- Email: [email protected]
Expression of Homeobox Genes in Cervical Cancer
Gynecologic Oncology 84, 216 –221 (2002) doi:10.1006/gyno.2001.6498, available online at http://www.idealibrary.com on
Expression of Homeobox Genes in Cervical Cancer Hung Li,* Chiu-Jung Huang,† ,1 and Kong-Bung Choo† ,2 *Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan 11564; and †Department of Medical Research and Education, Veterans General Hospital–Taipei, Shih-Pai, Taipei, Taiwan 11217 Received October 19, 2001
Objective. Members of the homeobox (HB) gene superfamily encode transcription factors crucial for development and may be associated with tumorigenesis. In this study, we aimed to develop a procedure to survey the expression of the dispersed-type HB genes in cervical cancer cells. Methods. Nineteen sets of degenerate primers were designed based on conserved homeodomains of known dispersed-type HB genes. A cDNA library derived from HeLa, a cervical cancer cell line, was used. Two successive rounds of PCR were performed using a combination of the HB degenerate primers and a primer recognizing the flanking sequence of the vector used in the cDNA library construction. Results. On cloning and sequence analysis of the PCR fragments generated, 10 known and 3 putative novel HB genes were detected in HeLa. RT-PCR expression analysis further showed that HOXD9 and ATBF1 were differentially expressed in cancer cells and not in normal cervix. Conclusions. Our data demonstrate the feasibility of using degenerate primers in PCR experiments in a collective analysis of complex gene families. Our data indicate that HOXD9 and ATBF1 are expressed in cervical cancer, but not in normal cervix. © 2002 Elsevier Science
Key Words: cervical cancer; dispersed homeobox genes; collective PCR analysis; degenerate primers.
INTRODUCTION Cervical cancer is a prevalent gynecological malignancy, particularly in regions where access to regular Pap smear examination is limited. For a long while, human papillomaviruses (HPVs) have been recognized as an important etiological factor leading to cervical lesions [1–3]. However, HPV alone may not be enough for the tumorigenesis process. Alterations in other cellular genes are most likely involved, as demonstrated in many studies involving the analysis of loss of heterozygosity [4 –7]. In recent years, numerous embryonic genes have been found to be involved in postnatal regulation of differentiation and cell growth. Mutations in some of these genes often lead to the genesis of many forms of human
disorders, in particular cancers [8 –17]. One of the classes of such oncodevelopmental genes is the homeobox gene family. Homeobox (HB) genes are essential in developmental processes in pattern formation and establishment of body plans in organisms ranging from Drosophila to man. Mammalian homeobox genes are categorized based on sequence homology. The Antennapedia-like genes are collectively called the HOX genes. Thirty-nine different HOX genes are organized into four clusters, each extending about 100 kb in four separate chromosomes [18, 19]. These clustered HOX genes are important regulators of development and are expressed in overlapping domains along the anterior–posterior axis of the vertebrate embryo in multiple tissues [20 –23]. In addition to the four HOX gene clusters, there are numerous non-Antp-type homeobox genes dispersed among chromosomes. Dispersed HB genes show distinct expression patterns compared with clustered genes. The better characterized non-Antp-type homeobox gene families include the Pax, the Msx, and the POU genes and genes coding for the LIM proteins [8, 26, 27]. Members of the PAX gene family have been found to be involved in some cancers [reviewed in 8, 9]. Deregulation of the expression of these and other HB genes has been linked to the genesis of leukemias and lymphomas by inducing aberrant cellular proliferation [10 –12]. HB genes induce transformation by aberrant expression, translocation, and selective transcriptional repression in conjunction with other factors [10 –14]. The developmental Patched gene of Drosophila has also been linked to the development of basal cell carcinoma of the skin [15–17]. Two recent studies have reported the analysis of HB gene expression in cervical cancer cells using PCR-based or cDNAarray hybridization approaches [18, 19]. In these studies, only the clustered-type HB genes were analyzed. The aim of the present study is to develop an approach for a more comprehensive analysis of the dispersed HB genes in cervical cancer cells. For this purpose, a panel of degenerate primers was designed based on conserved amino acid domains of various HB gene classes. The primers were applied collectively to the analysis of HB gene expression in the cervical cancer cell line, HeLa.
1
Present address: Department of Zoology, National Taiwan University, Taipei, Taiwan 10673. 2 To whom correspondence and reprint requests should be addressed. Fax: 886-2-2872 1312. E-mail: [email protected]. 0090-8258/02 $35.00 © 2002 Elsevier Science All rights reserved.
216
MATERIALS AND METHODS Cell lines and biopsies. The cervical cancer cell lines HeLa (ATCC CCL-2), CaSki (ATCC CRL-1550), and SiHa
217
PCR ANALYSIS OF HOMEOBOX GENE IN CERVICAL CANCER
TABLE 1 Degenerate Primers Used for Collective Analysis of Homeobox Genes in a HeLa cDNA Library Primer designation
Sequence a
Degeneracy b
HB domain recognized
(A1) ␥N26 (A2) ␥LFB23 (A3) ␥LB23 (A4) ␥H23 (A5) ␥A23 (B1) ␥Px23-2 (B2) ␥P23-2 (B3) ␥L23-2 (B4) ␥K23 (B5) ␥E26 (C1) ␥X23 (C2) ␥Z23 (C3) ␥M23 (C4) ␥C23 (D1) ␥SA26 (D2) ␥Px23-1 (D3) ␥P23-1 (D4) ␥L23-1 (D5) ␥En26
ATHAAYAAYTGGTTYATHAAYCARMG GTNTAYAAYTGGTTYGCNAAYMG GTNATHACNTGGTTYCARAAYMG AARATHTGGTTYCARAAYMGNMG AAYTGGTTYGGNAAYAARMGNAT CARGTNTGGTTYAGYAAYMGNMG GTNAGNGTNTGGTTYTGYAAYMG GTNRTNCARGTNTGGTTYCARAA CARGTNTGGTTYAARAAYMGNMG CARGTNAAYAAYTGGTTYATHAAYGC CARGTNAARACNTGGTAYCARAAYMG CARRTNAARATHTGGTTYCARAAYMG AARGTNTGGTTYCARAAYMGNMG CARGTNTGGTTYTGYAAYMGNMG GARACNCARGTNAARATHTGGTTYCA CARGTNTGGTTYTCNSSYMGNMG GTNCGNGTNTGGTTYTGYAAYMG CARGTNTGGTTYCARAAYMGNMG AARATHTGGTTYCARAAYAARMGNGC
576 512 768 768 512 1024 1024 1024 1024 768 1024 1536 1024 1024 768 2048 1024 1024 768
INNWFINQR VYNWFANR VITWFQNR KIWFQNRR NWFGNKRI QVWFSNRR VRVWFCNR VVQVWFQN QVWFKNRR QVNNWFINA QVKTWYQNR QVKIWFQNR KVWFQNRR QVWFCNRR ETQVKIWFQ QVWFSNRR VRVWFCNR QVWFQNRR KIWFQNKAR
a For successive rounds of PCR, the longer primers were used in first-round PCR followed by the use of the shorter internal (underlined) primer for second-round PCR. The nucleotide abbreviations used are as follows: R ⫽ A, G; Y ⫽ C, T; M ⫽ A, C; K ⫽ G, T; S ⫽ G, C; W ⫽ A, T; H ⫽ A, T, C; B ⫽ G, T, C; V ⫽ G, A, C; D ⫽ G, A, T; N ⫽ G, A, T, C. b Degeneracies are for the longer primers listed.
(ATCC HTB-35) were originally obtained from the American Type Culture Collection. C33A was a gift from Dr. Y.-S. Chang, Chang Gung University Medical College, Tao Yuen, Taiwan. The cell lines were cultured in DMEM supplemented with 10% fetal calf serum. Biopsies of normal cervix and cervical cancer were gifts of Dr. Chi-Ping Han, Head of the Obstetrics and Gynecology Department, 803rd Army Hospital, Taichung, Taiwan, and were used for the studies with consent. The pathological status of the biopsies was determined by resident pathologists of the same hospital. Whole biopsies were snapped frozen in liquid nitrogen and kept at ⫺80°C before they were used for RNA preparation. No attempts were made in isolation of epithelial cells for RNA preparation from the biopsy samples. PCR amplification of HB sequences in HeLa. HB degenerate primers used in the study are listed in Table 1. Each set of primers consists of a longer 23- to 26-meric oligonucleotide and an internal and therefore shorter (20-meric) oligonucleotide for use in two successive rounds of PCR amplification. The HeLa cDNA library (Cat. No. 937248) was purchased from Stratagene (La Jolla, CA). The cDNA library was constructed using the Uni-ZAP XR vector. The vector allows unidirectional cloning of cDNA inserts with a T3 sequence at the 5⬘-terminus and a T7 sequence at the 3⬘-end. The original cDNA library was subjected to in vivo excision and subcloning into the pBluescript SK phagemid vector (Stratagene) before cDNA plasmid DNA preparations were made. PCR was performed using a combination of the HB degenerate primers and a 22-meric T7 primer (5⬘-GTAATACGACTCACTAT-
AGGGC-3⬘) for recognition of the vector sequence located at the 3⬘-end of the cDNA insert. With the exception of two cases, the degeneracy of the HB primers was 1024 or lower. Following first-round PCR, an aliquot of the PCR product was used in second-round PCR using the overlapping and internal shorter primers to increase specificity. For all primer sets and for both rounds of PCR, amplification was carried out by touch-down PCR using a standard program as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles with a denaturation temperature of 94°C for 1 min; an annealing temperature of 60°C for 1 min (with a decrement of 0.1°C per cycle), and an extension temperature at 72°C for 2 min. After 30 cycles, a final extension at 72°C was carried out for 10 min before termination of PCR. PCR products were analyzed in 2% agarose gels (Fig. 1). Cloning and sequence analysis of PCR fragments. Major bands were excised from the gel and the DNA fragments recovered were used for cloning into the pGEM-TEasy vector (Promega, Madison, WI) using a standard procedure [28]. One to three recombinant clones from each gel-recovered PCR fragment were obtained and subjected to sequencing analysis using an ABI377 automatic sequencer. The sequences obtained were subjected to BLAST searches of the GenBank nucleotide and protein databases. Clones that showed more than 90% amino acid sequence homology with known homeodomains were candidates for further analysis. Preparation of RNA and RT-PCR analysis. Total RNA was prepared from cell lines using the Tri-Reagent kit obtained
218
LI, HUANG, AND CHOO
TABLE 2 Primers Used for RT-PCR Expression Profile Analysis Gene
Accession number
HOX-A5
M26679
HOX-D4
X17360
HOX-D9
X59372
OCT-1
X13403
PKNOX-1
U68727
MOX-1
U10492
PBX-3
X59841
DLX-2
L07919
ATBF1
L32832
GAPDH
M33197
HB92
AF426412
HB103
AF426413
Primer sequences
PCR product (bp)
Reference
AAGCCCTGTTCTCGTTGCCCTAAT CACCGCTTGGAGTCACAGTTTTCA GTTTATAAGTCTCAGCTCTCCTTC AAATAATACTTTAATCAGTGGCAG AGTTCTCGTGCAACTCGTTCCTG AAACAGCAACAACAACAAATCCGC CACTTGATGCAACTGGGAACCTGG TTCTCCCTTCTCTCCTTTGCCCTC TCTTTGCTCTCCCCGGGTAGTGAT CTCTGAAAAGTCGAAAGCAACAAC TAATAAGGAGGGCTGCTGGGTGAG TTTGGGGTGGGGAGGTGGGGTTAT TTGCATATTTCCATTACTGACTTG TGTGTTTTGATTGGTGGGATGTAT CCGGGCGCTCTGAGGCTTCTTTCT AGGGGTTGCTGAGGTCACTGCTAA AATCCCCCAAACCAGAAGAACAGA GGAAGCAGGCAGAGTGAGGTAATA GCATGGCCTTCCGTGTCCCCA TAGGCCCCTCCCCTCTTCAAG ACTTATGGAACCCAAAGAAAGAAG AGACCGACTGTCATGCAAATAATA TGATAGAGGAGTCCAACCGAGCAG AAGTTTACAGCAATTCCACACACC
458
29
532
30
501
31
411
32
555
33
400
34
438
35
534
36
483
37
450
38
386
This paper
394
This paper
from Molecular Research Center, Inc. (Cincinnati, OH). HeLa total RNA was also obtained commercially (Cat. No. 64025-1) from Clontech (Palo Alto, CA). All RNA preparations were treated with RNase-free DNase to remove contaminating genomic DNA. Five micrograms of the DNase-treated RNA was subjected to reverse transcription using oligo(dT) as a primer using the SuperScript First-Strand Synthesis System for RT-PCR obtained from Life Technologies (Gaithersburg, MD). To probe for the presence of specific HB genes, the cDNA preparations were used in PCR using the one-tube Master Mix obtained from Qiagen (Valencia, CA). The sequences of the specific HB primers used in RT-PCR are listed in Table 2. In some cases, other PCR primer sets were used for confirmation of the results obtained (data not shown). The identity of each RT-PCR-positive band was confirmed by direct sequencing of the PCR products or plasmid clones of the PCR products.
a gene probably due to biased PCR and cloning procedure. The size of the PCR-generated cDNA inserts in these clones ranged from 0.2 to 1.7 kb (data not shown). Since highly degenerate primers were used in the PCR amplification step, no attempts were made to correlate clone frequency with transcript abundance. On a BLAST search of the GenBank nucleotide and protein databases of the sequences represented by the 60 clones, about 10% of the clones were clearly false amplification products without recognizable homeodomains. We also discarded
RESULTS Using the 19 sets of highly degenerate primers, numerous bands were invariably generated in first-round PCR. On second-round PCR, however, most primer sets generated a single distinct major band (Fig. 1). The major bands were recovered for cloning. About 60 recombinant clones were randomly picked for further restriction and sequencing analysis. The number of clones representing independent gene sequences ranged from one to three with a single case of nine clones for
FIG. 1. Electrophoretic profiles of PCR detection of HB sequences in a HeLa cell line derived cDNA library. Lanes 1–19 show the PCR products generated with the use of primer sets A1–A5, B1–B5, C1–C4, and D1–D5 as shown in Table 1, in that order. The electrophoresis was done in a 2% agarose gel, and the size markers (M) are also indicated.
PCR ANALYSIS OF HOMEOBOX GENE IN CERVICAL CANCER
TABLE 3 Expression Profile of HeLa-Derived Homeobox Genes in Cervical Cancer Cells as Determined by RT-PCR Cervical cells Homeobox gene (I) Clustered HB genes HOX-A5 HOX-D4 HOXD9 (II) Dispersed HB genes OCT-1 PKNOX-1 MOX-1 PBX-3 DLX-2 ATBF1 (III) Putative novel HB gene HB92 HB103
Normal
HeLa
C33A
CaSki
SiHa
⫹ ⫹ ⫺
⫹ ⫾ ⫹
⫹ ⫹ ⫹
⫹ ⫹ ⫹
⫹ ⫹ ⫾
⫹ ⫹ ⫹ ⫹ ⫹ ⫺
⫹ ⫹ ⫹ ⫾ ⫹ ⫹
⫺ ⫹ ⫹ ⫹ ⫹ ⫺
⫹ ⫹ ⫹ ⫹ ⫹ ⫺
⫾ ⫹ ⫹ ⫺ ⫹ ⫺
⫹ ⫺
⫹ ⫹
⫹ ⫺
⫾ ⫺
⫾ ⫺
Note. In the table, “⫹” and “⫺” indicate the presence and absence of the HB gene transcripts, respectively, as detected by RT-PCR. “⫾” indicates the detection of only faint bands in the RT-PCR reaction.
clones with ambiguous homeodomains with less than 90% sequence homology or clones that carried inserts less than 0.5 kb. A final tally of 27 clones that were longer than 0.5 kb and with clearly identified homeodomains was kept for subsequent experiments. Twenty-four of the clones matched with 10 different known HB genes with different frequencies. The OCT-1, PKNOX1, MOX-1, HANF-1, PBX-3, DLX-2, and ATBF-1 genes detected are dispersed HB genes. Despite our original intention of focusing on the dispersed HB genes, three clustered HB genes, namely HOXA5, HOXD4, and HOXD9, were also detected, probably because of homologous domains recognized by the degenerate primers. No mutations were found in any of these known genes based on the sequencing data of the PCR-derived segments. Three of the clones did not match with any known genes in the nucleotide and protein database searches, suggesting that they are putative novel HB genes expressed in HeLa and are candidates for future analysis. The expression status of the HB genes detected in HeLa was further examined in other cervical cancer cell lines and in normal cervices. Primers specific to each of the 10 known homeobox genes were designed based on published sequences (Refs. [29 –38] and Table 2). The primers were, in most instances, targeted to unique sequences located beyond the 3⬘end of the conserved homeodomain. RT-PCR was performed using RNA derived from three other cervical cancer cell lines, C33A, SiHa, and CaSki. Total RNA prepared from a normal cervix was also included. The results, with the exception of the HANF-1 gene, are summarized in Table 3. In the case of HANF-1, despite the use of different sets of primers for RT-PCR detection of this gene in the cancer cell lines, none was successful, including HeLa. It is
219
unclear whether the discrepancy was due to differences in the HeLa cDNA library and the HeLa RNA used in the RT-PCR analysis or because of contamination of the cDNA library from which the clones were derived. Due to this inconsistency, RT-PCR data of HANF-1 were not included in Table 3, and the gene was not further analyzed. Of the remaining 9 HB genes analyzed, HOXD9 expression was not detected in normal cervix but it was in cervical cancer cell lines (Fig. 2 and Table 3). Expression of the ATBF1 gene in HeLa was confirmed in RT-PCR experiments. However, we failed to detect expression of this gene in normal cervix as well as in the other three cervical cell lines tested. The discrepancy is unclear. The lack of expression of the HOXD9 and ATBF1 genes in normal cervix was further confirmed in seven other independently derived normal cervical biopsy tissues (data not shown). Of the three putative novel HB genes detected in HeLa, only two genes, tentatively designated HB92 and HB103, carried sequences outside the homeodomain long enough for the design of successful PCR primers that yielded results in RT-PCR experiments (Table 3). The third gene was, therefore, not included in further analysis. The derived sequences for HB92 (GenBank Accession Number AF426412) and HB103 (AF426413) are 585 and 742 bp long, respectively. The HB92 gene was found to be expressed in both normal and cancer cells whereas gene HB103 was detected in HeLa and not in normal cervix and other cancer cell lines. The absence of expression of HB103 was also confirmed in three other independently derived normal cervical tissues. The derivation and detailed characterization of the two genes are not the subjects of this work but they are interesting candidates for further studies to elucidate their structure and biological functions. The expression data obtained by the use of cervical cancer cell lines were in most cases confirmed by RT-PCR analysis of RNA preparations from surgically derived cervical cancer biopsies. For ATBF1, HOXD9, and HB103, four different biopsy samples were used. For all other samples, two to four biopsies
FIG. 2. RT-PCR detection of HB transcripts in normal cervix (lane 1) and in cervical cancer cell lines HeLa (lane 2), C33A (lane 3), CaSki (lane 4), and SiHa (lane 5) in a 1.5% agarose gel. The primers used and the sizes of the PCR products are as shown in Table 2.
220
LI, HUANG, AND CHOO
were analyzed (data not shown). Attempts to detect transcripts of the HB genes in normal cervix and in the cervical cancer cell lines or biopsies by Northern blots were made but were unsuccessful, probably due to the low abundance of HB transcripts in the tissues [39, 40]. DISCUSSION In this work, we describe a PCR-based approach using degenerate primers for comprehensive detection and analysis of the dispersed homeobox genes in the HeLa cDNA library. The possibility exists that the expression profile of the HB genes might be altered on culture. The HeLa cell line was used in this seminal study for the purpose of rapid assessment of HB gene expression status. For the genes of interest, confirmation was obtained using surgically derived biopsies. The use of whole normal cervices as controls also warrants care in data interpretation since underlying dermis and other cells besides epidermal cells are also present. With these potential drawbacks in mind, we describe here detection of the expression of seven dispersed and three clustered HB genes in the HeLa cell line. Three other HB genes that did not match with any known gene sequences in the GenBank database are potential novel genes. Although quantification of HB transcripts in normal and cervical cancer cells by other more sensitive procedures such as real-time PCR and in situ hybridization is not the primary objective of this study, the parameter is, nonetheless, important for any single selected HB gene of interest. Such an approach, or other adoptions of the approach, should be applicable to other superfamilies of genes, such as zinc-finger proteins or kinases, and targeting at cDNA libraries derived from a wide range of temporal or spatial sources. We further show that expression of HOXD9, and possibly ATBF1, may be correlated with the pathogenesis of cervical cancer. HOXD9 is involved in the early stages of limb morphogenesis and in the pathogenesis of arthritis [41– 43]. To date, no evidence of the association of this gene with neoplastic transformation has been reported. The ATBF1 gene, encoding a large protein containing homeodomains and zinc-finger motifs, is associated with neuronal differentiation [37, 44, 45]. More recently, it has further been shown that ATBF1 represses transcriptional activity of the MYB oncoprotein [46]. On the other hand, absence of ATBF1 gene expression is associated with enhanced malignancy in ␣-fetoprotein producing gastric cancer [47]. The possible involvement of HOXD9 and ATBF1 in the pathogenesis process of cervical cancer warrants further investigation. A recent study by Alami et al. [48], focusing on the clustered HB genes, has found differential expression of HOXC5 and HOXC8 in primary normal keratinocyte cultures and in cervical cancer cell lines. In their study, specific primer pairs for all 39 HB genes were used in a PCR-based approach. In a different study, Shim et al. [49] applied cDNA hybridization arrays using normal and cervical cancer cell generated probes and
have reported the possible involvement of HOXA1 and HOX7 in cervical tumorigenesis. The inconsistency observed in these and in our studies may mainly be a reflection of different methodologies being applied. More importantly, our primers were designed to target the dispersed group of HB genes, whereas the studies conducted by Alami et al. and Shim et al. focused on the clustered gene sets. The complexity of the HB gene family certainly demands a combination of approaches in the derivation of complementary rather than exclusive results. ACKNOWLEDGMENTS This work was supported by a grant (VGH89-384) from the Veterans General Hospital–Taipei, Taiwan. We thank Dr. C. P. Han for clinical samples and M. J. Shih for competent technical assistance.
REFERENCES 1. Choo KB, Pan CC, Liu MS, Ng HT, Chen CP, Lee YN, Chao CF, Meng CL, Yeh MY, Han SH. Presence of episomal and integrated human papillomavirus DNA sequences in cervical carcinoma. J Med Virol 1987; 21:101–7. 2. Lorincz AT, Reid R, Jenson AB, Greenberg MD, Lancaster W, Kurman RJ. Human papillomavirus infection of the cervix: relative risk association with 15 common anogenital types. Obstet Gynecol 1992;79:328 –37. 3. zur Hausen H. Molecular pathogenesis of cancer of the cervix and its causation by specific human papillomavirus types. Curr Top Microbiol Immunol 1994;186:131– 6. 4. Lazo PA. The molecular genetics of cervical carcinoma. Br J Cancer 1999;80:2008 –18. 5. Mitra AB. Genetic deletion and human papillomavirus infection in cervical cancer: loss of heterozygosity sites at 3p and 5p are important genetic events. Int J Cancer 1999;82:322– 4. 6. Kersemaekers AM, Hermans J, Fleuren GJ, van de Vijver MJ. Loss of heterozygosity for defined regions on chromosomes 3, 11 and 17 in carcinomas of the uterine cervix. Br J Cancer 1998;77:192–200. 7. Mullokandov MR, Kholodilov NG, Atkin NB, Burk RD, Johnson AB, Klinger HP. Genomic alterations in cervical carcinoma: losses of chromosome heterozygosity and human papillomavirus tumor status. Cancer Res 1996;56:197–205. 8. Stuart ET, Gruss P. PAX genes: what’s new in developmental biology and cancer? Hum Mol Genet 1995;4:1717–20. 9. Read AP. Pax genes-paired feet in three camps. Nat Genet 1995;9:333– 4. 10. Nakamura T, Largaespada DA, Shaughnessy JD Jr, Jenkins NA, Copeland NG. Cooperative activation of Hoxa and Pbx-1-related genes in murine myeloid leukaemias. Nat Genet 1996;12:149 –52. 11. Nakamura T, Largaespada DA, Lee MP, Johnson LA, Ohyashiki K, Toyama K, Chen SJ, Willman CL, Chen IM, Feinberg AP, Jenkins NA, Copeland NG, Shaughnessy JD Jr. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat Genet 1996;12:154 – 8. 12. Thorsteinsdottir U, Sauvageau G, Hough MR, Dragowska W, Lansdorp PM, Lawrence HJ, Largman C, Humphries RK. Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol 1997;17:495–505. 13. Maulbecker CC, Gruss P. The oncogenic potential of deregulated homeobox genes. Cell Growth Diff 1993;4:431– 41.
PCR ANALYSIS OF HOMEOBOX GENE IN CERVICAL CANCER 14. Moskow JJ, Bullrich F, Huebner K, Daar IO, Buchberg AM. Meis1, a PBX1-related homeobox gene involved in myeloid leukemia in BXH-2 mice. Mol Cell Biol 1995;15:5434 – 43. 15. Gailani MR, Bale AE. Developmental genes and cancer: role of patched in basal cell carcinoma of the skin. J Natl Cancer Inst 1997;89:1103–9. 16. Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, Chidambaram A, Vorechovsky I, Holmberg E, Unden AB, Gillies S, Negus K, Smyth I, Pressman C, Leffell DJ, Gerrard B, Goldstein AM, Dean M, Toftgard R, Chenevix-Trench G, Wainwright B, Bale AE. Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 1996;85:841–51. 17. Johnson RL, Rothman AL, Xie J, Goodrich LV, Bare JW, Bonifas JM, Quinn AG, Myers RM, Cox DR, Epstein EH Jr, Scott MP. Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 1996;272:1668 –71. 18. Denis D. Guidebook to the homeobox genes. London: Oxford Univ. Press, 1994. 19. Scott MP. A rational nomenclature for vertebrate homeobox (HOX) genes. Nucleic Acids Res 1993;21:1687– 8. 20. Davis AP, Witte DP, Hsieh-Li HM, Potter SS, Capecchi MR. Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature 1995;375: 791– 4. 21. Favier B, Lemeur M, Chambon P, Dolle P. Axial skeleton homeosis and forelimb malformation in Hoxd-11 mutant mice. Proc Natl Acad Sci USA 1995;92:310 – 4. 22. Horan GS, Ramirez-Solis R, Featherstone MS, Wolgemuth DJ, Bradley A, Behringer RR. Compound mutants for the paralogous hoxa-4, hoxb-4 and hoxd-4 genes show more complete homeotic transformations and a dosedependent increase in the number of vertebrate transformed. Genes Dev 1995;9:1667–77. 23. Howlett SK, Bolton VN. Sequence and regulation of morphological and molecular events during the first cycle of mouse embryogenesis. J Embryol Exp Morphol 1985;87:175–206. 24. Ramirez-Solis R, Zheng H, Whiting J, Krumlauf R, Bradley A. Hox B-4 (Hox-2.6) mutant mice show homeotic transformation of a cervical vertebra and defects in the closure of the external rudiments. Cell 1993;73: 279 –94. 25. Satokata I, Benson G, Maas R. Sexually dimorphic sterility phenotypes in Hoxa10-deficient mice. Nature 1995;374:460 –3. 26. Chalepakis G, Stoykova A, Wijnholds J, Tremblay P, Gruss P. Pax: gene regulators in the developing nervous system. J Neurobiol 1993;24:1367– 84. 27. Ryan AK, Rosenfeld, MG. POU domain family values: flexibility, partnerships, and developmental codes. Genes Dev 1997;11:1207–25. 28. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, second ed. Cold Spring Harbor, NY: Cold Spring Harbor Press, 1989. 29. Tournier-Lasserve E, Odenwald WF, Garbern J, Trojanowski J, Lazzarini RA. Remarkable intron and exon sequence conservation in human and mouse homeobox Hox 1.3 gene. Mol Cell Biol 1989;9:2273– 8. 30. Cianetti L, Di Cristofaro A, Zappavigna V, Bottero L, Boccoli G, Testa U, Russo G, Boncinelli E, Peschle C. Molecular mechanisms underlying the expression of the human HOX-5.1 gene. Nucleic Acids Res 1990;18: 4361– 8. 31. Zappavigna V, Renucci A, Izpisua-Belmonte JC, Urier G, Peschle C, Duboule D. HOX4 genes encode transcription factors with potential autoand cross-regulatory capacities. EMBO J 1991;10:4177– 87. 32. Sturm RA, Das G, Herr W. The ubiquitous octamer-binding protein Oct-1 contains a POU domain with a homeobox subdomain. Gene Dev 1988;2: 1582–99.
221
33. Chen H, Rossier C, Nakamura Y, Lynn A, Chakravarti A, Antonarakis SE. Cloning of a novel homeobox-containing gene, PKNOX1, and mapping to human chromosome 21q22.3. Genomics 1997;41:193–200. 34. Futreal PA, Cochran C, Rosenthal J, Miki Y, Swenson J, Hobbs M, et al. Isolation of a diverged homeobox gene, MOX1, from the BRACA1 region on 17q21 by solution hybrid capture. Hum Mol Genet 1994;3:1359 – 64. 35. Monica K, Galili N, Nourse J, Saltman D, Cleary ML. PBX2 and PBX3, new homeobox genes with extensive homology to the proto-oncogene PBX1. Mol Cell Biol 1991;11:6149 –57. 36. Selski DJ, Thomas NE, Coleman PD, Rogers KE. The human brain homeogene, DLX-2: cDNA sequence and alignment with the murine homologue. Gene 1993;132:301–3. 37. Morinaga T, Yasuda H, Hashimoto T, Higashio K, Tamaoki T. A human ␣-fetal protein enhancer-binding protein, ATBF1, contains four homeodomains and seventeen zinc fingers. Mol Cell Biol 1991;11:6041–9. 38. Tokunaga K, Nakamura Y, Sakata K, Fujimori K, Ohkubo M, Sawada K, Sakiyama S. Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res 1987;47:5616 –9. 39. Bai, Y, Akiyama Y, Nagasaki H, Yagi OK, Kikuchi Y, Saito N, Takeshita K, Iwai T, Yuasa Y. Distinct expression of CDX2 and GATA4/5, development-related genes, in human gastric cancer cell lines. Mol Carcinog 2000;28:184 – 8. 40. Vider BZ, Zimber A, Chastre E, Gespach C, Halperin M, Mashiah P, Yaniv A, Gazit A. Deregulated expression of homeobox-containing genes, HOXB6, B8, C8, C9, and Cdx-1, in human colon cancer cell lines. Biochem Biophys Res Commun. 2000;272:513– 8. 41. Xue C, Hasunuma T, Ashhara H, Yin W, Maeda T, Fujisawa K, Dong Y, Sumida T, Nishioka K. Transcriptional regulation of the HOX4C gene by basic fibroblast growth factor on rheumatoid synovial fibroblasts. Arthritis Rheum 1997;40:1628 –35. 42. Fromental-Ramain C, Warot X, Lakkaraju S, Favier B, Haack H, Birling C, Dierich A, Doll EP, Chambon P. Specific and redundant functions of the paralogous Hoxa-9 and Hoxd-9 genes in forelimb and axial skeleton patterning. Development 1996;122:461–72. 43. Khoa, ND, Hasunuma T, Kobata T, Kato T, Nishioka K. Expression of nurine HOXD9 during embryonic joint patterning and in human T lymphotropic virus type I tax transgenic mice with arthropathy resembling rheumatoid arthritis. Arthritis Rheum 1999;42:686 –96. 44. Miura Y, Tam T, Ido A, Morinaga T, Miki T, Hashimoto T, Tamaoki T. Cloning and characterization of an ATBF1 isoform that expresses in a neuronal differentiation-dependent manner. J Biol Chem 1995;270: 26840 – 8. 45. Ido A, Miura Y, Tamaoki T. Activation of ATBF1, a multiple-homeodomain zinc-finger gene, during neuronal differentiation of murine embryonal carcinoma cells. Dev Biol 1994;163:184 –7. 46. Kaspar P, Dvorakova M, Kralova J, Pajer Pl Kozmik, Z, Dvorak M. Myb-interacting protein, ATBF1, represses transcriptional activity of Myb oncoprotein. J Biol Chem 1999;274:14422– 8. 47. Kataoka H, Miura Y, Joh T, Seno K, Tada T, Tamaoki T, Nakabayashi H, Kawaguchi M, Asai K, Kato T, Itoh M. Alpha-fetoprotein producing gastric cancer lacks transcription factor ATBF1. Oncogene 2001;20:869 – 73. 48. Alami Y, Castronovo V, Belotti D, Flagiello D, Clausse N. HOXC5 and HOXC8 expression are selectively turned on in human cervical cancer cells compared to normal keratinocytes. Biochem Biophys Res Commun 1999;257:738 – 45. 49. Shim C, Zhang W, Rhee CH, Lee JH. Profiling of differentially expressed genes in human primary cervical cancer by complementary DNA expression array. Clin Cancer Res 1998;4:3045–50.
Expression of Homeobox Genes in Cervical Cancer Hung Li,* Chiu-Jung Huang,† ,1 and Kong-Bung Choo† ,2 *Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan 11564; and †Department of Medical Research and Education, Veterans General Hospital–Taipei, Shih-Pai, Taipei, Taiwan 11217 Received October 19, 2001
Objective. Members of the homeobox (HB) gene superfamily encode transcription factors crucial for development and may be associated with tumorigenesis. In this study, we aimed to develop a procedure to survey the expression of the dispersed-type HB genes in cervical cancer cells. Methods. Nineteen sets of degenerate primers were designed based on conserved homeodomains of known dispersed-type HB genes. A cDNA library derived from HeLa, a cervical cancer cell line, was used. Two successive rounds of PCR were performed using a combination of the HB degenerate primers and a primer recognizing the flanking sequence of the vector used in the cDNA library construction. Results. On cloning and sequence analysis of the PCR fragments generated, 10 known and 3 putative novel HB genes were detected in HeLa. RT-PCR expression analysis further showed that HOXD9 and ATBF1 were differentially expressed in cancer cells and not in normal cervix. Conclusions. Our data demonstrate the feasibility of using degenerate primers in PCR experiments in a collective analysis of complex gene families. Our data indicate that HOXD9 and ATBF1 are expressed in cervical cancer, but not in normal cervix. © 2002 Elsevier Science
Key Words: cervical cancer; dispersed homeobox genes; collective PCR analysis; degenerate primers.
INTRODUCTION Cervical cancer is a prevalent gynecological malignancy, particularly in regions where access to regular Pap smear examination is limited. For a long while, human papillomaviruses (HPVs) have been recognized as an important etiological factor leading to cervical lesions [1–3]. However, HPV alone may not be enough for the tumorigenesis process. Alterations in other cellular genes are most likely involved, as demonstrated in many studies involving the analysis of loss of heterozygosity [4 –7]. In recent years, numerous embryonic genes have been found to be involved in postnatal regulation of differentiation and cell growth. Mutations in some of these genes often lead to the genesis of many forms of human
disorders, in particular cancers [8 –17]. One of the classes of such oncodevelopmental genes is the homeobox gene family. Homeobox (HB) genes are essential in developmental processes in pattern formation and establishment of body plans in organisms ranging from Drosophila to man. Mammalian homeobox genes are categorized based on sequence homology. The Antennapedia-like genes are collectively called the HOX genes. Thirty-nine different HOX genes are organized into four clusters, each extending about 100 kb in four separate chromosomes [18, 19]. These clustered HOX genes are important regulators of development and are expressed in overlapping domains along the anterior–posterior axis of the vertebrate embryo in multiple tissues [20 –23]. In addition to the four HOX gene clusters, there are numerous non-Antp-type homeobox genes dispersed among chromosomes. Dispersed HB genes show distinct expression patterns compared with clustered genes. The better characterized non-Antp-type homeobox gene families include the Pax, the Msx, and the POU genes and genes coding for the LIM proteins [8, 26, 27]. Members of the PAX gene family have been found to be involved in some cancers [reviewed in 8, 9]. Deregulation of the expression of these and other HB genes has been linked to the genesis of leukemias and lymphomas by inducing aberrant cellular proliferation [10 –12]. HB genes induce transformation by aberrant expression, translocation, and selective transcriptional repression in conjunction with other factors [10 –14]. The developmental Patched gene of Drosophila has also been linked to the development of basal cell carcinoma of the skin [15–17]. Two recent studies have reported the analysis of HB gene expression in cervical cancer cells using PCR-based or cDNAarray hybridization approaches [18, 19]. In these studies, only the clustered-type HB genes were analyzed. The aim of the present study is to develop an approach for a more comprehensive analysis of the dispersed HB genes in cervical cancer cells. For this purpose, a panel of degenerate primers was designed based on conserved amino acid domains of various HB gene classes. The primers were applied collectively to the analysis of HB gene expression in the cervical cancer cell line, HeLa.
1
Present address: Department of Zoology, National Taiwan University, Taipei, Taiwan 10673. 2 To whom correspondence and reprint requests should be addressed. Fax: 886-2-2872 1312. E-mail: [email protected]. 0090-8258/02 $35.00 © 2002 Elsevier Science All rights reserved.
216
MATERIALS AND METHODS Cell lines and biopsies. The cervical cancer cell lines HeLa (ATCC CCL-2), CaSki (ATCC CRL-1550), and SiHa
217
PCR ANALYSIS OF HOMEOBOX GENE IN CERVICAL CANCER
TABLE 1 Degenerate Primers Used for Collective Analysis of Homeobox Genes in a HeLa cDNA Library Primer designation
Sequence a
Degeneracy b
HB domain recognized
(A1) ␥N26 (A2) ␥LFB23 (A3) ␥LB23 (A4) ␥H23 (A5) ␥A23 (B1) ␥Px23-2 (B2) ␥P23-2 (B3) ␥L23-2 (B4) ␥K23 (B5) ␥E26 (C1) ␥X23 (C2) ␥Z23 (C3) ␥M23 (C4) ␥C23 (D1) ␥SA26 (D2) ␥Px23-1 (D3) ␥P23-1 (D4) ␥L23-1 (D5) ␥En26
ATHAAYAAYTGGTTYATHAAYCARMG GTNTAYAAYTGGTTYGCNAAYMG GTNATHACNTGGTTYCARAAYMG AARATHTGGTTYCARAAYMGNMG AAYTGGTTYGGNAAYAARMGNAT CARGTNTGGTTYAGYAAYMGNMG GTNAGNGTNTGGTTYTGYAAYMG GTNRTNCARGTNTGGTTYCARAA CARGTNTGGTTYAARAAYMGNMG CARGTNAAYAAYTGGTTYATHAAYGC CARGTNAARACNTGGTAYCARAAYMG CARRTNAARATHTGGTTYCARAAYMG AARGTNTGGTTYCARAAYMGNMG CARGTNTGGTTYTGYAAYMGNMG GARACNCARGTNAARATHTGGTTYCA CARGTNTGGTTYTCNSSYMGNMG GTNCGNGTNTGGTTYTGYAAYMG CARGTNTGGTTYCARAAYMGNMG AARATHTGGTTYCARAAYAARMGNGC
576 512 768 768 512 1024 1024 1024 1024 768 1024 1536 1024 1024 768 2048 1024 1024 768
INNWFINQR VYNWFANR VITWFQNR KIWFQNRR NWFGNKRI QVWFSNRR VRVWFCNR VVQVWFQN QVWFKNRR QVNNWFINA QVKTWYQNR QVKIWFQNR KVWFQNRR QVWFCNRR ETQVKIWFQ QVWFSNRR VRVWFCNR QVWFQNRR KIWFQNKAR
a For successive rounds of PCR, the longer primers were used in first-round PCR followed by the use of the shorter internal (underlined) primer for second-round PCR. The nucleotide abbreviations used are as follows: R ⫽ A, G; Y ⫽ C, T; M ⫽ A, C; K ⫽ G, T; S ⫽ G, C; W ⫽ A, T; H ⫽ A, T, C; B ⫽ G, T, C; V ⫽ G, A, C; D ⫽ G, A, T; N ⫽ G, A, T, C. b Degeneracies are for the longer primers listed.
(ATCC HTB-35) were originally obtained from the American Type Culture Collection. C33A was a gift from Dr. Y.-S. Chang, Chang Gung University Medical College, Tao Yuen, Taiwan. The cell lines were cultured in DMEM supplemented with 10% fetal calf serum. Biopsies of normal cervix and cervical cancer were gifts of Dr. Chi-Ping Han, Head of the Obstetrics and Gynecology Department, 803rd Army Hospital, Taichung, Taiwan, and were used for the studies with consent. The pathological status of the biopsies was determined by resident pathologists of the same hospital. Whole biopsies were snapped frozen in liquid nitrogen and kept at ⫺80°C before they were used for RNA preparation. No attempts were made in isolation of epithelial cells for RNA preparation from the biopsy samples. PCR amplification of HB sequences in HeLa. HB degenerate primers used in the study are listed in Table 1. Each set of primers consists of a longer 23- to 26-meric oligonucleotide and an internal and therefore shorter (20-meric) oligonucleotide for use in two successive rounds of PCR amplification. The HeLa cDNA library (Cat. No. 937248) was purchased from Stratagene (La Jolla, CA). The cDNA library was constructed using the Uni-ZAP XR vector. The vector allows unidirectional cloning of cDNA inserts with a T3 sequence at the 5⬘-terminus and a T7 sequence at the 3⬘-end. The original cDNA library was subjected to in vivo excision and subcloning into the pBluescript SK phagemid vector (Stratagene) before cDNA plasmid DNA preparations were made. PCR was performed using a combination of the HB degenerate primers and a 22-meric T7 primer (5⬘-GTAATACGACTCACTAT-
AGGGC-3⬘) for recognition of the vector sequence located at the 3⬘-end of the cDNA insert. With the exception of two cases, the degeneracy of the HB primers was 1024 or lower. Following first-round PCR, an aliquot of the PCR product was used in second-round PCR using the overlapping and internal shorter primers to increase specificity. For all primer sets and for both rounds of PCR, amplification was carried out by touch-down PCR using a standard program as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles with a denaturation temperature of 94°C for 1 min; an annealing temperature of 60°C for 1 min (with a decrement of 0.1°C per cycle), and an extension temperature at 72°C for 2 min. After 30 cycles, a final extension at 72°C was carried out for 10 min before termination of PCR. PCR products were analyzed in 2% agarose gels (Fig. 1). Cloning and sequence analysis of PCR fragments. Major bands were excised from the gel and the DNA fragments recovered were used for cloning into the pGEM-TEasy vector (Promega, Madison, WI) using a standard procedure [28]. One to three recombinant clones from each gel-recovered PCR fragment were obtained and subjected to sequencing analysis using an ABI377 automatic sequencer. The sequences obtained were subjected to BLAST searches of the GenBank nucleotide and protein databases. Clones that showed more than 90% amino acid sequence homology with known homeodomains were candidates for further analysis. Preparation of RNA and RT-PCR analysis. Total RNA was prepared from cell lines using the Tri-Reagent kit obtained
218
LI, HUANG, AND CHOO
TABLE 2 Primers Used for RT-PCR Expression Profile Analysis Gene
Accession number
HOX-A5
M26679
HOX-D4
X17360
HOX-D9
X59372
OCT-1
X13403
PKNOX-1
U68727
MOX-1
U10492
PBX-3
X59841
DLX-2
L07919
ATBF1
L32832
GAPDH
M33197
HB92
AF426412
HB103
AF426413
Primer sequences
PCR product (bp)
Reference
AAGCCCTGTTCTCGTTGCCCTAAT CACCGCTTGGAGTCACAGTTTTCA GTTTATAAGTCTCAGCTCTCCTTC AAATAATACTTTAATCAGTGGCAG AGTTCTCGTGCAACTCGTTCCTG AAACAGCAACAACAACAAATCCGC CACTTGATGCAACTGGGAACCTGG TTCTCCCTTCTCTCCTTTGCCCTC TCTTTGCTCTCCCCGGGTAGTGAT CTCTGAAAAGTCGAAAGCAACAAC TAATAAGGAGGGCTGCTGGGTGAG TTTGGGGTGGGGAGGTGGGGTTAT TTGCATATTTCCATTACTGACTTG TGTGTTTTGATTGGTGGGATGTAT CCGGGCGCTCTGAGGCTTCTTTCT AGGGGTTGCTGAGGTCACTGCTAA AATCCCCCAAACCAGAAGAACAGA GGAAGCAGGCAGAGTGAGGTAATA GCATGGCCTTCCGTGTCCCCA TAGGCCCCTCCCCTCTTCAAG ACTTATGGAACCCAAAGAAAGAAG AGACCGACTGTCATGCAAATAATA TGATAGAGGAGTCCAACCGAGCAG AAGTTTACAGCAATTCCACACACC
458
29
532
30
501
31
411
32
555
33
400
34
438
35
534
36
483
37
450
38
386
This paper
394
This paper
from Molecular Research Center, Inc. (Cincinnati, OH). HeLa total RNA was also obtained commercially (Cat. No. 64025-1) from Clontech (Palo Alto, CA). All RNA preparations were treated with RNase-free DNase to remove contaminating genomic DNA. Five micrograms of the DNase-treated RNA was subjected to reverse transcription using oligo(dT) as a primer using the SuperScript First-Strand Synthesis System for RT-PCR obtained from Life Technologies (Gaithersburg, MD). To probe for the presence of specific HB genes, the cDNA preparations were used in PCR using the one-tube Master Mix obtained from Qiagen (Valencia, CA). The sequences of the specific HB primers used in RT-PCR are listed in Table 2. In some cases, other PCR primer sets were used for confirmation of the results obtained (data not shown). The identity of each RT-PCR-positive band was confirmed by direct sequencing of the PCR products or plasmid clones of the PCR products.
a gene probably due to biased PCR and cloning procedure. The size of the PCR-generated cDNA inserts in these clones ranged from 0.2 to 1.7 kb (data not shown). Since highly degenerate primers were used in the PCR amplification step, no attempts were made to correlate clone frequency with transcript abundance. On a BLAST search of the GenBank nucleotide and protein databases of the sequences represented by the 60 clones, about 10% of the clones were clearly false amplification products without recognizable homeodomains. We also discarded
RESULTS Using the 19 sets of highly degenerate primers, numerous bands were invariably generated in first-round PCR. On second-round PCR, however, most primer sets generated a single distinct major band (Fig. 1). The major bands were recovered for cloning. About 60 recombinant clones were randomly picked for further restriction and sequencing analysis. The number of clones representing independent gene sequences ranged from one to three with a single case of nine clones for
FIG. 1. Electrophoretic profiles of PCR detection of HB sequences in a HeLa cell line derived cDNA library. Lanes 1–19 show the PCR products generated with the use of primer sets A1–A5, B1–B5, C1–C4, and D1–D5 as shown in Table 1, in that order. The electrophoresis was done in a 2% agarose gel, and the size markers (M) are also indicated.
PCR ANALYSIS OF HOMEOBOX GENE IN CERVICAL CANCER
TABLE 3 Expression Profile of HeLa-Derived Homeobox Genes in Cervical Cancer Cells as Determined by RT-PCR Cervical cells Homeobox gene (I) Clustered HB genes HOX-A5 HOX-D4 HOXD9 (II) Dispersed HB genes OCT-1 PKNOX-1 MOX-1 PBX-3 DLX-2 ATBF1 (III) Putative novel HB gene HB92 HB103
Normal
HeLa
C33A
CaSki
SiHa
⫹ ⫹ ⫺
⫹ ⫾ ⫹
⫹ ⫹ ⫹
⫹ ⫹ ⫹
⫹ ⫹ ⫾
⫹ ⫹ ⫹ ⫹ ⫹ ⫺
⫹ ⫹ ⫹ ⫾ ⫹ ⫹
⫺ ⫹ ⫹ ⫹ ⫹ ⫺
⫹ ⫹ ⫹ ⫹ ⫹ ⫺
⫾ ⫹ ⫹ ⫺ ⫹ ⫺
⫹ ⫺
⫹ ⫹
⫹ ⫺
⫾ ⫺
⫾ ⫺
Note. In the table, “⫹” and “⫺” indicate the presence and absence of the HB gene transcripts, respectively, as detected by RT-PCR. “⫾” indicates the detection of only faint bands in the RT-PCR reaction.
clones with ambiguous homeodomains with less than 90% sequence homology or clones that carried inserts less than 0.5 kb. A final tally of 27 clones that were longer than 0.5 kb and with clearly identified homeodomains was kept for subsequent experiments. Twenty-four of the clones matched with 10 different known HB genes with different frequencies. The OCT-1, PKNOX1, MOX-1, HANF-1, PBX-3, DLX-2, and ATBF-1 genes detected are dispersed HB genes. Despite our original intention of focusing on the dispersed HB genes, three clustered HB genes, namely HOXA5, HOXD4, and HOXD9, were also detected, probably because of homologous domains recognized by the degenerate primers. No mutations were found in any of these known genes based on the sequencing data of the PCR-derived segments. Three of the clones did not match with any known genes in the nucleotide and protein database searches, suggesting that they are putative novel HB genes expressed in HeLa and are candidates for future analysis. The expression status of the HB genes detected in HeLa was further examined in other cervical cancer cell lines and in normal cervices. Primers specific to each of the 10 known homeobox genes were designed based on published sequences (Refs. [29 –38] and Table 2). The primers were, in most instances, targeted to unique sequences located beyond the 3⬘end of the conserved homeodomain. RT-PCR was performed using RNA derived from three other cervical cancer cell lines, C33A, SiHa, and CaSki. Total RNA prepared from a normal cervix was also included. The results, with the exception of the HANF-1 gene, are summarized in Table 3. In the case of HANF-1, despite the use of different sets of primers for RT-PCR detection of this gene in the cancer cell lines, none was successful, including HeLa. It is
219
unclear whether the discrepancy was due to differences in the HeLa cDNA library and the HeLa RNA used in the RT-PCR analysis or because of contamination of the cDNA library from which the clones were derived. Due to this inconsistency, RT-PCR data of HANF-1 were not included in Table 3, and the gene was not further analyzed. Of the remaining 9 HB genes analyzed, HOXD9 expression was not detected in normal cervix but it was in cervical cancer cell lines (Fig. 2 and Table 3). Expression of the ATBF1 gene in HeLa was confirmed in RT-PCR experiments. However, we failed to detect expression of this gene in normal cervix as well as in the other three cervical cell lines tested. The discrepancy is unclear. The lack of expression of the HOXD9 and ATBF1 genes in normal cervix was further confirmed in seven other independently derived normal cervical biopsy tissues (data not shown). Of the three putative novel HB genes detected in HeLa, only two genes, tentatively designated HB92 and HB103, carried sequences outside the homeodomain long enough for the design of successful PCR primers that yielded results in RT-PCR experiments (Table 3). The third gene was, therefore, not included in further analysis. The derived sequences for HB92 (GenBank Accession Number AF426412) and HB103 (AF426413) are 585 and 742 bp long, respectively. The HB92 gene was found to be expressed in both normal and cancer cells whereas gene HB103 was detected in HeLa and not in normal cervix and other cancer cell lines. The absence of expression of HB103 was also confirmed in three other independently derived normal cervical tissues. The derivation and detailed characterization of the two genes are not the subjects of this work but they are interesting candidates for further studies to elucidate their structure and biological functions. The expression data obtained by the use of cervical cancer cell lines were in most cases confirmed by RT-PCR analysis of RNA preparations from surgically derived cervical cancer biopsies. For ATBF1, HOXD9, and HB103, four different biopsy samples were used. For all other samples, two to four biopsies
FIG. 2. RT-PCR detection of HB transcripts in normal cervix (lane 1) and in cervical cancer cell lines HeLa (lane 2), C33A (lane 3), CaSki (lane 4), and SiHa (lane 5) in a 1.5% agarose gel. The primers used and the sizes of the PCR products are as shown in Table 2.
220
LI, HUANG, AND CHOO
were analyzed (data not shown). Attempts to detect transcripts of the HB genes in normal cervix and in the cervical cancer cell lines or biopsies by Northern blots were made but were unsuccessful, probably due to the low abundance of HB transcripts in the tissues [39, 40]. DISCUSSION In this work, we describe a PCR-based approach using degenerate primers for comprehensive detection and analysis of the dispersed homeobox genes in the HeLa cDNA library. The possibility exists that the expression profile of the HB genes might be altered on culture. The HeLa cell line was used in this seminal study for the purpose of rapid assessment of HB gene expression status. For the genes of interest, confirmation was obtained using surgically derived biopsies. The use of whole normal cervices as controls also warrants care in data interpretation since underlying dermis and other cells besides epidermal cells are also present. With these potential drawbacks in mind, we describe here detection of the expression of seven dispersed and three clustered HB genes in the HeLa cell line. Three other HB genes that did not match with any known gene sequences in the GenBank database are potential novel genes. Although quantification of HB transcripts in normal and cervical cancer cells by other more sensitive procedures such as real-time PCR and in situ hybridization is not the primary objective of this study, the parameter is, nonetheless, important for any single selected HB gene of interest. Such an approach, or other adoptions of the approach, should be applicable to other superfamilies of genes, such as zinc-finger proteins or kinases, and targeting at cDNA libraries derived from a wide range of temporal or spatial sources. We further show that expression of HOXD9, and possibly ATBF1, may be correlated with the pathogenesis of cervical cancer. HOXD9 is involved in the early stages of limb morphogenesis and in the pathogenesis of arthritis [41– 43]. To date, no evidence of the association of this gene with neoplastic transformation has been reported. The ATBF1 gene, encoding a large protein containing homeodomains and zinc-finger motifs, is associated with neuronal differentiation [37, 44, 45]. More recently, it has further been shown that ATBF1 represses transcriptional activity of the MYB oncoprotein [46]. On the other hand, absence of ATBF1 gene expression is associated with enhanced malignancy in ␣-fetoprotein producing gastric cancer [47]. The possible involvement of HOXD9 and ATBF1 in the pathogenesis process of cervical cancer warrants further investigation. A recent study by Alami et al. [48], focusing on the clustered HB genes, has found differential expression of HOXC5 and HOXC8 in primary normal keratinocyte cultures and in cervical cancer cell lines. In their study, specific primer pairs for all 39 HB genes were used in a PCR-based approach. In a different study, Shim et al. [49] applied cDNA hybridization arrays using normal and cervical cancer cell generated probes and
have reported the possible involvement of HOXA1 and HOX7 in cervical tumorigenesis. The inconsistency observed in these and in our studies may mainly be a reflection of different methodologies being applied. More importantly, our primers were designed to target the dispersed group of HB genes, whereas the studies conducted by Alami et al. and Shim et al. focused on the clustered gene sets. The complexity of the HB gene family certainly demands a combination of approaches in the derivation of complementary rather than exclusive results. ACKNOWLEDGMENTS This work was supported by a grant (VGH89-384) from the Veterans General Hospital–Taipei, Taiwan. We thank Dr. C. P. Han for clinical samples and M. J. Shih for competent technical assistance.
REFERENCES 1. Choo KB, Pan CC, Liu MS, Ng HT, Chen CP, Lee YN, Chao CF, Meng CL, Yeh MY, Han SH. Presence of episomal and integrated human papillomavirus DNA sequences in cervical carcinoma. J Med Virol 1987; 21:101–7. 2. Lorincz AT, Reid R, Jenson AB, Greenberg MD, Lancaster W, Kurman RJ. Human papillomavirus infection of the cervix: relative risk association with 15 common anogenital types. Obstet Gynecol 1992;79:328 –37. 3. zur Hausen H. Molecular pathogenesis of cancer of the cervix and its causation by specific human papillomavirus types. Curr Top Microbiol Immunol 1994;186:131– 6. 4. Lazo PA. The molecular genetics of cervical carcinoma. Br J Cancer 1999;80:2008 –18. 5. Mitra AB. Genetic deletion and human papillomavirus infection in cervical cancer: loss of heterozygosity sites at 3p and 5p are important genetic events. Int J Cancer 1999;82:322– 4. 6. Kersemaekers AM, Hermans J, Fleuren GJ, van de Vijver MJ. Loss of heterozygosity for defined regions on chromosomes 3, 11 and 17 in carcinomas of the uterine cervix. Br J Cancer 1998;77:192–200. 7. Mullokandov MR, Kholodilov NG, Atkin NB, Burk RD, Johnson AB, Klinger HP. Genomic alterations in cervical carcinoma: losses of chromosome heterozygosity and human papillomavirus tumor status. Cancer Res 1996;56:197–205. 8. Stuart ET, Gruss P. PAX genes: what’s new in developmental biology and cancer? Hum Mol Genet 1995;4:1717–20. 9. Read AP. Pax genes-paired feet in three camps. Nat Genet 1995;9:333– 4. 10. Nakamura T, Largaespada DA, Shaughnessy JD Jr, Jenkins NA, Copeland NG. Cooperative activation of Hoxa and Pbx-1-related genes in murine myeloid leukaemias. Nat Genet 1996;12:149 –52. 11. Nakamura T, Largaespada DA, Lee MP, Johnson LA, Ohyashiki K, Toyama K, Chen SJ, Willman CL, Chen IM, Feinberg AP, Jenkins NA, Copeland NG, Shaughnessy JD Jr. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat Genet 1996;12:154 – 8. 12. Thorsteinsdottir U, Sauvageau G, Hough MR, Dragowska W, Lansdorp PM, Lawrence HJ, Largman C, Humphries RK. Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol 1997;17:495–505. 13. Maulbecker CC, Gruss P. The oncogenic potential of deregulated homeobox genes. Cell Growth Diff 1993;4:431– 41.
PCR ANALYSIS OF HOMEOBOX GENE IN CERVICAL CANCER 14. Moskow JJ, Bullrich F, Huebner K, Daar IO, Buchberg AM. Meis1, a PBX1-related homeobox gene involved in myeloid leukemia in BXH-2 mice. Mol Cell Biol 1995;15:5434 – 43. 15. Gailani MR, Bale AE. Developmental genes and cancer: role of patched in basal cell carcinoma of the skin. J Natl Cancer Inst 1997;89:1103–9. 16. Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, Chidambaram A, Vorechovsky I, Holmberg E, Unden AB, Gillies S, Negus K, Smyth I, Pressman C, Leffell DJ, Gerrard B, Goldstein AM, Dean M, Toftgard R, Chenevix-Trench G, Wainwright B, Bale AE. Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 1996;85:841–51. 17. Johnson RL, Rothman AL, Xie J, Goodrich LV, Bare JW, Bonifas JM, Quinn AG, Myers RM, Cox DR, Epstein EH Jr, Scott MP. Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 1996;272:1668 –71. 18. Denis D. Guidebook to the homeobox genes. London: Oxford Univ. Press, 1994. 19. Scott MP. A rational nomenclature for vertebrate homeobox (HOX) genes. Nucleic Acids Res 1993;21:1687– 8. 20. Davis AP, Witte DP, Hsieh-Li HM, Potter SS, Capecchi MR. Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature 1995;375: 791– 4. 21. Favier B, Lemeur M, Chambon P, Dolle P. Axial skeleton homeosis and forelimb malformation in Hoxd-11 mutant mice. Proc Natl Acad Sci USA 1995;92:310 – 4. 22. Horan GS, Ramirez-Solis R, Featherstone MS, Wolgemuth DJ, Bradley A, Behringer RR. Compound mutants for the paralogous hoxa-4, hoxb-4 and hoxd-4 genes show more complete homeotic transformations and a dosedependent increase in the number of vertebrate transformed. Genes Dev 1995;9:1667–77. 23. Howlett SK, Bolton VN. Sequence and regulation of morphological and molecular events during the first cycle of mouse embryogenesis. J Embryol Exp Morphol 1985;87:175–206. 24. Ramirez-Solis R, Zheng H, Whiting J, Krumlauf R, Bradley A. Hox B-4 (Hox-2.6) mutant mice show homeotic transformation of a cervical vertebra and defects in the closure of the external rudiments. Cell 1993;73: 279 –94. 25. Satokata I, Benson G, Maas R. Sexually dimorphic sterility phenotypes in Hoxa10-deficient mice. Nature 1995;374:460 –3. 26. Chalepakis G, Stoykova A, Wijnholds J, Tremblay P, Gruss P. Pax: gene regulators in the developing nervous system. J Neurobiol 1993;24:1367– 84. 27. Ryan AK, Rosenfeld, MG. POU domain family values: flexibility, partnerships, and developmental codes. Genes Dev 1997;11:1207–25. 28. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, second ed. Cold Spring Harbor, NY: Cold Spring Harbor Press, 1989. 29. Tournier-Lasserve E, Odenwald WF, Garbern J, Trojanowski J, Lazzarini RA. Remarkable intron and exon sequence conservation in human and mouse homeobox Hox 1.3 gene. Mol Cell Biol 1989;9:2273– 8. 30. Cianetti L, Di Cristofaro A, Zappavigna V, Bottero L, Boccoli G, Testa U, Russo G, Boncinelli E, Peschle C. Molecular mechanisms underlying the expression of the human HOX-5.1 gene. Nucleic Acids Res 1990;18: 4361– 8. 31. Zappavigna V, Renucci A, Izpisua-Belmonte JC, Urier G, Peschle C, Duboule D. HOX4 genes encode transcription factors with potential autoand cross-regulatory capacities. EMBO J 1991;10:4177– 87. 32. Sturm RA, Das G, Herr W. The ubiquitous octamer-binding protein Oct-1 contains a POU domain with a homeobox subdomain. Gene Dev 1988;2: 1582–99.
221
33. Chen H, Rossier C, Nakamura Y, Lynn A, Chakravarti A, Antonarakis SE. Cloning of a novel homeobox-containing gene, PKNOX1, and mapping to human chromosome 21q22.3. Genomics 1997;41:193–200. 34. Futreal PA, Cochran C, Rosenthal J, Miki Y, Swenson J, Hobbs M, et al. Isolation of a diverged homeobox gene, MOX1, from the BRACA1 region on 17q21 by solution hybrid capture. Hum Mol Genet 1994;3:1359 – 64. 35. Monica K, Galili N, Nourse J, Saltman D, Cleary ML. PBX2 and PBX3, new homeobox genes with extensive homology to the proto-oncogene PBX1. Mol Cell Biol 1991;11:6149 –57. 36. Selski DJ, Thomas NE, Coleman PD, Rogers KE. The human brain homeogene, DLX-2: cDNA sequence and alignment with the murine homologue. Gene 1993;132:301–3. 37. Morinaga T, Yasuda H, Hashimoto T, Higashio K, Tamaoki T. A human ␣-fetal protein enhancer-binding protein, ATBF1, contains four homeodomains and seventeen zinc fingers. Mol Cell Biol 1991;11:6041–9. 38. Tokunaga K, Nakamura Y, Sakata K, Fujimori K, Ohkubo M, Sawada K, Sakiyama S. Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res 1987;47:5616 –9. 39. Bai, Y, Akiyama Y, Nagasaki H, Yagi OK, Kikuchi Y, Saito N, Takeshita K, Iwai T, Yuasa Y. Distinct expression of CDX2 and GATA4/5, development-related genes, in human gastric cancer cell lines. Mol Carcinog 2000;28:184 – 8. 40. Vider BZ, Zimber A, Chastre E, Gespach C, Halperin M, Mashiah P, Yaniv A, Gazit A. Deregulated expression of homeobox-containing genes, HOXB6, B8, C8, C9, and Cdx-1, in human colon cancer cell lines. Biochem Biophys Res Commun. 2000;272:513– 8. 41. Xue C, Hasunuma T, Ashhara H, Yin W, Maeda T, Fujisawa K, Dong Y, Sumida T, Nishioka K. Transcriptional regulation of the HOX4C gene by basic fibroblast growth factor on rheumatoid synovial fibroblasts. Arthritis Rheum 1997;40:1628 –35. 42. Fromental-Ramain C, Warot X, Lakkaraju S, Favier B, Haack H, Birling C, Dierich A, Doll EP, Chambon P. Specific and redundant functions of the paralogous Hoxa-9 and Hoxd-9 genes in forelimb and axial skeleton patterning. Development 1996;122:461–72. 43. Khoa, ND, Hasunuma T, Kobata T, Kato T, Nishioka K. Expression of nurine HOXD9 during embryonic joint patterning and in human T lymphotropic virus type I tax transgenic mice with arthropathy resembling rheumatoid arthritis. Arthritis Rheum 1999;42:686 –96. 44. Miura Y, Tam T, Ido A, Morinaga T, Miki T, Hashimoto T, Tamaoki T. Cloning and characterization of an ATBF1 isoform that expresses in a neuronal differentiation-dependent manner. J Biol Chem 1995;270: 26840 – 8. 45. Ido A, Miura Y, Tamaoki T. Activation of ATBF1, a multiple-homeodomain zinc-finger gene, during neuronal differentiation of murine embryonal carcinoma cells. Dev Biol 1994;163:184 –7. 46. Kaspar P, Dvorakova M, Kralova J, Pajer Pl Kozmik, Z, Dvorak M. Myb-interacting protein, ATBF1, represses transcriptional activity of Myb oncoprotein. J Biol Chem 1999;274:14422– 8. 47. Kataoka H, Miura Y, Joh T, Seno K, Tada T, Tamaoki T, Nakabayashi H, Kawaguchi M, Asai K, Kato T, Itoh M. Alpha-fetoprotein producing gastric cancer lacks transcription factor ATBF1. Oncogene 2001;20:869 – 73. 48. Alami Y, Castronovo V, Belotti D, Flagiello D, Clausse N. HOXC5 and HOXC8 expression are selectively turned on in human cervical cancer cells compared to normal keratinocytes. Biochem Biophys Res Commun 1999;257:738 – 45. 49. Shim C, Zhang W, Rhee CH, Lee JH. Profiling of differentially expressed genes in human primary cervical cancer by complementary DNA expression array. Clin Cancer Res 1998;4:3045–50.