/Ionomycin-stimulated cell population transcribing multiple cytokines and compares them with the cloned cytokine plasmids. Treatment of PBMLs with PMA-Ionomycin induced transcription of IL-2 (Lane 2), IL-4 (Lane 3) IL-6 (Lane 4), IFN-y (Lanes 8 and 9), and IL-10 (Lane 11). IL-12 mRNA was not detected (Lane 13). The plasmid controls matched the

44

R.G. Keefe et al. / Veterinary Immunology and Immunopathology

1 2

3

4

5

6 7

8

56 (I 997) 39-51

9 10 11 12 13 14 15

Fig. 1, 1.2% Agarose gel demonstrating ability of RT-PCR to detect transcripts of multiple cytokines. Total RNA (4 pg) from PMA-Ionomycin-stimulated peripheral blood mononuclear leukocytes reverse-transcribed to cDNA compared with cloned cDNAs. PCR was performed at maximum conditions of 55°C annealing and 35 cycles. 100 base pair ladder (Lanes 1 and 151, IL-2 PCR of PBML cDNA (Lane 2), IL-4 PCR of PBML (Lane 31, IL-6 PCR of PBML (Lane 4) and cloned plasmid cDNA (Lane 51, IL-10 PCR of PBML (Lane 6) and plasmid cDNA (Lane 7). IFN of PBML (Lanes 8 and 9) and cloned plasmid cDNA (Lane 10). Actin PCR of PBML (Lane 11) and cloned cDNA (Lane 12), IL-12 PCR of PBML (Lane 13), distilled water control (Lane 14).

PMA-stimulated cDNA samples in predicted IL- 10, and P-Actin.

3.2. Selectioe cytokine mRNA expression

sizes of the PCR products for IFN-y,

in pokeweed-stimulated

IL-6,

cell cultures

No cytokine message was detected in any of the unstimulated freshly isolated peripheral blood mononuclear cells (data not shown). Therefore, we analyzed PBMCs stimulated with pokeweed mitogen to determine if activation of these cells might reveal different cytokine transcription patterns between infected and non-infected animals. The results of the pokeweed-stimulated cultures from the panel of dairy cows are illustrated in Fig. 2, Fig. 3, and Fig. 4. The initial actin PCR was performed using 5 ~1 of cDNA, and produced variable levels of actin message on an agarose gel (data not shown). Subsequent actin PCRs were performed with the volumes of cDNA adjusted such that the products were of relatively equal intensity on an agarose gel (Fig. 2A, Lanes 1-15). The same adjusted volumes of cDNA were used in all subsequent experimental cytokine PCRs. Lanes 16-18 of Fig. 2A demonstrate the effect of cycle number on actin band intensity, using the PMA/Ionomycin-stimulated control cDNA. It can be seen that maximum band intensity of actin is not achieved until 35 cycles (Lane 18). Fig. 2B demonstrates the results of interleukin-2 PCR in pokeweed-stimulated cell cultures. The levels of the IL-2 cDNA were considerably higher in the BLV-infected AL and PL animals (Lanes 6-15) as compared with the negative controls (Lanes l-5). Fig. 3 shows the results of interleukin-12 PCR, using primers to the p40 subunit. Fig. 3A shows the agarose gel of IL- 12 PCR performed at 33 cycles. The levels of the IL- 12 cDNA are consistently higher in the infected animals, AL and PL (Lanes S-17) than in the negatives (Lanes 2-6). In addition, a PCR was performed on the mouse IL-12 p40

R.G. Keefe et al. / Veterinary

Immunology and Immunopathology

56 (1997) 39-51

45

(a) 600bp IOObp -

M w

6 7

Ml2345

8 9101112131415 -+

600bp 100bp -

M 6 7 8 9 101112131415 Fig. 2. (A) RT-PCR demonstrates actin transcripts of pokeweed mitogen-stimulated pereipheral blood mononuclear cells normalized at sub-plateau cycle number of 30. 100 base pair molecular weight marker CM), BLV-negative (Lanes l-5). BLV-positive (AL) (Lanes 6-10) and -positive (PL) (Lanes 1 l-151, plasmid control (+) distilled water control (-). Lanes 16-18 are PCR of cDNA from PMA-stimulated PBMLs performed at 28 cycles (Lane 18), 30 cycles (Lane 191, and 35 cycles (Lane 20). (B) IL-2 RT-PCR of pokeweed mitogen-stimulated cDNA. Samples for Lanes 1- 15 are as listed above. Lane ( - ) is the water control and Lane ( + ) is PMA-stimulated

cDNA.

plasmid, resulting in the expected size band. To confirm that the PCR reaction is analyzed at a linear portion of the amplification, IL-12 PCR was repeated at 19 cycles and a Southern hybridization performed using bovine IL-12 ~40. The results of this experiment are shown in Fig. 3B, which represents a repeat of the IL-12 PCR using two BLV-negative and two BLV-positive (AL) cDNAs at 33 cycles (Top) and Southern Blot of 20 cycles (bottom). A comparison of the two experiments illustrates that the banding pattern is indistinguishable at 33 cycles or 20 cycles. This establishes that the PCR at 33 cycles is at linear phase and the data generated at that cycle number is indeed valid.

46

R.G. Keefe et al. / Veterinary immunology and Immunopathology

56 (I 997) 39-51

Fig. 4 demonstrates the results of interferon-gamma PCR. The BLV-negative animals produced variable amounts of IFN-7 message (Lanes l-5), the BLV-positive (AL) animals produced the greatest levels of IFN-y message (Lanes 6- 101, and the BLVpositive (PL) animals produced the least amounts of IFN message (Lanes 11- 15). Actin

(a)

123456

-+

600 bp100 bp->

7 8 9 10 11 12 13 14 15 16 17

-6OObp -1OObp

1234+-

R.G. Keefe et al / Veterinary

(a)

Ml

Immunology

2

345

and Immunopathology

-

56 (1997) 39-51

P

41

+

600 bp --_) 100bp +

600 bp + 100bp --_) M 6 7

8

9

10 11 1213 14 15 M

(W 1 2 3456789M

-6OObp - 10Obp

Fig. 4. (A) RT-PCR of IFN-y from pokeweed-stimulated PBML cDNA generated from BLV-negative cows (Lanes l-5). BLV-positive AL cows (Lanes 6-101, and BLV-positive PL cows (Lanes I l- 15). M is the 100 bp ladder, (-I is the distilled water control, (+) is the cloned IFN-y cDNA positive control, and P is the PMA-stimulated cDNA positive control. (B) Titration of interferon-gamma plasmid. 1.2% agarose gel demonstrating levels of sensitivity in the interferon-gamma PCR. Conditiond for this PCR are as in Fig. 4. Amount of cDNA in PCR is 6.5 pg (Lane II, 65 ng (Lane 2),0.65 ng (Lane 3). 65 pg (Lane 4), 6.5 pg (Lane 5). 0.65 pg (Lane 6). 65 fg (Lane 7). 6.5 fg (Lane 8), distilled water (Lane 9).

Fig. 3. (A) RT-PCR of IL-12 p40 from pokeweed-stimulated PBML. cDNA generated from BLV-negative cows (Top row; Lanes 2-6). BLV-positive (AL) cows (Bottom; Lanes S-12), and BLV-positive (PL) cows (Bottom; Lanes 13- 17). Lanes I and 7 are the 100 bp marker. (-1 is the water control, and (+ ) is murine ~40 plasmid clone using the bovine-specific IL-12 primers. > indicates predicted IL-12 PCR band sire of 300 base pairs. (B) Southern hybridization of IL-12 PCR. Top half of figure shows a repeat of the IL-12 PCR experiment using four cDNA samples shown in (A). Lanes 1 and 2, BLV-negative cDNA; Lanes 3 and 4, BLV-positive cDNA; Lane 5, bovine IL-12 p40 plasmid; Lane 6 distilled water; M is 100 bp marker. PCR performed at 33 cycles. Bottom half of figure shows the PCR repeated at 20 cycles, run on an agarose gel and transferred to Immobilon membrane and hybridized with a bovine IL-12 ~40 probe. The exposed autoradiograph is shown.

48

R.G. Keefe et al. / Veterinary

Immunology

and Immunopathology

56 (1997) 39-51

levels for the IL-12 and IFN-y samples are as shown in Fig. 2A. The PCR for interferon-gamma was also repeated at 19 cycles and transferred to membrane and shown to reflect the same pattern of as the agarose gel of the 29 cycles (data not shown). Fig. 4B shows an agarose gel of a titration of the interferon-gamma plasmid to determine the level of sensitivity of the PCR reaction in discriminating differences among DNA templates. The most intense bands (Lane 2, 65 ng) is 100000 times more concentrated than the weakest band (Lane 8, 6.5 fg). Thus the PCR assay for interferongamma can discriminate at least lOOOO-fold differences among the amount of DNA in a reaction. A similar titration was performed for IL-12 PCR and similar result obtained, with the level of sensitivity approximately 1:lOOOO (data not shown).

4. Discussion Analysis for cytokine mRNA in freshly isolated PBMCs did not detect any message; this was not unexpected, as the peripheral blood mononuclear cells are not typically activated. All subsequent experiments were conducted on pokeweed mitogen-stimulated cell cultures. Such culture conditions facilitate non-specific activation of T- and B-cell subpopulation via cell surface receptors (Yokoyama et al., 1979). The activation can reveal the potential for these cells to produce particular cytokines. No obvious differences between BLV-infected and non-infected animals in relative levels of IL-4 and IL- 10 were observed. Interleukin-6 was produced in slightly higher levels in some of the BLV-positive animals in the pokeweed cultures, but was not seen in all of the infected animals. Pokeweed mitogen induced IL-2 (Fig. 2) and IL-12 (Fig. 3) to a greater extent in all of the BLV-positive (AL and PL) cattle as compared with the non-infected controls. Some of the uninfected controls expressed low levels of IL-2 message, but the levels in the BLV-infected cultures were markedly higher. This is particularly dramatic when one considers how relatively few T-cells there were in the BLV-positive PL samples compared with the non-infected controls (see Table 2). The elevated levels of IL-2 observed correlate with previous reports (Sordillo et al., 1994; Stone et al., 1995) that found elevated levels of IL-2 protein and IL-2 receptor in lymphocyte cultures from BLV-positive animals. The IL-12 findings were equally dramatic. While a few (two of live) of the non-infected cultures produced IL-12 message at levels equal to the BLV-infected animals, all of the BLV-infected cultures produced IL-12 mRNA. The IL-l 2 PCR was repeated at 20 cycles and a Southern hybridization performed using bovine IL-12 ~40. The resulting autoradiograph indicates even more dramatic differences between infected and non-infected cell cultures. This finding confirms that the results obtained from the PCR performed at 33 cycles are valid and indicative of the immune status of the mononuclear cells in the cultures. Pokeweed induced IFN-7 mRNA dramatically in the BLV-negative and BLV-positive (AL) animals, but only slightly in the BLV-positive (PL) animals. IL-12 is a known activator of IFN-y (Wolf et al., 1994) and one would expect significant IFN-7 production in the cultures producing IL-12. The lower levels of IFN-7 message in the PL cultures is probably observed because these cultures contain far fewer T-cells than the non-infected or the AL cultures (Table 2). PCR was performed on serially diluted

R.G. Keefe et al. / Veterinary

Immunology

and Immunopatholo~y

56 (1997) 39-51

49

interferon-gamma plasmid under the same conditions as in Fig. 4A and demonstrates the difference between the brightest bands and the faintest bands is at least lOOOO-fold. The difference between the faint bands seen in Lanes 1l- 15 (BLV-PL) and the brightest bands in Lanes 6-10 (BLV-AL) of Fig. 4A is therefore significant. The underlying cause of persistent lymphocytosis is unknown. Multiple hypotheses to explain the mechanisms exist. One hypothesis, prompted by the presence of virus-specific antibodies in the infected animals, suggests that viral antigen production stimulates lymphoproliferation. However, in this scenario one would also expect a T-cell expansion, as viral antigens also activate these cells. Furthermore, minimal viral expression in vivo has been observed (Heeney et al., 1992). Another possibility involves direct viral influence upon the B-cells or other infected cells. BLV is closely related to another oncogenic retrovirus, human T-cell leukemia virus (HTLV-I and II). The two viruses are similar at the nucleotide level and share nearly identical genomic organization and disease progressions. HTLV has been shown to activate several cellular genes, including the IL-2 and IL-2 receptor genes, promoting T-cell proliferation in an autocrine fashion (Green et al., 1990; Ruben et al., 1988). Due to the similar nature of the two viruses, it seems plausible that BLV may act in a similar fashion. In BLV infection, one would predict a B-cell growth cytokine and or cytokine receptor to be activated (IL-4, IL-6, IL-lo). With the findings that T-cells and monocytes may also be targets for BLV infection (Heeney et al., 1992; Stott et al., 1991; Williams et al., 19881, the viral-mediated production of lymphoproliferative factors could occur through these accessory cells, expanding the list of possible cytokines that could be produced in this fashion. In this study, we were not able to detect aberrant B-cell growth cytokine message in the peripheral blood cells. The IL-2 and IL- 12 detected in this study should not account for the dramatic predominance of B-cells in blood of BLV-positive cattle. Although IL-4, -6, and -10, were detected in the peripheral blood cell cultures of some BLV-positive animals, there was no association with BLV-infection. This study has taken a step towards defining cytokine transcription associated with BLV disease progression. RT-PCR is a quick and sensitive method for analyzing cytokine gene transcription and has demonstrated the association of three cytokines in BLV infection. This assay cannot attempt to quantitate levels of mRNA expression between animals in a study group, but rather demonstrates general trends among preparations containing relatively similar amounts of cDNA. The results presented here justify future studies in which bioactive cytokine protein production is analyzed in leukocyte sub-populations on a single cell basis and correlated with virus. In addition, analysis of organized lymphoid tissue may be important in elucidating mechanisms of pathogenesis not observed in the peripheral blood. Acknowledgements This work was supported in part by NIH grant lROlCA5647801 Al and funds provided by the U.S. Department of Agriculture under the Animal Health Act of 1977, Public Law 95-113. The authors would also like to thank Wendy Brown and Chris Howard for generous donations of reagents, and Bernadette Taylor for help in preparing the manuscript and technical support with the experiments.

50

R.G. Kecfe et al. / Veterinary

Immunology

and Immunopathology

56 (1997) 39-51

References

Baldwin, C.L., Machugh N.D., Ellis, J.A., Naessens, J., Newson, J. and Morrison, WI., 1988. Monoclonal antibodies which react with bovine T-lymphocyte antigens and induce blastogenesis: tissue distribution and functional characteristics of the target antigens. Immunology, 63: 439-446. Baliga, V. and Ferrera, J.F., 1977. Expression of the bovine leukemia lymphocytes. Proc. Sot. Exp. Biol. Med., 156: 388-391.

virus and its internal antigen in blood

Bumy,

A., Bruck, C., Cleuter, Y., Couez, D., Deschamps, J., Gregoire, D., Ghysdael, K.J., Kettman, R., Mammerickx, M., Marbaix, G. and Portetelle, D., 1985. Bovine leukemia virus and enzootic bovine leukosis. J. Vet. Res., 52: 133-144.

Bumy, A., Cleuter, Y., Kettman, R., Mammerickx, M., Marbaix, G., Potetelle, D.. van der Broeke, A., Willems, L. and Thomas, R., 1988. Facts and hypotheses derived from the study of an infectious cancer. Vet. Micro., 17: 197-218. Cerretti, D.P., McKereghan, K., Larsen, A., Cantrell, M.A., Anderson, D., Cosman, D., Gillis, S. and Baker, P.E., 1986. Cloning, sequence, and expression of bovine interleukin 2. Proc. Natl. Acad. Sci. USA, 83: 3223-3227. Cerretti, D.P., McKereghan, K., Larsen, A., Cosman, D., Gillis, S. and Baker, P.E., 1986. Cloning, sequence, and expression of bovine interferon-gamma. J. Immunol., 136: 4561-4564. Clever% H., MacHugh, N.D., Bensaid, A., Dunlap, S., Baldwin, C.L., Kaushal, A., Iams, K., Howard, C.J. and Morrison, WI., 1990. Identification of a bovine surface antigen uniquely expressed on CD4-CDI-T cell receptor gamma/delta+ T lymphocytes. Eur. J. Immunol., 20: 809-817. Cludts, I., Kettman, R., Cleuter, Y., Bumy, A. and Droogmans, L., 1991. Nucleotide sequence of interleukin-6 cDNA. DNA Sequences, 2: 41 I-413. Covert, J. and Splitter, G.. 1995. Detection of cytokine transcriptional profiles from bovine mononuclear cells and CD4 + lymphocytes by reverse transcriptase polymerase chain reaction. Vet. Immunol. Immunopathol., 49: 39-50. Dallman, M.J. and Porter, A.C.G., 199 1. Semi-quantitative PCR for the analysis of gene expression. In: M.J. McPherson, P. Quirke and G.R. Taylor @ditorsl. PCR: A practical approach. Oxford University Press, NY, pp. 215-224. Degen, J.L., Neubauer, M.G., Freizner, Degen, S.J., Seyfreid, C.E. and Morris, D.R., 1983. Regulation of protein synthesis in mitogen-activated bovine lymphocytes: analysisofactin-specific and total mRNA accumulation and utilization. J. Biol. Chem., 258: 12153-12162. Deshayes, L., Levy, D., Parodi, A.L. and Levy, J., 1980. Spontaneous immune response of bovine leukemia virus-infected cattle against five different viral proteins. Int. J. Cancer, 25: 503-508. Ellis, J.A., Davis, W.C., MacHugh, N.D., Emery, D.L., Kaushal, A. and Morrison, WI., 1988. Differentiation antigens on bovine mononuclear phagocytes identified bymonoclonal antibodies. Vet. Immunol. Immunopathol., 19: 325. Ferrick, D.A., Sambhara, S.R., Balhausen, W., Iwamoto, A., Pircher. H., Walker, CL., Yokoyama, W.M., Miller, R.G. and Mak, T., 1989. T Cell function and expression are dramatically altered in T Cell receptor V6 1. I J64C 64 transgenic mice. Cell, 57: 483-492. Green, P. and Chen, I.S.Y., 1990. Regulation of human T cell leukemia virus expression. FASEB J., 170: 169-175. Hash, S.M., Brown, W.C. and Ficht, A.R., 1994. Cloning of a full-length cDNA encoding bovine interleukin-IO using the polymerase chain reaction. Gene, 139: 2.57-261. Heeney, J.L., Valli, P.J.S., Jacobs, R.M. and Valli, V.E.O., 1992. Evidence for bovine leukemia virus infection of peripheral blood monocytes and limited antigen expression in bovine lymphoid tissue. Lab. Invest., 66: 608-617. Heussler, V.T., Eichom, M. and Dobbelaere, D.A., 1992. Cloning of a full-length cDNA encoding bovine interleukin-4 by the polymerase chain reaction. Gene, 114: 273-278. Hutchinson, L.E., Stevens, M.G. and Olsen, SC., 1994. Cloning bovine cytokine fragments and measuring bovine cytokine mRNA using the reverse transcription-polymerase chain reaction. Vet. Immunol. Immunopathol., 44: 13-29. Kettman, R., Couez, D. and Bumy, A., 1982. Leukemogenesis by bovine leukemia virus: Proviral DNA

R.G. Keefe et al. / Veterinary

Immunology

and Immunopathology

56 (1997) 39-51

51

integration and lack of RNA expression of viral long terminal repeat and 3’ proximate cellular sequences. Proc. Nat]. Acad. Sci. USA, 79: 2465-2469. Lagarias and Radke, K., 1989. Transcriptional activation of bovine leukemia virus in blood cells from experimentally infected, asymptomatic sheep with latent infections. J. Viral., 63: 2099-2107. Naessens, J., Newson, J., MacHugh, N., Howard, C.J., Parsons, C.J. and Jones, B., 1990. Characterization of a bovine leucocyte differentiation antigen of 145000 MW restricted to B lymphocytes. Immunology, 69: 525. O’Garra, A. and Vieira, P., 1992. Polymerase chain reaction for detection of cytokine gene expression Curr. Opinion Immunol., 4: 21 I-215. Powers, M. and Radke, K., 1992. Activation of Bovine Leukemia Virus transcription in lymphocytes from infected sheep: rapid transition through early to late gene expression. J. Virol., 66: 4769-4777. Reiner, S.L., Zheng, S., Cony, D. and Locksley, R.M., 1993. Constructing polycompetitor cDNAs for Quantitative PCR. J. Immunol. Methods, 165: 37-46. Ruben, S., Poteat, H., Tan, T., Kawakami, K., Roeder, R., Haseltine, W. and Rosen, C., 1988. Cellular transcription factors and the regulation of IL-2 receptor gene expression by the HTLV-I tax gene product. Science, 241: 89-92. Sagata, N., Yasunaga, T., Tsuzuku-Kawamura, J., Oshishi, K., Ogawa, Y. and Ikawa, Y., 1985. Complete nucleotide sequence of the genome of bovine leukemia virus: its evolutionary relationship with other retroviruses. PNAS USA, 82: 677-68 I. Sordillo, L.M., Hicks, CR. and Pighetti, G.M., 1994. Altered Interleukin-2 production by lymphocyte populations from bovine leukemia virus-infected cattle. P.S.E.B.M., 207: 268-273. Stott, M., Thurmond, M., Dunn, S.C., Osbum, B. and Stott, J.L., 1991. Integrated bovine leukosis virus proviral DNA in T helper and T cytotoxic/suppressor lymphocytes. J. Gen. Virol., 72: 307-315. Stone, D.M., Hof, A.J. and Davis, W.C. 1995. Up-regulation of IL-2 receptor n and MHC class 11 expression on lymphocyte subpopulations from bovine leukemia virus infected lymphocytotic cows. Vet. Immunol. Immunopathol., 48: 65-76. Thurmond, M.C., Holmberg, CA. and Picanso, J.P., 1985, Antibodies to bovine leukemia virus and presence of malignant lymphoma in slaughtered California dairy cattle. J. Nat. Cancer Inst., 74: 71 l-7 14. Thurmond, M.C., Carter, R.L., Picanso, J.P. and Stralka, K., 1990. Upper normal prediction limits of lymphocyte counts for cattle not infected with bovine leukemia virus. Am. J. Vet. Res., 51: 466-470. Williams, D., Barta, 0. and Amborski, G.F., 1988. Molecular studies of T-lymphocytes from cattle infected with bovine leukemia virus. Vet. Immunol. Immunopathol., 19: 307-323. Wolf, S.F., Sieburth, D. and Sypek, J., 1994. lnterleukin 12: A key modulator of immune function. Stem Cells, 12: 154- 168. Yokoyama, K. and Osawa, T., 1979. The collaboration of T-cell subsets in the mitogenic stimulation of purified B-cell subpopulations. Immunology, 38: 789-796. Zarlenga, D.S., Canals, A., Aschenbrenner, R.A. and Gasbarre, L.C., molecular cloning of cDNA encoding the small and large subunits Biophys. Acta, 1270: 215-217.

1995. Enzymatic amplification and of bovine interleukin 12. Biochim.