Differential expression and regulation of cytokine mRNAs in normal human CD45R T cell subsets

DIFFERENTIAL EXPRESSION AND REGULATION OF CYTOKINE mRNAs IN NORMAL HUMAN CD45R T CELL SUBSETS Ian Beckman,l

Kathryn Shepherd,l Katina Dimopoulos,l Frank Firgaira,3 John Bradley’

Michael Aherq2

Cytokine mRNA expression was analyzed by reverse transcriptase (RT)/PCR in extensively purified normal peripheral CD4+CD45R T cell subsets. Both CD45RA+ and CD45 RO+ populations produced mRNAs for interleukin (IL)-2, IL-2 receptor (alpha chain), IL-6 receptor and tumour necrosis factor (TNF)-beta within 3-4 h of activation. Whilst IL-3 and RANTES were also expressed in both subsets, CD45RO+ cells were clearly the- major producers of these cytokines. In contrast, mRNA transcripts for IL-1 alpha, IL-4, IL-5, IL-6, IL-lo, interferon gamma (IFN-y) and the T cell receptor for IL-1 were almost exclusively induced in CD45RO+ T cells. A population of CD4+ T cells co-expressing intermediate levels of both CD45RA and CD45R0, namely CD45RA+/CD45RO+, appeared to be the major producers of IL-6. Addition of cycloheximide (CHx) 4 h after T cell activation resulted in substantial superinduction of IL-2 mRNA in the CD4+CD45RO+ population but had little effect on CD4+CD45RA+ cells. Taken together, these results show that normal CD4+CD45R T cell subsets exhibit distinct cytokine mRNA profiles and that these differ from the patterns displayed by Thl and Th2 type T helper clones. Furthermore, they suggest for the first time that IL-2 mRNA turnover is differentially regulated in CD45R T cell subsets.

CD45 is a major surface receptor found on haemapoetic cells. It comprises two extracellular domains which are heavily glycosylated, a single transmembrane region and a highly conserved cytoplasmic tail.’ CD45 is a member of the protein tyrosine phosphatase family and in T cells plays a major role in antigeninduced signal transduction.2 Multiple isoforms of CD45, with molecular weights from about 220 kDa to 180 kDa are generated by the alternate splicing of three exons (4,5 and 6; designated A, B and C), each encoding approximately 50 amino acids within the N-terminal extracellular domain.3,4 Thus, eight different transcripts derived from exons, A, B and C are possible (i.e. ABC, AB, AC, BC, A, B, C and one lacking all three, namely RO). Differential isoform expression on T cells From the Departments of Clinical Immunology,’ Medicine’ and Haematology,3 Flinders Medical Centre, Bedford Park, South Australia, 5042. Correspondence to: Dr Ian Beckman, Clinical Immunology, Flinders Medical Centre, Bedford Park, South Australia 5042. Received 14 June 1993; accepted for publication 17 August 1993 @ 1994 Academic Press Limited 1043-4666/94/020116+08 $08.00/O KEY

116

WORDS:

Cytokine

mRNAs/PCR/T

cell subsets

appears to correlate with prior antigenic exposure and function. Naive or unprimed CD4+T cells isolated from peripheral blood display the higher molecular weight isoforms while memory cells predominantly express the isoform lacking exons A, B and C. These subsets are referred to as CD45RA+ and CD45RO+ respectively. 5,6 Accumulating evidence indicates that CD4+CD45RA+ and CD4+CD45RO+ T cells display different functional and migratory properties. For example, CD45RA T cells function as inducers of cytotoxic CD8+ T cells and migrate from blood to lymph nodes via high endothelial venules. CD45RO+ cells, on the other hand, migrate to the lymph via tissues, possess the capacity to respond to recall antigen and provide B cell helper function.‘,’ Whilst they represent non-overlapping subsets, a proportion of resting peripheral blood T cells express intermediate levels of both CD45RA and CD45RO isoforms on the cell surface.‘-l2 Murine T helper cell clones are subdivided into two functionally distinct cell groups, namely Thl and Th2, with each subset displaying distinctive cytokine profiles.13 Thl type cells secrete IL-2, IFN-y and TNF-P while the reciprocal Th2 subset produces IL-4, IL-5, IL-6 and IL-lo. Both subsets secrete IL-3, GMCYTOKINE,

Vol.

6, No.

2 (March),

1994: pp 116-123

Cytokine expression in normal human T cells / 117

CSF and TNF-a. Allergens or helminths preferentially induce a Th2 type T cell response, characterized by high levels of IL-4 and IL-5, IgE and eosinophilia. Infection with intracellular bacteria, on the other hand, elicits a Thl response with IL-2, IFN-y and IgG2a production, delayed type hypersensitivity and macrophage activation. l4 Although analogous human helper clones have recently been reported,15 many human CD4+T cell clones show overlapping and heterogeneous cytokine profiles. 16,i7 In this report we have utilized the reverse transcriptase (RT)/PCR technique to provide a comprehensive analysis of cytokine gene expression at the mRNA level in purified peripheral human T cell subsets isolated on the basis of differential CD45 isoform expression.

890 * 740 * 680 + 590 ) 530 -

380 +

d0

d3

d0

II CD 45 RO+ Figure 1. RT/PCR analysis of CD45 by resting and activated CD4+CD45RA+ cells.

RESULTS RTIPCR Analysis of CD45 mRNA Transcripts Expressed by Resting and Activated CD4 + CD4SZU + and CD4+ CD45RO -I- T cells Peripheral blood CD4+CD45R T cell subsets were isolated by negative immunoselection. Purified T cells, treated with anti-CD8, anti-CD16 and antiCD45RA or anti-CD45RO mAbs, were ‘panned’ on goat anti-mouse IgG coated plates to remove CD8+, CD16+ cells and CD45RO+ or CD45RA-t cells respectively, as described in Materials and Methods. Cells were either used immediately to prepare mRNA, or activated in culture through CD2 and CD28 using the anti-CD2 mabs Tllz + Tlls and 9.3 (anti-CD28) for 3 days before RT/PCR analysis. PCR primers (corresponding to exon 2 and exon 9 of CD45) were chosen to amplify all cDNA fragments derived from the differentially spliced CD45 mRNA transcripts (see 18). As shown in Fig. 1, purified resting (do) CD45RA+ and CD45RO+ T cells clearly showed different CD45 transcript profiles. CD45RO-t cells produced just two main products of relatively low size [approximately 380 and 530 base pairs (bp)] corresponding to transcripts RO and B/C. In contrast, resting CD45RA+ T cells expressed the higher size transcripts ABC (890 bp), AB/AC (740 bp), BC (680 bp) and B/C (530 bp). RO was virtually undetectable in this population. However, striking changes in this profile occurred when CD45RAS T cells were activated for 3 days (d3). Large increases were seen in the relative amounts of RO, B/C and A while transcripts ABC, AB, and AC almost disappeared. This resulted in a CD45 mRNA profile virtually identical to activated CD45RO+ cells.

d3

CD 45 RA+ mRNA

transcripts expressed and CD4+CD45RO+ T

Subsets were isolated from purified resting peripheral T cells by negative immunoselection and used immediately or activated for 3 days through CD2 and CD28 using anti-Tll, and anti-Tll, and mAb 9.3. Resting T cells, 10’ (do) or activated T cells (d3) from each population were subjected to RTiPCR analysis using primers corresponding to exon 2 and exon 9 of the CD45 gene.ta PCR products were subjected to gel electrophoresis and stained with Et Br. The arrows refer to the size of the PCR products in base pairs. Each lane represents 20% of the amplified products.

Differential Induction of Cytokine mRNAs in CD4+CD45R T Cell Subsets Negatively immunoselected CD4SCD45RAS and CD4+CD45RO+ peripheral T cell subsets were activated in vitro with mAbs Tllz + Tlls (1:lOOO ascites) and 1 rig/ml PMA, or medium alone. Cytoplasmic RNA was extracted after 3 h and subjected to RT / PCR analysis. It can be seen from the pairwise comparisons shown in Fig. 2, which are representative of at least 10 individual normal blood donors, that transcripts for IL-4, IL-5, IL-6 and IL-10 were selectively induced in CD45RO+ cells. Whilst both subsets expressed IL-2, IL-3 and IFN-?I, IL-3 was preferentially expressed in CD45RO+ T cells. All the above genes were silent in unactivated T cells. A similar, albeit weaker pattern was seen in T cells stimulated with mAb OKT3 (anti-CD3)+ PMA (data not shown). It was unlikely that NK cells were contributing to the IFN-7 product in the CD45RA population because the CD4+ T cell preparations were vigorously depleted of CD16-t cells to the extent that both subsets were negative for CD16 and indeed, CD14 and CD19 by PCR (data not shown). However, it is clear from the literature’-l2 and from our own studies (unpublished data and Fig. 3), that a proportion of

CYTOKINE,

1

2

1

IL-2

2

1

IL-3 Figure 2. A CD4+CD45RO+

2

1

IL-4

representative T cells.

2

1

IL-5

profile

of

cytokine

2

1

IL-6 mRNA

Vol.

6, No.

2 (March

2 IFN-?/

expression

in

purified

CD4+CD45RA+

and

Each subset was negatively selected by antibody panning and then activated in culture with mAbs T1lZ + Tll, (1:lOOO) and PMA (1 rig/ml). After 3 h, cytoplasmic RNA was extracted from lo6 cells and subjected to RT/ PCR analysis to determine cytokine induction using the corresponding primers. For each cytokine examined, tracks 1 and 2 represent Et Br stained PCR products from CD4+CD45RA+ T cells and CD4+CD45RO+ T cells, respectively.

CD45RA Figure 3. Flow CD4+CD45RO+

microfluorimetry peripheral blood

FitC + sorting of CD4+CD45RAhi+. CD4+CD45ROhi+ T cells using three colour immunofluorescence.

and

CD4+CD45RA+/

Purified T cells were first stained with OKT4 and PE-sheep anti-mouse IgG. Unoccupied sites were blocked with normal mouse serum before addition of FITC conjugated anti-CD45RA and biotinylated UCHLl. After further incubation, biotinylated UCHLl binding was detected by the addition of TRI-COLOUR. The stained cells were then washed prior to sorting on a FACSTAR cell sorter under sterile conditions, first gating on the CD4+ population. Subsequent gates were chosen to separate three distinct populations based on staining reactivity with UCHLl and anti-CD45RA. Gate R3 represents CD45RAhi+cells; gate R4 represents CD45ROhi+ cells and gate R5 represents the double positives with intermediate staining, namely CD45RA+/ CD45RO+.

1994:

116-123)

Cytokine

resting CD4+ T cells co-express intermediate levels of CD45RA and CD45RO on the cell surface. These double positive cells, which can form a continuum with the CD45RA single-positive population, may produce IFN-?I. ‘” To address t hi s q uestion, we used three colour immunofluorescence and flow cytometry to positively sort three discrete CD4+ T cell populations; CD45RAhi-t (cells expression high amounts of surface CD45RA and little if any CD45RO); CD45ROhi+ (CD45RO high positive cells expressing low to negligible amounts of CD45RA) and cells coexpressing intermediate levels of both, namely CD45RA+/CD45RO+ (see Fig. 3). Each population was then stimulated with anti-CD2 mAbs + PMA for 4 h prior to RT/PCR analysis. It can be seen from Fig. 4 that IFN-y transcripts were strongly induced in the CD45ROhi+ population and to a lesser extent in the but were not detected in double positives, CD45RAhi+ T cells. The same result was seen in cells activated for 20 h (data not shown). Thus the strong IFN-y signal detected in the negatively selected CD45RA+ population (see Fig. 2) was most likely due to the presence of CD45RA+/CD45RO+ cells. mRNAs for IL-la, IL-10 and the T cell receptor for IL-1 were almost exclusively induced in the CD45ROhi+ subset. On the other hand, all three populations produced mRNA for IL-2, IL-6 receptor, TNF-B, IL-3 and RANTES (albeit IL-3 and TNF-B were weakly expressed in the double positive population and RANTES weakly in CD45RAhi+ T cells). Only the CD45RAhi+ and CD45ROhi+ populations were tested for IL-2 receptor (alpha chain) mRNA expression and both were found to be positive. Interestingly, IL-6 mRNA was preferentially expressed in the CD45RAKD45RO population. IL-7 mRNA was not detected in any subset, either at 4 h or 20 h postactivation (data not shown). Beta-actin was included to act as an internal control for the RT/PCR and shown to be similar in all groups. Finally, it can be seen that the CD45RA+/ CD45RO+ population expressed a somewhat intermediate CD45 mRNA transcript pattern in that both the RO and the ABC transcripts were weakly expressed.

Differential Effect of Cycloheximide [CHx] on IL2 mRNA Expression in CD4 + CD45R T cell Subsets Short-lived mRNAs, particularly IL-2, can be superinduced (stabilized) by CHx when the protein synthesis inhibitor is added to cells several hours after activation.i9,*’ In addition to confirming this finding, we found that CHx caused a substantial increase in IL-2 mRNA expression in CD4+CD45RO+ T cells

expression

in normal

1 2 3 l-Lf--LL-----J31 actin

1

2

3

human

1

IL-2

,I IL-3

1 -I23 IL-6

IL-6r

3

2

IL-10

ll2

i 1119

IFN-y

Ill2

TNF-t3

2

T cells

31

M

IL-lr

2

3 IL-2r

IL-lU

-1 CD 45 Figure sorted

4. Differential expression CD4+CD45R T cell subsets.

RANTES of cytokine

mRNA

in positively

Purified CD4+T cells were positively sorted into three discrete populations namely, CD45RAhi+, CD45ROhi+ and cells expressina intermediate levels of both isoforms CD45RA+/CD45RO+ as deicribed in the legend to Fig. 3. Each population was activated through CD2 for 4 h using mAbs Tl l2 + Tl l? and PMA (1 ngiml) and subjected to RTiPCR analysis using the corresponding primers for cytokines and CD45 as described in the legend to Fig. 1. For each cytokine examined, track 1 represents CD45RAhi+T cells; track 2, CD45ROhi+T cells and track 3, CD45RA+/CD45RO+T cells. M is a lane containing markers.

but had little effect in CD4+CD45RA+ T cells despite the fact that both subsets produced similar levels of IL-2 mRNA in the absence of CHx. This was illustrated using semi-quantitative PCR (see Fig. 5). In these particular experiments several samples (8~1) were taken from each PCR reaction mix at predeter-

120 I Beckman et al.

CYTOKINE,

Vol.

6, No.

2 (March

1994:

116-123)

4 IL-2

27

29

CD 45 RA+

31

27

29

CD 45 RO+

Figure 5. Differential effect CD4+CD45RO+ T cells.

of CHx

31

27

29

31

PCR cycle CD 45 RA+/CHX treatment

on IL-2

mRNA

27

29

31

M

CD 45 RO +/CHX accumulation

in

CD4+CD45RA+

and

Cells were activated at 1 x lO%nl with mAbs Tll, + Tll, and 20 units/ml recombinant IL-2 (Boehringer, Australia). After 4 h, medium or CHx (Sigma) (20 &ml) was added to appropriate wells and the cultures incubated for a further 20 h. Cytoplasmic RNA was extracted and converted into cDNA before being subjected to semi-quantitative PCR. That is, samples (8 ~1) were taken at 27,29 and 31 cycles from each PCR mix before the predetermined reaction plateau was reached and analyzed by agarose electrophoresis and ET Br staining.

mined cycles (27, 29 and 31) to coincide with the exponential phase of the reaction and before plateau. All samples were subsequently analyzed by gel electrophoresis and the gels stained with Et Br. In this cycle range substantial differences in the level of IL-2 mRNA accumulation were clearly seen between CHx treated CD45RO+ and untreated CD45RO+ T cells. However, minimal effects were observed with CHx treated CD45RA+ cells. On the other hand, attempts to superinduce IL-5 mRNA in CD2-activated CD45RO+ cells and also induce IL-5 mRNA in ‘non-responder’ CD45RA+ T cells with CHx were not successful (data not shown).

DISCUSSION We have shown that normal human CD4+T cell subsets, distinguished on the basis of CD45R isoform expression, exhibit different cytokine mRNA profiles after in vitro activation. Both CD4+CD45RA+ (naive T cells) and CD4+CD45RO+ (memory T cells) expressed IL-2, TNF-B and IL-3 mRNA transcripts within 3-4 h of activation through CD2 or CD3. IL-3, however, was mainly induced in the CD45RO+ population. That IL-2 mRNA was observed in both CD45R subsets in this study is consistent with previous data.‘0,21 Each subset also expressed message for the IL-2 receptor (alpha chain) and IL-6 receptor. Thus, unprimed T cells appear to

be capable of producing cytokines IL-2, TNF-B and IL-3, at least at the mRNA level, following initial activation. On the other hand, IL-lo, IL-4, IL-5, IL10 and the T cell receptor for IL-l, were almost exclusively induced in CD4+CD45RO+ T cells. The finding that activated CD45RO+ cells express both IL-la and the receptor for IL-l suggests that this cytokine could be a major autocrine growth factor for memory T cells. All the cytokines examined in this report were transcriptionally silent in unstimulated T cells. However, we have detected a weak IL-10 PCR product in resting unfractionated peripheral blood mononuclear cells from a number of donors, suggesting a low turnover of IL-10 by monocytes and/or B cells (Beckman, unpublished observations). Positive selection of the respective subpopulations by sorting on a flow cytometer clearly demonstrated that IFN-)I was a product almost exclusively of CD4+CD45ROhi+ T cells and to a lesser extent, CD45RA+/CD45RO+ cells. This pattern was seen at 4 h and 20 h post-activation. Moreover, while CD45RA+/CD45RO+ cells showed a similar cytokine profile to CD45ROhi-t cells, the double positive population appeared to be the major producers of IL6 mRNA suggesting that these cells represent a functionally distinct population. Indeed, CD45RA+/ CD45RO+ T cells could be the major providers of B cell helper function and/or act as co-stimulators for naive T cells. We and others22 have found that IL-6 is a specific cofactor for CD2-activated naive T cells but not memory T cells (Beckman et al., in preparation).

Cytokine expressionin normal human T cells /

RANTES is a member of the intercrine beta subfamily of cytokines and is reported to act as a selective chemoattractant for monocytes and memory T cells.23,24 Our results show that CD4+CD45ROhi+ T cells are also the major producers of mRNA for RANTES . It is well documented that mRNA degradation is a major point of control for gene expression. This is particularly evident for short-lived mRNAs.25 CHx has been shown to enhance accumulation of IL-2 mRNA due to stabilization of the message, presumably by inhibiting a labile protein repressor(s) involved in degradation.19,20 Despite similar levels of IL-2 mRNA induction in untreated CD4-t CD45RA+ and CD4+CD45RO+ T cells, we found that CHx treatment substantially enhanced the level of IL-2 mRNA expression in CD45RO+ T cells but had minimal effects on CD45RA+ T cells. Whilst the evidence is somewhat indirect at this stage, it does suggest for the first time that the processes involved in IL-2 mRNA decay are fundamentally different in the two T cell subpopulations. One possibility is that a putative IL-2 specific repressor protein[s] is differentially activated in CD45RA+ and CD45RO+ cells due to different intracellular signalling mechanisms. Alternatively, it could be argued that only primed T cells require repressor-like factors to control activity of the IL-2 enhancer. Studies are underway to examine this further. Murine Th2 helper cells can produce IL-2 in the presence of CHX.~~ Our attempts to induce IL-5 mRNA expression in CD2-activated ‘non-responder’ CD4+CD45RA+ T cells with CHx were not successful. Indeed, the addition of CHx 4 h after activation actually decreased IL-5 mRNA accumulation in CD4+CD45RO+ cells (data not shown). This observation is consistent with earlier reports suggesting that cytokines show differential sensitivity to CHX.~~ It is noteworthy that whilst the cytokine profiles of CD4+CD45RA+ and CD4+CD45RO+ T cells are similar to the Thl/Th2 classification in showing a cluster of cytokines, e.g. IL-la, IL-4, IL-5, IL-6, IL10 and the receptor for IL-l on CD45RO+ cells (‘Th2 like’), they differ significantly in that both CD45R subsets express mRNA for IL-2 and TNF-P. More interestingly, IFN-y and IL-4 mRNAs were detected in the same subset. This latter observation is intriguing given that these two cytokines are clearly produced by different Th helper clones and show reciprocal modulating effects. For example, while IgE production is mediated by IL-4 it is down-regulated by IFN-Y.~’ However, it is possible that further dissection of the CD45ROhi+ population may reveal functionally distinct subsets within this population. In conclusion, we have shown that normal human T cells, purified on the basis of differential CD45R

121

isoform expression, exhibit distinct cytokine mRNA profiles. That they do not coincide with a strict Thll Th2 classification is perhaps not surprising given this division is based on data derived from cloned effector T cells. Finally, our studies suggest that processes involved in destabilizing IL-2 mRNA are different in CD4+CD45RA+ and CD4+CD45RO+ T cells.

MATERIALS Monoclonal OKT3

AND METHODS antibodies (anti-CD3)

(mAbs) and

OKTS

(anti-CD8)

were

obtained from ATCC and HOgO-4DllD8 (anti-CD16) from Dr Heddy Zola, Immunology Department, Flinders Medical Centre, Adelaide. CD45RA mAb FMC44, CD19 mAb FMC63 and CD14 mAb FMC32 were prepared in the Immunology Department, Flinders Medical Centre.29z31 UCHLl (anti-CD45RO), 9.3 (anti-CD28) and the mitogenie pair of anti-CD2 mAbs (Tl12 and T113) were kind gifts from Dr Peter Beverley, London,32 Bristol-Myers Squibb, Seattle and Dr Ellis Reinherz, Boston,33 respectively. Biotinylated UCHLl was prepared as described previously12 and fluoresceinated (FITC) anti-CD45RA purchased from Becton-Dickinson.

T cell Purification T cells were sequentially isolated from peripheral blood mononuclear cells of normal healthy young adults using nylon wool, percoll density gradient centrifugation, plastic adherence and antibody panning on goat anti-mouse IgG (Dakopatts) coated plates [using a cocktail of mabs against monoctyes (anti-CD14), NK cells (anti-CD16) and B cells (anti-CD19)] as previously described.34 CD4+CD45RA+ and CD4+CD45RO+ subsets were negatively immunoselected using a second round of panning with OKT8, HOSO-4DllD8 and FMC44 or UCHLl. Positive immunoselection of CD4+ T cell subsets was achieved on a FACSTAR cell sorter (Becton-Dickinson) using three colour immunofluorescence. Purified T cells were first incubated with OKT4, washed twice and incubated with phycoerythrin (PE) conjugated sheep antimouse IgG (Jackson Laboratories). After washing, unoccupied binding sites were blocked by the addition of normal mouse serum for 10 min before the cells were treated with FITC labelled anti-CD45RA and biotinylated UCHLl. After 30 min the cells were washed again and incubated with TRI-COLOUR (Caltag Laboratories) to detect cells reacting with biotinylated UCHLl. Following two further washes, the thrice labelled T cells were sorted, by first gating on the CD4fpopulation into three discrete populations CD45RAhi+CD45RO-, CD45ROhi+CD45RAand cells co-expressing intermediate levels of CD45RA and CD45RO namely, CD45RA+/CD45RO+, by choosing gates based on FITC and TRI-COLOUR staining intensities.

T cell Activation T cell subpopulations were plated at 5

x

lo5 or 1 x lo6

122 I Beckman

CYTOKINE,

et al

medium RPMI-1640 + 10% foetal calf serum (FCS; Flow Laboratories, Australia) in 24 well plates (Costar) and stimulated for 3, 4 or 20 h through CD2 using

per ml in culture

mabs T112 + Tlls (1: 1000 ascites) in combination with either phorbol myristate acetate (PMA, Sigma) (1 @ml),

9.3 (anti-CD28; 1: 1000 ascites) or 20U/ml recombinant IL-2 (Boehringer Australia), or through CD3 using OKT3 (10 @ml) + PMA. Cells cultured without mitigen were used as a source of unstimulated cells.

RTIPCR Cytoplasmic RNA was isolated from 5 X lo5 or lo6 mitogen-stimulated or non-stimulated (control) T cells by lysing the cell pellets in 0.1 ml of a solution containing 10 mM Tris pH 7.5, 1.50mM NaCL, 0.65% NP-40 and 10 mM vanyl ribonucleoside complexes (Gibco-BRL). The nuclei were removed by centrifugation (6500 rpm/l min] and the supernatant (cytoplasmic fraction) transferred to a new tube containing 10 mM sodium acetate pH 5,50 mM NaCl, 5 mM EDTA and 0.5% SDS in 0.3ml. The contents were vortexed and then extracted twice with phenol/chloroform (1: 1) and once with chloroform

alone. The RNA was not precipi-

tated but stored at -80°C as 1250 or 2500 cell equivalents per ~1 of supernatant. First strand cDNA was synthesized from 13 ~1 of RNA supernatant, using M-MLV reverse transcriptase (GibcoBRL) and oligo dT priming according to the manufacturers directions. The reaction was carried out at 37°C for 1 h in a final volume of 40 ~1. One eighth of the cDNA was added to 45 p,l of PCR mix (Bresatec,

Adelaide)

and the mixture

subjected to 27-34 cycles of PCR amplification using a thermal cycler (Innovonics, Melbourne) with a 1 min/95”C denaturation, 2 min/BO“C annealing and 3 min/72”C extension profile. Each PCR product, 10 t.~l, was analyzed by electrophoresis on 2% agarose gels and subsequently stained with ethidium bromide (ET Br). A 123 bp DNA ladder (Gibco-BRL) was used as a marker. Primers for CD45”, IL-1O,3s the T cell receptor for IL-136 {5’-GAAACATCAGGCTGGCTGC and and RANTE$ TCCATGCTACCCGAGAGGCAC} {S-CTCGCTGTCATCCTCATTGCTAC and 3’GTAGGATAGTGAGGGGAAGCCTC} were synthesized with an Applied Biosystems Model 381A DNA synthesizer. Other primers were purchased from Clontech (Integrated Sciences, Australia). In all cases the PCR products obtained were the size predicted from the cDNA sequence.

REFERENCES 1. Clark EA, Ledbetter, JA (1989) Leukocyte cell surface enzymology: CD45(LCA,T200) is a protein tyrosine phosphatase. Immunol Today 10:225-228. 2. Trowbridge IS, Ostergaard, HL, Johnson (1991) CD45: a leukocyte-specific member of the protein tyrosine phosphatase family. Biochimica et Biophysics Acta 1095:46-56. 3. Hall LR, Streuli M, Schlossman SF, Saito H (1988) Complete exon-intron organization of the human leukocyte common antigen (CD45) gene. J Immunol141:2781-2787.

Vol. 6, No. 2 (March 1994: 116-123)

4. Streuli M, Hall LR, Saga Y, Schlossman, SF, Saito H (1987) Differential usage of three exons generates at least five different mRNAs encoding human leukocyte common antigens. J Exp Med 166:1548-1566. 5. Morimoto C, Letvin NL, Distaso JA, Aldrichi WR, Schlossman SF (1985) The isolation and characterization of the human suppressor inducer T cell subset. J Immunol134:1508-1515. 6. Smith SH, Brown MH, Rowe D, Callard RE, Beverely PCL (1986) Functional subsets of human helper-inducer cells defined by a new monoclonal antibody, UCHLl. Immunol58:6370. 7. Akbar AN, Salmon M, Janossy G (1991) The synergy between naive and memory T cells during activation. Immunol Today 12:184-188. 8. Mackay CR (1991) T-cell memory: the connection between function, phenotype and migration pathways. Immunol Today 12:189-192. 9. Wallace DL, Beverley PCL (1990) Phenotypic changes associated with activation of CD45RA+ and CD45RO+ T cells. Immunol69:460-467. 10. Kristensson K, Borrebaeck CAK, Carlsson R (1992) Human CD4+ T cells expressing CD45RA acquire the lymphokine gene exnression of CD45RO+ T-heloer cells after activation in yitro. Immunol76:103-109. 11. Ferrer JM, Plaza A, Kreisler M, Diaz-Espada F (1992) Differential interleukin secretion by in vitro activated human CD45RA and CD45RO CD4+ T cell subsets. Cell Immunol 141:10-20. 12. Zola H, Flego L, MacCardle PJ, Donohoe PJ, Ranford J, Robertson D (1992) The CD45RO (~180, UCHLl) marker: complexity of expression in peripheral blood. Cell Immunol 145:175186. 13. Mosmann TR, Moore KW (1991) The role of IL-10 in cross regulation of Tnl and Tn2 responses. Immunol Today A49A53. 14. Romagnani S (1992) Induction of TH1 and TH2 responses: a key role for the ‘natural’ immune response? Immunol Today 13:379-381. 15. Romagnani S (1992) Human TH1 and Tn2 subsets: regulation of differentiation and role in protection and immunopathology. Int Arch Allergy Immunol98:279-285. 16. Paliard X, de Waal Malefyt R, Yssel H, Blanchard D, Chretien I, Abrams J, de Vries JE, Spits H (1988) Simultaneous production of IL-2, IL-4 and IFN-gamma by activated human CD4+ and CDS+ T-cell clones. J Immunol 141:849-855. 17. Noma T, Nakakubo H, Sugita M, Kumagai S, Maeda M, Shimizu A, Honjo T (1989) Expression of different combinations of interleukins by human T cell leukemic cell lines that are clonally related. J Exp Med 169:1853-1858. 18. Kanegane H, Miyawaki T, Kato K, Yokoi T, Uehara T, Yachie A, Taniguchi N (1991) A novel subpopulation of CD45RA+ CD4+ T cells expressing IL-2 receptor a-chain (CD25) and having a functionally transitional nature into memory cells. Int Immunol 3:1349-1356. 19. Shaw J, Meerovitch K, Elliott JF, Bleackley RC, Paetkau V (1987) Induction, suppression and superinduction of lymphokine mRNA in T lymphocytes. Mol Immunol24:409-419. 20. Shaw J, Meerovitch K, Bleackley RC, Paetkau V (1988) Mechanisms regulating the level of IL-2 mRNA in T lymphocytes. J Immunol140:2243-2248. 21. Salmon M, Kitas GD, Bacon PA (1989) Production of lymphokine mRNA by CD45Rt and CD45R- helper T cells from human peripheral blood and by human CD4+ T cell clones. J Immunol 143:907-912. 22. Kasahara Y, Miyawaki T, Kato K, Kanegane H, Yachie A. Yokoi T. Tanirruchi N (1990) Role of interleukin 6 for differential responsivenes; of naive and memory CD4+ T cells in CD2mediated activation. J Exp Med 172:1419-1424. L

Cytokine expression in normal human T cells / 123 23. Oppenheim JJ, Zachariae, COC, Mukaida N, Matsushima K (1991) Properties of the novel proinflammatory supergene ‘intercrine’ cytokine family. Ann Rev Immunol 9:617648. 24. Schall TJ, Bacon K, Toy KI, Goeddel DV (1990) Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 34769-771. 25. Hentze MW (1991) Determinants and regulation of cytoplasmic mRNA stability in eukaryotic cells. Biochimica et Biophysica Acta 1090:281-292. 26. Munoz E, Zubiaga A, Olson D, Huber BT (1989) Control of lymphokine expression in T helper 2 cells. Proc Nat1 Acad Sci USA 86:9461-9464. 27. Zubiaga AM, Munoz E, Huber BT (1991) Superinduction IL-2 gene transcription in the presence of cycloheximide. J Immuno1 146:3857-3863. 28. Pene J, Rousset F, Briere F, Chretien I, Bonnefoy J-Y, Spits H, Yokota T, Arai N, Arai K-I, Banchereau J, de Vries JE (1988) IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons g and a and prostaglandin Ez. Proc Nat1 Acad Sci USA 85:6880-6884. 29. Zola H, Melo JV, Zowtyi HN, Nikoloutsopoulos A, Skinner J (1990) The leukocyte-common antigen (CD45) complex and B-lymphocyte activation. Human Immunol27:368-377. 30. Shimizu Y, van Seventer GA, Ennis E, Newman W, Horgan KJ, Shaw S (1992) Crosslinking of the T cell-specific access-

ory molecules CD7 and CD28 modulates T cell adhesion. J Exp Med 175:577-582. 31. Hancock WW, Zola H, Atkins RC (1983) Antigenic heterogeneity of human mononuclear phagocytes: Immunohistological analysis using mabs. Blood 62:1271-1279. 32. Akbar AN, Terry L, Timms A, Beverley PCL, Janossy G (1988) Loss of CD45R and gain of UCHLl reactivity is a feature of primed T cells. J Immunol 140:2171-2178. 33. Meuer SC, Hussey RE, Fox MF, Acute 0, Fitzgerald KA, Hodgdon JC, Protentis JP, Schlossman SF, Reinherz EL (1984) An alternative pathway of T-cell activation: a functional role for the 50 kd Tll sheep erythrocyte receptor protein. Cell 36:897906. 34. Beckman I, Dimopoulos K, Xu X, Ahern M, Bradley J (1991) Age-related changes in the activation requirements of human CD4+ T-cell subsets. Cell Immunol 132:17-25. 35. Yamamura M, Uyemura K, Deans RJ, Weinberg K, Rea TH, Bloom BR, Modlin RL (1991) Defining protective responses to pathogens: cytokine profiles in leprosy lesions. Science 254:277279. 36. Sims JE, Acres RB, Grubin CE, McMahan CJ, Wignall JM, March CJ, Dower SK (1989) Cloning the interleukin 1 receptor from human T cells. Proc Nat1 Acad Sci USA 86:8946-8950. 37. Schall TJ, Jongstra J, Dyer BJ, Jorgensen J, Clayberger C, Davis, MM, Krensky AM (1988) A human T cell-specific molecule is a member of a new gene family. J 1mmuno1141:1018-1025.