- Email: [email protected]
Extracellular Uridine Nucleotides Initiate Cytokine Production by Murine Dendritic Cells
Cellular Immunology 195, 147–156 (1999) Article ID cimm.1999.1531, available online at http://www.idealibrary.com on
Extracellular Uridine Nucleotides Initiate Cytokine Production by Murine Dendritic Cells 1 Ian Marriott,* Edward W. Inscho,† and Kenneth L. Bost* *Department of Biology, University of North Carolina at Charlotte, Charlotte, North Carolina 28223; and †Department of Physiology, Tulane University School of Medicine, New Orleans, Louisiana 70112 Received May 13, 1999; accepted June 21, 1999
While it is recognized that activated dendritic cells perform their immune functions with greater efficacy, it is not altogether clear what factors are responsible for such activation. Recent evidence points to an important role for extracellular nucleotides in the modulation of leukocyte function. In the present study we investigated the ability of extracellular nucleotides to activate CD11c 1 murine dendritic cells. Mobilization of intracellular calcium was observed following treatment of these cells with UTP or UDP, but not ATP. Furthermore, this nucleotide receptor was pertussis toxin-sensitive, suggesting the presence of a P2Y nucleotide receptor. Such receptors were not present on murine peritoneal macrophages or on CD11c-negative leukocyte populations. Importantly, activation of these P2Y nucleotide receptors on dendritic cells provided a potent stimulus for cytokine mRNA expression and secretion. Thus, expression of a P2Y nucleotide receptor on CD11c 1 dendritic cells functions to mobilize intracellular calcium and to induce cytokine production. © 1999 Academic Press
INTRODUCTION Receptor-mediated activation of leukocytes is a necessary event for optimal immune responses. However, the physiological relevance of certain leukocyte cell surface receptors in the control of immune activation is not always apparent. For example, there is a growing body of evidence to support the notion that many leukocytes express receptors for extracellular nucleotides. These nucleotides act via an array of P2 purinoceptor subtypes and initiate elevations in intracellular [Ca 21] (for review see Ref. 1). Activation of these leukocyte
receptors has been demonstrated to modulate monokine production (2, 3), increase oxygen radical formation (4, 5), augment chemotaxis (6), or stimulate Blymphocyte activation (7). Unfortunately, the characteristics of purinoceptors expressed on leukocytes have been most often defined using cell lines or in vitro cultures, with little emphasis on their role in the activation of immune responses in vivo. Recently, there has been growing interest in the role of dendritic cells in the initiation of immune responses (8 –11). The abilities of dendritic cells to function as antigen-presenting cells and to act as costimulators of T-lymphocyte activation are well documented (12, 13). Importantly, there is accumulating evidence to suggest that dendritic cells are a significant source of cytokine production, in particular, IL-12 (10, 14 –19). Our laboratory has recently demonstrated the ability of cultured dendritic cells to be infected by Salmonella, an interaction which initiates a distinct pattern of cytokine expression and secretion by these cells (11). Despite the obvious importance of dendritic cells in the initiation of immune responses, there are significant gaps in our knowledge of those receptor-mediated signals responsible for activation of this cell population. To date, neither the presence of nucleotide receptors nor their function in normal dendritic cells has been investigated. In the present study, we report the presence of a predominantly pyrimidine-sensitive P2Y receptor on primary murine dendritic cells. These receptors stimulate an increase in intracellular calcium, followed by an increased expression of cytokine mRNAs and cytokine secretion. These studies were made possible by methods employed to isolate CD11c 1 dendritic cells following their in vivo generation by treatment with flt-3 ligand (11, 20 –24). MATERIALS AND METHODS
1
This work is supported by Grant AI32976 to K.L.B. from the National Institute of Allergy and Infectious Diseases and by Grant DK-44628 from the National Institute of Diabetes and Digestive and Kidney Diseases, American Heart Association, to E.W.I. Edward W. Inscho is an Established Investigator of the American Heart Association.
Reagents and Solutions The acetoxymethyl ester (AM) derivative of indo-1 was purchased from Teflabs (Austin, TX). Ionomycin
147
0008-8749/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
148
MARRIOTT, INSCHO, AND BOST
and 2-hydroxyethylpiperazine-N9-2-ethanesulfonic acid (Hepes) were obtained from Calbiochem (San Diego, CA). Lipopolysaccharide, adenosine 59-trisphosphate (ATP), adenosine 59-diphosphate (ADP), uridine 59-diphosphate (UDP), uridine 59-trisphosphate (UTP), platelet-activating factor (PAF), and ethylene glycol-bis-(b-aminoethyl)N,N,N9N9-tetraacetic acid (EGTA) were purchased from Sigma Chemical Co. (St. Louis, MO.). Anhydrous dimethylsulfoxide (DMSO) was purchased from Aldrich (Milwaukee, WI). NaCl, KCl, CaCl 2, MgCl 2, MnCl 2, NiCl 2, D-glucose, and NaOH were purchased from Fisher Scientific (Houston, TX). Pertussis toxin (PTX) was purchased from List Biological Laboratories Inc. (Campbell, CA). The hexasodium salt of suramin was purchased from Alexis Biochemicals (San Diego, CA). Pyridoxal-phosphate-6-azophenyl-29,49-disulfonic acid (PPADS) was purchased from Research Biochemicals International (Natick, MA). Stock solutions of indo-1-AM, thapsigargin, and gramicidin were made up in DMSO. PAF and ionomycin were dissolved in ethanol. The basic Na 1 medium employed in the fluorescence experiments contained 140 mM NaCl, 3 mM KCl, 1 mM CaCl 2, 1 mM MgCl 2, 10 mM D-glucose, and 20 mM Hepes-free acid, titrated to pH 7.3 at 37°C with NaOH. Ca 21-free solutions were made by omitting Ca 21 and adding 200 mM EGTA. When Ca 21 and Mn 21 were added to cell suspensions, these divalents were added as chloride salts. All solutions and stocks were stored at 220°C. Isolation of Murine Dendritic Cells and in Vitro Activation Primary murine dendritic cells were isolated as described previously by our laboratory (11). Briefly, the population of dendritic cells present in peripheral lymphoid organs of BALB/c mice (18 –21 g) (Charles Rivers, Wilmington, MA) was expanded in vivo by treatment with soluble human flt-3 ligand (10 mg/mouse ip daily for 9 days) (Immunex, Seattle, WA). This treatment reproducibly induced splenomegaly, lymphadenopathy, and a dramatic increase in CD11c 1 leukocytes as previously reported (11, 21). Following treatment with flt-3 ligand, mice were euthanized and spleens and mesenteric lymph nodes were excised. Organs were injected with RPMI 1640 containing 15 mM Hepes and 1 mg/ml collagenase D (Boehringer Mannheim, Indianapolis, IN), minced, and then incubated in medium with collagenase D at 37°C for 20 min. Following manipulation of the fragments through a wire mesh screen (60-mm diameter) to obtain single cell suspensions, cells were washed twice in RPMI 1640 containing 15 mM Hepes and 10% fetal bovine sera (Atlanta Biologicals, Norcross, GA). CD11c 1 leukocytes were isolated by incubation with magnetic microbeads conjugated to a monoclonal hamster anti-mouse CD11c antibody (clone N418, Miltenyi
Biotec, Auburn, CA) (0.5 ml per mouse) for 20 min at 6°C. CD11c 1 dendritic cells were then separated by passing the cell suspension over a MACS VS 1 column held in a VarioMACS magnetic separator (Miltenyi Biotec). Adherent CD11c 1 cells in the column were eluted with 5 ml of medium following removal of the magnetic source. CD11c 1 cells were then washed three times in medium with a 10-min incubation between washes to minimize the presence of any adherent magnetic beads. To ensure that the isolated cells were dendritic cells, cells were Giemsa stained for morphology and were stained immunofluorescently for the presence of CD11c and MHC class II and the absence of CD45R/B220 and CD3 as previously described (11). In some experiments, cells that were not adherent to the MACS VS 1 column, and hence were predominantly CD11c 2 (9, 10, 21), were collected and used as a negative control in the fluorimetric experiments or capture ELISAs described below. Isolation of Murine Peritoneal Macrophages and in Vitro Activation Elicited peritoneal macrophages were isolated as previously described (25). Briefly, BALB/c mice (Charles Rivers Laboratories) weighing 20 –24 g were injected ip with 250 ml of incomplete Freund’s adjuvant (Sigma Chemical Co.). Three days later, the peritoneal cavities were lavaged with RPMI 1640 (7 3 1.5 ml per animal) containing 2% FCS to remove the elicited peritoneal macrophages. After two washes in RPMI 1640, cells for use in extended in vitro studies were adhered to plastic culture flasks (Costar, Cambridge, MA) for 30 – 45 min in RPMI 1640 containing 2% FCS. Nonadherent cells were washed off, and the adherent macrophages were cultured in RPMI 1640 containing 2% FCS and gentamicin. To ensure that the isolated cells were macrophages, adherent cells were Giemsa stained for morphology and stained immunofluorescently for the presence of Mac-1 and the absence of surface Ig and CD3 as previously described (25). Fluorescence Determinations [Ca 21] i was determined by measuring the fluorescence of indo-1 as previously reported by our laboratory (26 –31). The excitation and emission wavelengths used were 331 nm (3-nm slit width) and 405 nm (10-nm slit width), respectively. All experiments were performed at 37°C using a Photon Technology International fluorescence spectrophotometer (Delta Scan) equipped with a magnetic stirrer and temperature control. Dendritic cell suspensions (25 3 10 6 cells/ml as determined by electronic counting (Coulter Electronics Model ZM, Hialeah, FL)) were loaded with indo-1 by incubation with a 4 mM concentration of the AM precursor for 30 min at 37°C in basic Na 1 medium. The
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
cells were then sedimented, resuspended in basic Na 1 medium, and stored on ice until required. To monitor fluorescence, aliquots containing the required cell number (final concentration of 1 3 10 6 cells/ml) were sedimented, resuspended in basic Na 1 medium plus or minus Ca 21 as required, and added to the cuvette. Fluorescence was calibrated using ionomycin and Mn 21 as previously described (26 –32) using a dissociation constant of 250 nM (33). Data presented are representative of results in a minimum of three experiments. Isolation of Poly(A)1 RNA and Semi-quantitative RT-PCR Total RNA was isolated from primary dendritic cells using TRIzol Reagent (Gibco-BRL, Gaithersburg, MD) as previously described (11, 25, 34, 35). Poly(A) 1 RNA was then isolated from total RNA using polystyrene latex-oligo dT beads (Oligotex-dT, Qiagen, Chatsworth, CA) as described previously (36). Poly(A) 1 RNA (100 ng) was reverse transcribed in the presence of random hexamers using 200 U of RNase H 2, Moloney leukemia virus reverse transcriptase (Promega, Madison, WI), in the buffer supplied by the manufacturer, as previously described by our laboratory (11, 25, 29, 35–37). PCR was performed on the reverse-transcribed cDNA product to determine the expression of IL-1, IL-6, IL-10, and IL-12p40, essentially as described previously (11, 25, 29, 35–37). Briefly, 10% of the total sample cDNA was combined with 2.5 U Taq polymerase (Promega), 0.02 mM dNTPs, 0.5 mg of each primer, and PCR buffer containing 2.5 mM MgCl 2 as provided by the manufacturer. Reactions were brought to 70°C prior to the addition of Taq polymerase. Samples were placed in a thermal cycler (Robocycler 40, Stratagene, La Jolla, CA) using 95°C denaturation, 60°C annealing, and 72°C extension temperatures, with the first 3 of 31 total cycles having extended denaturation and annealing times. Fifteen percent of each amplified sample was electrophoresed on ethidium-bromidestained agarose gels and visualized under UV illumination. Positive- and negative-strand PCR primers used, respectively, were TACAAGGAGAACCAAGCAACGACA and TATGTCCTGACCACTGTTGTTTCC to amplify IL-1 (287-bp fragment), GATGCTACCAAACTGGATATAATC and GGTCCTTAGCCACTCCTTCTGTG to amplify IL-6 (269-bp fragment), GGACAACATACTGCTAACCGACTC and AAAATCACTCTTCACCTGCTCCAC to amplify IL-10 (257-bp fragment), and CCACTCACATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCCAG to amplify IL-12p40 (266-bp fragment). PCR primers were derived from the published sequences of IL-1 (38), IL-6 (39), IL-10 (40), and IL-12p40 (41). These primers were designed using Oligo 4.0 primer analysis software (National Biosciences Inc., Plymouth, MA) based on their location in
149
different exons of the genomic sequence for IL-6 in addition to their lack of significant homology to sequences present in GenBank (MacVector Sequence analysis software, IBI, New Haven, CT). The sensitivity and linearity of RT-PCR amplification for this gene was predetermined using limiting dilutions of RNA generated from in vitro transcription reactions as is routine in our laboratory (11, 25, 29, 35–37). These initial studies insured that the RT-PCR conditions used here were in the linear range of amplification for this mRNA species. To insure that similar amounts of input RNA were reverse transcribed, poly(A) 1 RNA was quantified by DNA dipsticks (InVitrogen, San Diego, CA). In addition, PCR amplification of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was performed on 10% of the total cDNA product from each sample to insure similar efficiences of reverse transcription. The identity of the PCR-amplified fragments was verified by size comparison with DNA standards (Promega) and by direct DNA sequencing of representative fragments as previously described (11, 25, 29, 36). Densitometric analyses of the RT-PCR product bands were performed using NIH Image (obtained from the NIH Web site: http://rsb.info.nih.gov/nihimage). Each gel image was imported into NIH image by Adobe Photoshop (Adobe Systems, San Jose, CA), a gel-plotting macro was used to outline the bands, and the intensity was calculated on the Uncalibrated OD setting. Results are presented as either the mean fold increase over those levels found in untreated cells or as the percentage inhibition of the augmented levels, as appropriate. Quantification of IL-1, IL-6, IL-10, and IL-12p40 Secretion in Culture Supernatants Capture ELISAs were performed to quantify IL-1b, IL-6, IL-10, and IL-12p40 secretion essentially as described previously (43). Briefly, a capture antibodies against IL-1 (Genzyme Diagnostics, Cambridge, MA), IL-6, IL-10, or IL-12p40 (clones MP5-20F3, JES-2A5, and C15.6 respectively, PharMingen, San Diego, CA) were coated to microtiter plates (Nunc Maxisorp, Naperville, IL) at 10 mg/ml for 18 h. After being washed and blocked with PBS containing 2% BSA, culture supernatants were added to each well for 2 h. Unbound material was washed off and biotinylated anti-mouse IL-1b (Genzyme), IL-6, IL-10, or IL-12p40 antibody (clones MP5-32C11, SXC-1, and C17.8, respectively, PharMingen) was added at 5 mg/ml for 2 h. Bound antibody was detected by addition of streptavidin–alkaline phosphatase (Southern Biotechnology Associates, Birmingham, AL) for 30 min, followed by addition of nitrophenyl phosphate (Sigma Chemical Co.) Absorbances at 405 nm were measured approximately 30
150
MARRIOTT, INSCHO, AND BOST
min after substrate addition. A standard curve was constructed using varying dilutions of mouse rIL-1b (Genzyme), rIL-6, rIL-10, or rIL-12p40 (PharMingen). The cytokine content of culture supernatants was determined by extrapolation of absorbances to the standard curves. The minimum detectable levels in these assays were 10 pg/ml for IL-6, IL-10, and IL-12p40, and 40 pg/ml in the IL-1 assay. RESULTS Nucleotide receptors have been detected on a range of immune cells (6, 44). To date the presence of such receptors on dendritic cells has not been investigated. Nucleotides are well documented to elicit elevations in intracellular [Ca 21] due to mobilization of intracellular stores and/or influx of Ca 21 from the extracellular medium upon interaction with surface receptors (5, 6, 45, 46). To determine whether primary murine dendritic cells express functional nucleotide receptors, we have investigated the changes in intracellular [Ca 21] elicited by different species of nucleotides. The changes in intracellular free [Ca 21] were measured fluorimetrically with indo-1 following addition of each nucleotide species. A representative series of experiments is shown in Fig. 1. Addition of 20 mM ATP to cells in the presence of 1 mM external Ca 21 elicited no detectable alteration in cytosolic [Ca 21] (Fig. 1A), while 20 mM ADP resulted in a modest and transient increase (Fig. 1B). In contrast, both 20 mM UDP and 20 mM UTP elicited rapid and marked elevations in intracellular [Ca 21], with a rapid initial peak followed by a lower and slowly resolving phase (Figs. 1C and 1D, respectively). Importantly, in parallel experiments, neither indo-1-loaded elicited murine peritoneal macrophages nor cells that were nonadherent to the MACS VS 1 column (CD11c 2 cells) displayed significant elevations in intracellular [Ca 21] when treated with 20 mM UTP (Fig. 2). CD11c 2 cells were subsequently proved to be able to respond to exogenous Ca 21-mobilizing agonists by addition of the endosomal Ca 21-ATPase inhibitor, thapsigargin (100 nM) (Fig. 2B), as previously described (25–31). Macrophages were subsequently proved to be able to respond normally to exogenous agonists by addition of 100 nM platelet-activating factor as previously described (29) (Fig. 2C). These data are consistent with the presence of functional nucleotide receptors on the surface of primary dendritic cells that appear to be more sensitive to extracellular UTP and UDP than to ADP and that are nonresponsive to ATP. To further investigate the ability of uridine nucleotides to elevate intracellular [Ca 21], we have studied the effects of a range of concentrations of UTP on cytosolic free [Ca 21]. Changes in intracellular [Ca 21] accompanying addition of 0.2, 2, 20, and 200 mM UTP to cells acutely suspended in Ca 21-containing medium
FIG. 1. Effect of adenine and uracil nucleotides on [Ca 21] i in acutely isolated murine dendritic cells. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 and fluorescence monitored as outlined under Materials and Methods. Where indicated, 20 mM ATP (A), 20 mM ADP (B), 20 mM UDP (C), or 20 mM UTP (D) was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-to-animal variation.
were monitored fluorimetrically with indo-1 and are shown in Fig. 3. UTP elicited elevations in cytosolic free [Ca 21] in a dose-dependent manner with maximal responses seen at a concentration of 20 mM (Fig. 3C). Exposure of cells to higher concentrations of UTP failed to elicit an increase in the peak response in intracellular [Ca 21] (Fig. 3D). While the differential effects of the nucleotide species argue against a direct effect on the Ca 21 permeability of the plasma membrane, we have directly addressed this question by employing the nonspecific P2 antagonist, suramin (1, 6). As shown in Fig. 4B, 5-min prior exposure to 200 mM suramin abolishes the UTPmediated elevation in cytosolic free [Ca 21] seen in the control response in Fig. 4A. Such a result indicates that UTP-mediated elevations in intracellular [Ca 21] occur following interaction with a P2 nucleotide receptor, rather than by a nonspecific increase in the permeability of the plasma membrane to Ca 21. To further delineate the mechanisms responsible for the elevations in cytosolic free [Ca 21] seen following
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
FIG. 2. Differential effect of UTP on [Ca 21] i in CD11c 1 cells, CD11c 2 cells, and elicited macrophages. Indo-1-loaded CD11c 1 primary dendritic cells, CD11c 2 MACS VS 1 column nonadherent cells (CD11c 2) cells, or elicited peritoneal macrophages (F) were suspended in basic Na 1 medium containing 1 mM Ca 21 and fluorescence monitored as outlined under Materials and Methods. Where indicated, 20 mM UTP, 100 nM thapsigargin (THG), or 100 nM PAF was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading variation.
treatment with UTP, cells were exposed to 20 mM UTP in the absence of extracellular Ca 21. In these experiments, a component of the UTP-induced elevation in [Ca 21] remains, albeit significantly reduced (Fig. 4C). An elevation in intracellular [Ca 21] with an identical duration to that seen in these experiments was seen when cells were exposed to 20 mM UTP in Ca 21-containing medium in the presence of the inorganic Ca 21channel blocker Ni 21 (5 mM) (Fig. 4D). The transient nature of the UTP-mediated Ca 21 increases in the presence of Ni 21 or in the absence of external Ca 21 is most likely a result of extrusion of Ca 21 out of the cell across the plasma membrane and sequestration of Ca 21 back into endosomal stores. Hence, it appears that while a component of the Ca 21 changes elicited by UTP is due to an influx of Ca 21 across the plasma membrane as evidenced by the reduction in magnitude and duration of UTP-mediated changes in intracellular [Ca 21] in the absence of external Ca 21, or in the presence of extracellular Ni 21, a significant source of the Ca 21 elevation seems to be due to mobilization of intracellular Ca 21 stores. This finding was supported in additional experiments employ-
151
ing the endosomal Ca 21 ATPase inhibitor thapsigargin. In the absence of external Ca 21, addition of thapsigargin (100 nM) caused a transient increase in intracellular [Ca 21] (Fig. 5) of similar magnitude and duration to that seen in Figs. 4C and 4D. The transient nature of the Ca 21 increase is most likely a result of subsequent extrusion of Ca 21 across the plasma membrane. Importantly, subsequent addition of UTP (20 mM) was without effect (Fig. 5), suggesting that the UTP-releasible endosomal Ca 21 pool is contained within the thapsigargin-sensitive intracellular Ca 21 stores. Taken in concert, these observations are not consistent with the notion that UTP elevates intracellular Ca 21 solely by increasing the permeability of the plasma membrane to Ca 21. Furthermore, this finding points to the involvement of a P2Y and not a P2X receptor in this response since the latter are considered to elevate [Ca 21] via the opening of nonspecific cation channels rather than by the mobilization of intracellular Ca 21 stores (for review see Ref. 1). In contrast to P2X nucleotide receptors, stimulation of P2Y receptors involves the activation of regulatory G proteins. For example, the P2Y 4 nucleotide receptor subtype, which is particularly responsive to UTP, has been demonstrated to be inhibited by pertussis toxin
FIG. 3. UTP initiates elevations in intracellular [Ca 21] in primary dendritic cells in a dose-dependent fashion. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 and fluorescence monitored as outlined under Materials and Methods. Where indicated, 0.2, 2, 20, or 200 mM UTP was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-to-animal variation.
152
MARRIOTT, INSCHO, AND BOST
FIG. 5. UTP releases Ca 21 from thapsigargin-sensitive intracellular stores in primary dendritic cells. Indo-1-loaded dendritic cells were suspended in Ca 21-free Na 1 medium containing 200 mM EGTA and fluorescence monitored as outlined under Materials and Methods. Where indicated, 100 nM thapsigargin (THG) or 20 mM UTP was added.
While previous studies have implicated a role for nucleotide receptors in the modulation of cytokine production from immune cells (2, 48 –50), the effects of nucleotides on the production of cytokines by dendritic cells have not been investigated. To address the ability of nucleotides to modulate cytokine production in primary murine dendritic cells, cells were cultured for 2 h in medium alone or in the presence of 20 mM ATP, ADP, or UTP. Following recovery of mRNA from these cells, the expression of IL-1, IL-6, IL-10, and IL-12p40 mRNAs was analyzed using semi-quantitative RTPCR. As shown in Fig. 7, the expression of mRNAs encoding these cytokines were not appreciably altered
FIG. 4. Effects of the P2 receptor antagonist suramin, removal of extracellular Ca 21, and external Ni 21 on [Ca 21] i changes evoked by UTP. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 (A, B, and D) or Ca 21-free medium in the presence of 200 mM EGTA (C) and fluorescence monitored as outlined under Materials and Methods. Cells in B and D were exposed to 200 mM suramin and 5 mM NiCl 2, respectively, for 5 min prior to UTP addition. Where indicated, 20 mM UTP was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-to-animal variation.
(47). To better define the nucleotide receptor subtype present on dendritic cells we have investigated the ability of UTP to elevate intracellular [Ca 21] following exposure to PTX. Representative results of such an experiment are presented in Fig. 6. Cells were incubated for 5 h in RPMI medium containing 10% FCS in the absence or presence of 200 ng/ml PTX prior to fluorimetric measurement of intracellular [Ca 21]. As shown in Fig. 6, prior exposure to PTX markedly attenuated the UTP-mediated increases in cytosolic free [Ca 21] (Fig. 6B) compared to cells incubated for an identical time in the absence of PTX (Fig. 6A). Such PTX sensitivity is therefore consistent with the presence of a G-protein-linked, P2Y nucleotide receptor on primary murine dendritic cells.
FIG. 6. Effect of pertussis toxin on [Ca 21] i changes evoked by UTP. Dendritic cells were incubated for 5 h in RPMI medium containing 10% FCS in the absence (A) or presence (B) of 200 ng/ml pertussis toxin (PTX) prior to indo-1 loading. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 plus or minus 200 ng/ml PTX and fluorescence monitored as outlined under Materials and Methods. Where indicated, 20 mM UTP was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-toanimal variation.
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
FIG. 7. Effect of adenine and uracil nucleotides on cytokine mRNA expression in primary murine dendritic cells. Dendritic cells were cultured with either medium alone (CON), 20 mM ATP, 20 mM ADP, or 20 mM UTP as indicated. Cultures were maintained for 120 min prior to isolation of RNA, and semi-quantitative RT-PCR was performed to detect the expression of IL-1, IL-6, IL-10, or IL-12p40 mRNA. Results are presented as amplified products electrophoresed on ethidium-bromide-stained agarose gels. A positive control for each RT-PCR was also performed using LPS-stimulated macrophages (F). In addition, PCR amplification of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), was performed on 10% of the total cDNA product from each sample to ensure similar efficiences of reverse transcription. This experiment was performed three times with similar results.
by 20 mM ATP compared to those cells in medium only (CON). In contrast, a marked increase in the expression of mRNA encoding IL-6 was seen in dendritic cells exposed to 20 mM ADP (55.5-fold increase over unstimulated cells as determined by densitometric analysis), with modest increases in mRNA encoding IL-1, IL-10, and IL-12p40 (4.0-, 9.1-, and 2.3-fold increases over unstimulated cells, respectively) (Fig. 7). Importantly, dramatic increases were seen in the levels of all cytokine mRNAs investigated in cells exposed to 20 mM UTP (9.3-, 46.9-, 25.2-, and 2.7-fold increases for IL-1, IL-6, IL-10, and IL-12p40, respectively) (Fig. 7). A positive control for each RT-PCR was also performed using LPS-stimulated macrophages (Fig. 7). LPS-treated macrophages were used as a positive control for each RT-PCR as LPS is well documented to initiate the increased expression of mRNAs encoding an array of cytokines by murine peritoneal macrophages (25, 29). It is interesting to note that UTP-stimulated IL-12p40 expression by dendritic cells after 2 h, while LPSstimulated macrophages failed to show an increase. The increases in cytokine message expression could not be ascribed to differences in input RNA or to differences in the efficiency of reverse transcription as evidenced by RT-PCR amplification of the housekeeping gene G3PDH for each sample (Fig. 7). Rather, these data demonstrate the ability of nucleotides to enhance dendritic cell cytokine message expression in a manner that mirrors the ability of each nucleotide to mobilize intracellular [Ca 21] shown in Fig. 1. To determine whether the increased cytokine message expression initiated by nucleotides was mediated via a P2 receptor, we have used two documented competitive P2 antagonists, suramin and PPADS (51, 52).
153
Dendritic cells were cultured in the presence of 20 mM UTP in the presence or absence of either suramin (1 mM) or PPADS (1 mM). Cultures were maintained for 2 h prior to isolation of mRNA, and the expression of IL-1, IL-6, IL-10, and IL-12p40 was analyzed using semi-quantitative RT-PCR. As shown in Fig. 8, the presence of 50-fold excess of either suramin or PPADS attenuated the UTP-mediated expression of IL-1, IL10, and IL-12p40 and virtually abolished the expression of IL-6. Suramin reduced UTP-stimulated increases in cytokine mRNA as determined by densitometric analysis by 31.3, 83.4, 76.4, and 23.3% for IL-1, IL-6, IL-10, and IL-12p40, respectively. PPADS reduced UTP-stimulated increases in cytokine mRNA by 71.1, 93.3, 36.6, and 20.5% for IL-1, IL-6, IL-10, and IL-12p40, respectively. The sensitivity of the UTP-mediated increases in cytokine message expression to these antagonists is consistent with the notion that UTP-induced increases in cytokine message expression occur following interaction with a P2 nucleotide receptor. To investigate whether the increases in IL-1, IL-6, IL-10, and IL-12p40 mRNA expression caused by treatment with UTP seen in Fig. 7 were mirrored by alterations in translation and secretion of these cytokines, specific capture ELISAs were performed. Culture supernatants of untreated dendritic cells or cells treated with ATP (20 mM), UTP (20 mM), or a combination of UTP and the P2 antagonist, suramin (1 mM), for 24 h were assayed for the presence of IL-1, IL-6, IL-10, and IL-12p40. As expected, UTP induced significantly elevated levels of all cytokines assayed in primary murine dendritic cells (Fig. 9). In contrast, ATP failed to elicit any detectable elevations in any of the cytokines as-
FIG. 8. Effect of P2 antagonists on UTP-mediated changes in cytokine mRNA expression in primary murine dendritic cells. Dendritic cells were cultured with either 20 mM UTP or UTP plus either 1 mM suramin (UTP1SURA) or 1 mM PPADS (UTP1PPADS) as indicated. Cultures were maintained for 120 min prior to isolation of RNA, and semi-quantitative RT-PCR was performed to detect the expression of IL-1, IL-6, IL-10, or IL-12p40 mRNA. Results are presented as amplified products electrophoresed on ethidium-bromide-stained agarose gels. In addition, PCR amplification of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), was performed on 10% of the total cDNA product from each sample to ensure similar efficiences of reverse transcription. This experiment was performed three times with similar results.
154
MARRIOTT, INSCHO, AND BOST
FIG. 9. Effect of UTP on secretion of IL-1b, IL-6, IL-10, and IL-12p40 from murine dendritic cells. Dendritic cells were cultured in medium only (0) or with 20 mM ATP, 20 mM UTP, or UTP with the P2 antagonist suramin (1 mM) (UTP1SURA) as indicated. At 24 h after exposure, the supernatant was removed from each culture and the amount of IL-1b (A), IL-6 (B), IL-10 (C), and IL-12p40 (D) present was quantified using an appropriate capture ELISA for each. In addition a negative control for each ELISA was performed using UTP- (20 mM) stimulated CD11c 2, MACS VS 1 column nonadherent cells (CD11c 2). This experiment was performed three times with similar results. Where indicated, cytokine concentrations were below detectable levels.
sayed (Fig. 9). The observation that UTP, but not ATP, elicits cytokine secretion is consistent with this action occurring via pyrimidine nucleotide-specific receptors and argues against a nonspecific effect of this concentration of extracellular nucleotides on cytokine release. In addition, in the presence of a 50-fold excess concentration of the P2 antagonist, suramin, UTP failed to elicit significantly elevated levels of cytokine secretion (Fig. 9). A negative control for each ELISA was performed with cells that were nonadherent to the MACS VS 1 column, and hence predominantly CD11c 2. As shown in Fig. 9, these UTP- (20 mM) stimulated cells failed to significantly increase the production of any of the cytokines assayed. Taken in concert, these results demonstrate the ability of UTP to act via a P2 receptor to elevate cytokine secretion in primary dendritic cells. Furthermore, these findings are consistent with the results presented in Figs. 4, 7, and 8. DISCUSSION It has become apparent that, like ATP, extracellular uridine nucleotides exert effects on many tissues and
cells (for reviews see Refs. 53–55). Indeed, the observation that certain subtypes of nucleotide receptors display much higher affinity for uridine nucleotides than for adenosine nucleotides has lead to the suggestion that released UTP or UDP is used as the predominant nucleotide agonist in some types of cell– cell communication (56, 57). Levels of UTP in tissues may be as high as 10 26 M, i.e., sufficient to activate purinoceptors (58), and increased uridine nucleotide release has been detected from vascular endothelial cells during certain pathological conditions (59). In addition, the contention that uridine nucleotides represent endogenous ligands has been supported by recent studies in which mechanical stimulation was found to cause the cellular release of UTP in sufficient amounts to stimulate P2Y receptor responses (60, 61). To determine whether dendritic cells express functional nucleotide receptors, in vitro studies using an isolated population of CD11c 1 dendritic cells following their in vivo expansion by treatment with flt-3 ligand have been performed. Taken in concert, these in vitro studies demonstrate the presence of a P2Y nucleotide receptor that is predominantly sensitive to pyrimidine nucleotides on dendritic cells. Importantly, activation of this P2Y receptor by UTP initiates IL-1b, IL-6, IL10, and IL-12p40 mRNA expression and secretion. The contention that a P2Y receptor is present on the surface of dendritic cells, and also that this receptor mediates UTP stimulation of cytokine production, is supported by three pieces of evidence. First, UTP-mediated increases in cytosolic free [Ca 21], cytokine mRNA expression and cytokine secretion are inhibited by prior exposure to P2 receptor antagonists. Suramin and PPADS represent the best P2 receptor antagonists currently available. Suramin is a symmetrical polysulfonated napthylamine of urea and has been reported to competitively inhibit P2Y and some P2X receptor subtypes (1, 6). PPADS is chemically dissimilar to suramin and has been reported to act as a noncompetitive P2 receptor antagonist in a range of P2 subtypes (1, 51) including the P2Y 1 subtype (52). As shown in the present study, suramin completely blocked UTP-mediated elevations in intracellular [Ca 21] (Fig. 4B). Unfortunately, the effect of PPADS could not be investigated due to an incompatibility with the fluorimetric methods employed in these studies. Importantly, suramin and PPADS attenuated UTP-elicited elevations in cytokine message expression and secretion, mirroring the ability of suramin to inhibit UTP-mediated rises in cytosolic free Ca 21. Taken in concert, these data indicate that interaction of UTP with functional P2 receptors can elicit marked upregulation of cytokine production by murine dendritic cells. Second and third, UTP mobilizes a thapsigarginsensitive intracellular Ca 21 store and UTP-mediated mobilization of this Ca 21 store occurs via a pertussis-
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
toxin-sensitive G protein. In contrast to P2X receptors which appear to function as nonspecific ligand-gated cation channels (for review see Ref. 1), P2Y receptors are known to couple to heteromeric G proteins and phosphatidylinositol phospholipase C (57). The primary signaling cascade triggered by these nucleotide receptors is, therefore, via generation of inositol 1,4,5trisphosphate (IP 3) and subsequent release of IP 3-sensitive intracellular Ca 21 stores. The coupling between phospholipase C and P2Y receptors appears to operate via distinct G proteins in differing receptor subtypes (53). For example, while both P2Y 4 and P2Y 6 receptor subtypes are sensitive to uridine nucleotides, the P2Y 4 responses have been shown to be pertussis toxin sensitive (47), but those of P2Y 6 are not (62, 63). In the present study, we demonstrate that UTP initiates elevations in intracellular Ca 21 that are independent of external Ca 21 and that are insensitive to the nonorganic Ca 21-channel blocker, Ni 21. However, the UTPmediated elevations in cytosolic free Ca 21 due to release of an intracellular Ca 21 store are abolished by prior treatment with the potent and selective endosomal Ca 21-ATPase inhibitor, thapsigargin, consistent with the UTP-sensitive Ca 21 store being contained within a common intracellular Ca 21 pool. Importantly, UTP-mediated increases in intracellular [Ca 21] in the present study are sensitive to prior exposure to the G-protein inhibitor, pertussis toxin. Taken in concert, these results are consistent with UTP acting via a P2Y receptor subtype rather than a P2X nucleotide receptor subtype. Based upon the patterns and magnitude of the Ca 21 responses to the P2Y agonists surveyed, three of the six P2Y subtypes can be considered candidates for mediating dendritic cell responses to nucleotides, P2Y 3, P2Y 4, and P2Y 6. Both P2Y 1 (56), and P2Y 5 (64) subtypes display rank-order potency profiles of ATP.ADP.UTP, an order opposite to that seen in the present study. In accord with the present findings, P2Y 2 receptors are responsive to UTP (1, 65). However, P2Y 2 receptors are also highly sensitive to ATP and not responsive to either ADP or UDP (1, 65). As such, none of these receptor subtypes can fully account for the order of sensitivity to various nucleotides that we have seen in primary murine dendritic cells. The presence of the P2Y 6 receptor may account for the present results in that these receptors are reported to be highly sensitive to UDP and insensitive to ATP (65). However, the observation that Ca 21 responses to UTP in dendritic cells are markedly reduced by exposure to pertussis toxin (Fig. 6) argues against such a conclusion as this subtype has previously been demonstrated to be insensitive to this G-protein inhibitor (62, 63). The P2Y 3 receptor has been reported to be 10 times more sensitive to UDP than UTP and ADP, with ATP exhibiting only partial agonist activity (64), although the sensitivity of this receptor subtype to per-
155
tussis toxin was not investigated. However, there have been no reports of mammalian orthologues to the cloned avian P2Y 3 receptor, and it has been suggested that this receptor may be the functional avian homologue of the mammalian P2Y 6 receptor (66). In contrast, P2Y 4 receptors have been reported to be more responsive to UTP than UDP, (53, 65), but are known to be inhibited by pertussis toxin (63). Taken together, while most closely resembling the P2Y 4 and P2Y 6 receptor subtypes, the responses of primary dendritic cells to nucleotides in the present study are not in total accord with any documented P2Y subtype. Further studies must be undertaken to delineate the specific P2Y receptor subtype present in murine dendritic cells. Expression of transcripts encoding a human uridinesensitive subtype of the G-protein coupled P2Y receptor family, P2Y 6, has been detected in spleen, thymus, and leukocytes leading to the suggestion of its involvement in the immune system (53). Indeed, Clifford and co-workers (44) have proposed that the use of uridine vs adenosine nucleotides may be an advantage during inflammation. In their scenario, it is envisioned that the advantage lies in the fact that uridine nucleotides are not degraded into products such as AMP and adenosine, both of which may initiate adenosine receptor (A 2)-mediated inhibition of proinflammatory leukocyte functions as previously documented (48 –50, 62, 67). Such a suggestion is compelling in the light of the results presented in the present study. Given the recent finding that dendritic cells can serve as a significant source of cytokine production (10, 11, 14 –19), the present observation that extracellular UTP can stimulate significant production of an array of cytokines via a P2Y receptor may point to uridine nucleotides as being important endogenous ligands in the regulation of dendritic cell function. REFERENCES 1. 2.
3. 4. 5.
6. 7. 8.
Abbracchio, M. P., and Burnstock, G., Pharmacol. Ther. 6, 445, 1994. Ferrari, D., Chiozzi, P., Falzoni, S., Dal Susino, M., Melchiorri, L., Baricordi, O. R., and De Virgilio, F., J. Immunol. 159, 1451, 1997. Perregaux, D. G., and Gabel, C. A., J. Immunol. 160, 2469, 1998. Ward, P. A., Cunningham, T. W., McCulloch, K. K., and Johnson, K. J., Lab. Invest. 58, 438, 1988. Schmid-Antomarchi, H., Schmid-Alliana, A., Romey, G., Ventura, M-A., Breittmayer, V., Millet, M-A., Husson, H., Moghrabi, B., Lazdunski, M., and Rossi, B., J. Immunol. 159, 6209, 1997. Dubyak, G. R., and El-Moatassim, C., Am. J. Physiol. 265, C577, 1993. Padeh, S., Cohen, A., and Roifman, C. M., J. Immunol. 146, 1626, 1991. McWilliam, A. S., Nelson, D., Thomas, J. A., and Holt, P. G., J. Exp. Med. 179, 1331, 1994.
156 9. 10.
11. 12. 13. 14.
15. 16. 17.
18.
19.
20. 21.
22.
23.
24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38.
MARRIOTT, INSCHO, AND BOST Ruedl, C., Rieser, C., Bock, G., Wick, G., and Wolf, H., Eur. J. Immunol. 26, 1801, 1996. Sousa, C. R., Hieny, S., Scharton-Kersten, T., Jankovic, D., Charest, H., Germain, R. N., and Sher, A., J. Exp. Med. 186, 1819, 1997. Marriott, I., Hammond, T. G., Thomas, E. K., and Bost, K. L., Eur. J. Immunol. 29, 1107, 1999. Steinman, R. M., Annu. Rev. Immunol. 9, 271, 1991. Cella, M., Sallusto, F., and Lanzavecchia, A., Curr. Opin. Immunol. 9, 10, 1997. Macatonia, S. E., Hosken, N. A., Litton, M., Vieira, P., Hsieh, C. S., Culpepper, J. A., Wysocka, M., Trinchieri, G., Murphy, K. M., and O’Garra, A., J. Immunol. 154, 5071, 1995. Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A., and Alber, G., J. Exp. Med. 184, 747, 1996. Filgueira, L., Nestle, F. O., Rittig, M., Joller, H. I., and Groscurth, P., J. Immunol. 157, 2998, 1996. Heutler, C., Koch, F., Stanzl, U., Topar, G., Wysocka, M., Trinchieri, G., Enk, A., Steinman, R. M., Romani, N., and Schuler, G., Eur. J. Immunol. 26, 659, 1996. Koch, F., Stanzl, U., Jennewein, P., Janke, K., Heufler, C., Kampgen, E., Romani, N., and Schuler, G., J. Exp. Med. 184, 741, 1996. Winzler, C., Rovere, P., Rescigno, M., Granucci, F., Penna, G., Adorini, L., Zimmermann, V. S., Davoust, J., and RicciardiCastagnoli, P., J. Exp. Med. 185, 317, 1997. Drakes, M. L., Lu, L., Subbotin, V. M., and Thomson, A. W., J. Immunol. 159, 4268, 1997. Maraskovsky, E., Brasel, K., Teepe, M., Roux, E. R., Lyman, S. D., Shortman, K., and McKenna, H. J., J. Exp. Med. 184, 1953, 1996. Pulendran, B., Lingappa, J., Kennedy, M. K., Smith, J., Teepe, M., Rudensky, A., Maliszewski, C. R., and Maraskovsky, E., J. Immunol. 159, 2222, 1997. Shurin, M. R., Pandharipande, P. P., Zorina, T. D., Haluszczak, C., Subbotin, V. M., Hunter, O., Brumfield, A., Storkus, W. J., Maraskovsky, E., and Lotze, M. T., Cell. Immunol. 179, 174, 1997. Williams, D. E., Blood 90, 5022, 1997. Bost, K. L., and Mason, M. J., J. Immunol. 155, 285, 1995. Mason, M. J., Garcia Rodriguez, C., and Grinstein, S., J. Biol. Chem. 266, 20856, 1991. Mason, M. J., Mahaut-Smith, M. P., and Grinstein, S., J. Biol. Chem. 266, 10872, 1991. Marriott, I., Bost, K. L., and Mason, M. J., J. Cell. Physiol. 161, 441, 1994. Marriott, I., Bost, K. L., and Mason, M. J., J. Cell. Physiol. 177, 232, 1998. Marriott, I., and Mason, M. J., Am. J. Physiol. 269, C766, 1995. Marriott, I., and Mason, M. J., J. Biol. Chem. 271, 26732, 1996. MacDougall, S. L., Grinstein, S., and Gelfand, E. W., J. Clin. Invest. 81, 449, 1988. Grynkiewicz, G., Poenie, M., and Tsien, R. Y., J. Biol. Chem. 260, 3440, 1985. Marriott, I., and Bost, K. L., Cell. Immunol. 183, 113, 1998. Kincy-Cain, T., and Bost, K. L., J. Immunol. 157, 255, 1996. Bost, K. L., and Clements, J. C., Infect. Immun. 63, 1076, 1995. Kincy-Cain, T., and Bost, K. L., J. Immunol. 158, 2334, 1997. Telford, J. L., Macchia, G., Massone, A., Corinci, V., Palla, E., and Melli, M., Nucleic Acids Res. 14, 9955, 1986.
39.
40. 41.
42. 43. 44. 45. 46. 47. 48.
49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64.
65. 66. 67.
Van Snick, J., Cayphas, S., Szikora, J. P., Renauld, J. C., Van Roost, E., Boon, T., and Simpson, R. J., Eur. J. Immunol. 18, 193, 1988. Kim, J. M., Brannon, C. I., Copeland, N. G., Jenkins, N. A., Khan, T. A., and Moore, K. W., J. Immunol. 148, 3618, 1992. Schoenhaut, D. S., Chua, A. O., Wolitzky, A. G., Quinn, P. M., Dwyer, C. M., McComas, W., Familletti, P. C., Gately, M. K., and Gubler, U., J. Immunol. 148, 3433, 1992. Chong, C., Bost, K. L., and Clements, J. D., Infect. Immun. 64, 54, 1996. Bost, K. L., Clarke, B. L., Xu, J., Kiyono, H., McGhee, J. R., and Pascual, D. W., J. Immunol. 145, 4326, 1990. Clifford, E. E., Martin, K. A., Dalal, P., Thomas, R., and Dubyak, G. R., Am. J. Physiol. 273, C973, 1997. Falzoni, S., Munerati, M., and Ferrari, D., Spisani, S., Moretti, S., and Di Virgilio, F., J. Clin. Invest. 95, 1207, 1995. Miyagi, Y., Kobayashi, S., Nishimura, J., Fukui, M., and Kanaide, H., J. Physiol. 492, 751, 1996. Communi, D., Motte, S., Boeynaems, J. M., and Pirotton, S., Eur. J. Pharmacol. 317, 383, 1996. McWhinney, C. D., Dudley, M. W., Bowlin, T. L., Peet, N. P., Schook, L., Bradshaw, M., De, D. R., Borcherding, M., and Edwards III, C. K., Eur. J. Pharmacol. 310, 209, 1996. Hasko´, G., Szabo´, C., Ne´meth, Z. H., Kvetan, V., McCarthy Pastores, S., and Vizi, E. S., J. Immunol. 157, 4634, 1996. Ritchie, P. K., Spangelo, B. L., Krzymowski, D. K., Rossiter, T. B., Kurth, E., and Judd, A. M., Cytokine 9, 187, 1997. Lambrecht, G., J. Auton. Pharmacol. 16, 341, 1996. Hansmann, G., Bultmann, R., Tuluc, F., and Starke, K., Naunyn Schmiedebergs Arch. Pharmacol. 356, 641, 1997. Communi, D., and Boeynaems, J-M., Trends Pharmacol. Sci. 18, 83, 1997. Anderson, C. M., and Parkinson, F. E., Trends Pharmacol. Sci. 18, 387, 1997. Heilbronn, E., Knoblauch, B. H. A., and Mu¨ller, C. E., Neurochem. Res. 22, 1041, 1997. Burnstock, G., and King, B. F., Drug. Dev. Res. 38, 67, 1996. Harden, T. K., Boyer, J. L., and Nicholas, R. A., Annu. Rev. Pharmacol. Toxicol. 35, 541, 1995. Traut, T. W., Physiological concentrations of purines and pyrimidines. Mol. Cell. Biochem. 140, 1, 1994. Seifert, R., and Schultz, G., TiPS 10, 365, 1989. Enomoto, K., Furuya, K., Yamagishi, S., Oka, T., and Maeno, T., Pflu¨gers Arch. 427, 533, 1994. Lazarowski, E. R., Homolya, L., Boucher, R. C., and Harden, T. K., J. Biol. Chem. 272, 24348, 1997. Chang, K., Haraoka, K., Kumada, M., and Takuwa, Y., J. Biol. Chem. 270, 26152, 1995. Robaye, B., Boeynaems, J-M., and Communi, D., Eur. J. Pharmacol. 329, 231, 1997. Webb, T. E., Henderson, D., King, B. F., Wang, S., Simon, J., Bateson, A. N., Burnstock, G., and Barnard, E. A., Mol. Pharmacol. 50, 258, 1996. Nicholas, R. A., Watt, W. C., Lazarowski, E. R., Li, Q., and Harden, T. K., Mol. Pharmacol. 50, 224, 1996. Li, Q., Olesky, M., Palmer, R. K., Harden, T. K., Nicholas, R. A., Mol. Pharmacol. 54, 541, 1998. Le Moine, O., Stordeur, P., Schandene´, L., Marchant, A., de Groot, D., Goldman, M., and Devie`re, J., J. Immunol. 156, 4408, 1996.
Extracellular Uridine Nucleotides Initiate Cytokine Production by Murine Dendritic Cells 1 Ian Marriott,* Edward W. Inscho,† and Kenneth L. Bost* *Department of Biology, University of North Carolina at Charlotte, Charlotte, North Carolina 28223; and †Department of Physiology, Tulane University School of Medicine, New Orleans, Louisiana 70112 Received May 13, 1999; accepted June 21, 1999
While it is recognized that activated dendritic cells perform their immune functions with greater efficacy, it is not altogether clear what factors are responsible for such activation. Recent evidence points to an important role for extracellular nucleotides in the modulation of leukocyte function. In the present study we investigated the ability of extracellular nucleotides to activate CD11c 1 murine dendritic cells. Mobilization of intracellular calcium was observed following treatment of these cells with UTP or UDP, but not ATP. Furthermore, this nucleotide receptor was pertussis toxin-sensitive, suggesting the presence of a P2Y nucleotide receptor. Such receptors were not present on murine peritoneal macrophages or on CD11c-negative leukocyte populations. Importantly, activation of these P2Y nucleotide receptors on dendritic cells provided a potent stimulus for cytokine mRNA expression and secretion. Thus, expression of a P2Y nucleotide receptor on CD11c 1 dendritic cells functions to mobilize intracellular calcium and to induce cytokine production. © 1999 Academic Press
INTRODUCTION Receptor-mediated activation of leukocytes is a necessary event for optimal immune responses. However, the physiological relevance of certain leukocyte cell surface receptors in the control of immune activation is not always apparent. For example, there is a growing body of evidence to support the notion that many leukocytes express receptors for extracellular nucleotides. These nucleotides act via an array of P2 purinoceptor subtypes and initiate elevations in intracellular [Ca 21] (for review see Ref. 1). Activation of these leukocyte
receptors has been demonstrated to modulate monokine production (2, 3), increase oxygen radical formation (4, 5), augment chemotaxis (6), or stimulate Blymphocyte activation (7). Unfortunately, the characteristics of purinoceptors expressed on leukocytes have been most often defined using cell lines or in vitro cultures, with little emphasis on their role in the activation of immune responses in vivo. Recently, there has been growing interest in the role of dendritic cells in the initiation of immune responses (8 –11). The abilities of dendritic cells to function as antigen-presenting cells and to act as costimulators of T-lymphocyte activation are well documented (12, 13). Importantly, there is accumulating evidence to suggest that dendritic cells are a significant source of cytokine production, in particular, IL-12 (10, 14 –19). Our laboratory has recently demonstrated the ability of cultured dendritic cells to be infected by Salmonella, an interaction which initiates a distinct pattern of cytokine expression and secretion by these cells (11). Despite the obvious importance of dendritic cells in the initiation of immune responses, there are significant gaps in our knowledge of those receptor-mediated signals responsible for activation of this cell population. To date, neither the presence of nucleotide receptors nor their function in normal dendritic cells has been investigated. In the present study, we report the presence of a predominantly pyrimidine-sensitive P2Y receptor on primary murine dendritic cells. These receptors stimulate an increase in intracellular calcium, followed by an increased expression of cytokine mRNAs and cytokine secretion. These studies were made possible by methods employed to isolate CD11c 1 dendritic cells following their in vivo generation by treatment with flt-3 ligand (11, 20 –24). MATERIALS AND METHODS
1
This work is supported by Grant AI32976 to K.L.B. from the National Institute of Allergy and Infectious Diseases and by Grant DK-44628 from the National Institute of Diabetes and Digestive and Kidney Diseases, American Heart Association, to E.W.I. Edward W. Inscho is an Established Investigator of the American Heart Association.
Reagents and Solutions The acetoxymethyl ester (AM) derivative of indo-1 was purchased from Teflabs (Austin, TX). Ionomycin
147
0008-8749/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
148
MARRIOTT, INSCHO, AND BOST
and 2-hydroxyethylpiperazine-N9-2-ethanesulfonic acid (Hepes) were obtained from Calbiochem (San Diego, CA). Lipopolysaccharide, adenosine 59-trisphosphate (ATP), adenosine 59-diphosphate (ADP), uridine 59-diphosphate (UDP), uridine 59-trisphosphate (UTP), platelet-activating factor (PAF), and ethylene glycol-bis-(b-aminoethyl)N,N,N9N9-tetraacetic acid (EGTA) were purchased from Sigma Chemical Co. (St. Louis, MO.). Anhydrous dimethylsulfoxide (DMSO) was purchased from Aldrich (Milwaukee, WI). NaCl, KCl, CaCl 2, MgCl 2, MnCl 2, NiCl 2, D-glucose, and NaOH were purchased from Fisher Scientific (Houston, TX). Pertussis toxin (PTX) was purchased from List Biological Laboratories Inc. (Campbell, CA). The hexasodium salt of suramin was purchased from Alexis Biochemicals (San Diego, CA). Pyridoxal-phosphate-6-azophenyl-29,49-disulfonic acid (PPADS) was purchased from Research Biochemicals International (Natick, MA). Stock solutions of indo-1-AM, thapsigargin, and gramicidin were made up in DMSO. PAF and ionomycin were dissolved in ethanol. The basic Na 1 medium employed in the fluorescence experiments contained 140 mM NaCl, 3 mM KCl, 1 mM CaCl 2, 1 mM MgCl 2, 10 mM D-glucose, and 20 mM Hepes-free acid, titrated to pH 7.3 at 37°C with NaOH. Ca 21-free solutions were made by omitting Ca 21 and adding 200 mM EGTA. When Ca 21 and Mn 21 were added to cell suspensions, these divalents were added as chloride salts. All solutions and stocks were stored at 220°C. Isolation of Murine Dendritic Cells and in Vitro Activation Primary murine dendritic cells were isolated as described previously by our laboratory (11). Briefly, the population of dendritic cells present in peripheral lymphoid organs of BALB/c mice (18 –21 g) (Charles Rivers, Wilmington, MA) was expanded in vivo by treatment with soluble human flt-3 ligand (10 mg/mouse ip daily for 9 days) (Immunex, Seattle, WA). This treatment reproducibly induced splenomegaly, lymphadenopathy, and a dramatic increase in CD11c 1 leukocytes as previously reported (11, 21). Following treatment with flt-3 ligand, mice were euthanized and spleens and mesenteric lymph nodes were excised. Organs were injected with RPMI 1640 containing 15 mM Hepes and 1 mg/ml collagenase D (Boehringer Mannheim, Indianapolis, IN), minced, and then incubated in medium with collagenase D at 37°C for 20 min. Following manipulation of the fragments through a wire mesh screen (60-mm diameter) to obtain single cell suspensions, cells were washed twice in RPMI 1640 containing 15 mM Hepes and 10% fetal bovine sera (Atlanta Biologicals, Norcross, GA). CD11c 1 leukocytes were isolated by incubation with magnetic microbeads conjugated to a monoclonal hamster anti-mouse CD11c antibody (clone N418, Miltenyi
Biotec, Auburn, CA) (0.5 ml per mouse) for 20 min at 6°C. CD11c 1 dendritic cells were then separated by passing the cell suspension over a MACS VS 1 column held in a VarioMACS magnetic separator (Miltenyi Biotec). Adherent CD11c 1 cells in the column were eluted with 5 ml of medium following removal of the magnetic source. CD11c 1 cells were then washed three times in medium with a 10-min incubation between washes to minimize the presence of any adherent magnetic beads. To ensure that the isolated cells were dendritic cells, cells were Giemsa stained for morphology and were stained immunofluorescently for the presence of CD11c and MHC class II and the absence of CD45R/B220 and CD3 as previously described (11). In some experiments, cells that were not adherent to the MACS VS 1 column, and hence were predominantly CD11c 2 (9, 10, 21), were collected and used as a negative control in the fluorimetric experiments or capture ELISAs described below. Isolation of Murine Peritoneal Macrophages and in Vitro Activation Elicited peritoneal macrophages were isolated as previously described (25). Briefly, BALB/c mice (Charles Rivers Laboratories) weighing 20 –24 g were injected ip with 250 ml of incomplete Freund’s adjuvant (Sigma Chemical Co.). Three days later, the peritoneal cavities were lavaged with RPMI 1640 (7 3 1.5 ml per animal) containing 2% FCS to remove the elicited peritoneal macrophages. After two washes in RPMI 1640, cells for use in extended in vitro studies were adhered to plastic culture flasks (Costar, Cambridge, MA) for 30 – 45 min in RPMI 1640 containing 2% FCS. Nonadherent cells were washed off, and the adherent macrophages were cultured in RPMI 1640 containing 2% FCS and gentamicin. To ensure that the isolated cells were macrophages, adherent cells were Giemsa stained for morphology and stained immunofluorescently for the presence of Mac-1 and the absence of surface Ig and CD3 as previously described (25). Fluorescence Determinations [Ca 21] i was determined by measuring the fluorescence of indo-1 as previously reported by our laboratory (26 –31). The excitation and emission wavelengths used were 331 nm (3-nm slit width) and 405 nm (10-nm slit width), respectively. All experiments were performed at 37°C using a Photon Technology International fluorescence spectrophotometer (Delta Scan) equipped with a magnetic stirrer and temperature control. Dendritic cell suspensions (25 3 10 6 cells/ml as determined by electronic counting (Coulter Electronics Model ZM, Hialeah, FL)) were loaded with indo-1 by incubation with a 4 mM concentration of the AM precursor for 30 min at 37°C in basic Na 1 medium. The
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
cells were then sedimented, resuspended in basic Na 1 medium, and stored on ice until required. To monitor fluorescence, aliquots containing the required cell number (final concentration of 1 3 10 6 cells/ml) were sedimented, resuspended in basic Na 1 medium plus or minus Ca 21 as required, and added to the cuvette. Fluorescence was calibrated using ionomycin and Mn 21 as previously described (26 –32) using a dissociation constant of 250 nM (33). Data presented are representative of results in a minimum of three experiments. Isolation of Poly(A)1 RNA and Semi-quantitative RT-PCR Total RNA was isolated from primary dendritic cells using TRIzol Reagent (Gibco-BRL, Gaithersburg, MD) as previously described (11, 25, 34, 35). Poly(A) 1 RNA was then isolated from total RNA using polystyrene latex-oligo dT beads (Oligotex-dT, Qiagen, Chatsworth, CA) as described previously (36). Poly(A) 1 RNA (100 ng) was reverse transcribed in the presence of random hexamers using 200 U of RNase H 2, Moloney leukemia virus reverse transcriptase (Promega, Madison, WI), in the buffer supplied by the manufacturer, as previously described by our laboratory (11, 25, 29, 35–37). PCR was performed on the reverse-transcribed cDNA product to determine the expression of IL-1, IL-6, IL-10, and IL-12p40, essentially as described previously (11, 25, 29, 35–37). Briefly, 10% of the total sample cDNA was combined with 2.5 U Taq polymerase (Promega), 0.02 mM dNTPs, 0.5 mg of each primer, and PCR buffer containing 2.5 mM MgCl 2 as provided by the manufacturer. Reactions were brought to 70°C prior to the addition of Taq polymerase. Samples were placed in a thermal cycler (Robocycler 40, Stratagene, La Jolla, CA) using 95°C denaturation, 60°C annealing, and 72°C extension temperatures, with the first 3 of 31 total cycles having extended denaturation and annealing times. Fifteen percent of each amplified sample was electrophoresed on ethidium-bromidestained agarose gels and visualized under UV illumination. Positive- and negative-strand PCR primers used, respectively, were TACAAGGAGAACCAAGCAACGACA and TATGTCCTGACCACTGTTGTTTCC to amplify IL-1 (287-bp fragment), GATGCTACCAAACTGGATATAATC and GGTCCTTAGCCACTCCTTCTGTG to amplify IL-6 (269-bp fragment), GGACAACATACTGCTAACCGACTC and AAAATCACTCTTCACCTGCTCCAC to amplify IL-10 (257-bp fragment), and CCACTCACATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCCAG to amplify IL-12p40 (266-bp fragment). PCR primers were derived from the published sequences of IL-1 (38), IL-6 (39), IL-10 (40), and IL-12p40 (41). These primers were designed using Oligo 4.0 primer analysis software (National Biosciences Inc., Plymouth, MA) based on their location in
149
different exons of the genomic sequence for IL-6 in addition to their lack of significant homology to sequences present in GenBank (MacVector Sequence analysis software, IBI, New Haven, CT). The sensitivity and linearity of RT-PCR amplification for this gene was predetermined using limiting dilutions of RNA generated from in vitro transcription reactions as is routine in our laboratory (11, 25, 29, 35–37). These initial studies insured that the RT-PCR conditions used here were in the linear range of amplification for this mRNA species. To insure that similar amounts of input RNA were reverse transcribed, poly(A) 1 RNA was quantified by DNA dipsticks (InVitrogen, San Diego, CA). In addition, PCR amplification of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was performed on 10% of the total cDNA product from each sample to insure similar efficiences of reverse transcription. The identity of the PCR-amplified fragments was verified by size comparison with DNA standards (Promega) and by direct DNA sequencing of representative fragments as previously described (11, 25, 29, 36). Densitometric analyses of the RT-PCR product bands were performed using NIH Image (obtained from the NIH Web site: http://rsb.info.nih.gov/nihimage). Each gel image was imported into NIH image by Adobe Photoshop (Adobe Systems, San Jose, CA), a gel-plotting macro was used to outline the bands, and the intensity was calculated on the Uncalibrated OD setting. Results are presented as either the mean fold increase over those levels found in untreated cells or as the percentage inhibition of the augmented levels, as appropriate. Quantification of IL-1, IL-6, IL-10, and IL-12p40 Secretion in Culture Supernatants Capture ELISAs were performed to quantify IL-1b, IL-6, IL-10, and IL-12p40 secretion essentially as described previously (43). Briefly, a capture antibodies against IL-1 (Genzyme Diagnostics, Cambridge, MA), IL-6, IL-10, or IL-12p40 (clones MP5-20F3, JES-2A5, and C15.6 respectively, PharMingen, San Diego, CA) were coated to microtiter plates (Nunc Maxisorp, Naperville, IL) at 10 mg/ml for 18 h. After being washed and blocked with PBS containing 2% BSA, culture supernatants were added to each well for 2 h. Unbound material was washed off and biotinylated anti-mouse IL-1b (Genzyme), IL-6, IL-10, or IL-12p40 antibody (clones MP5-32C11, SXC-1, and C17.8, respectively, PharMingen) was added at 5 mg/ml for 2 h. Bound antibody was detected by addition of streptavidin–alkaline phosphatase (Southern Biotechnology Associates, Birmingham, AL) for 30 min, followed by addition of nitrophenyl phosphate (Sigma Chemical Co.) Absorbances at 405 nm were measured approximately 30
150
MARRIOTT, INSCHO, AND BOST
min after substrate addition. A standard curve was constructed using varying dilutions of mouse rIL-1b (Genzyme), rIL-6, rIL-10, or rIL-12p40 (PharMingen). The cytokine content of culture supernatants was determined by extrapolation of absorbances to the standard curves. The minimum detectable levels in these assays were 10 pg/ml for IL-6, IL-10, and IL-12p40, and 40 pg/ml in the IL-1 assay. RESULTS Nucleotide receptors have been detected on a range of immune cells (6, 44). To date the presence of such receptors on dendritic cells has not been investigated. Nucleotides are well documented to elicit elevations in intracellular [Ca 21] due to mobilization of intracellular stores and/or influx of Ca 21 from the extracellular medium upon interaction with surface receptors (5, 6, 45, 46). To determine whether primary murine dendritic cells express functional nucleotide receptors, we have investigated the changes in intracellular [Ca 21] elicited by different species of nucleotides. The changes in intracellular free [Ca 21] were measured fluorimetrically with indo-1 following addition of each nucleotide species. A representative series of experiments is shown in Fig. 1. Addition of 20 mM ATP to cells in the presence of 1 mM external Ca 21 elicited no detectable alteration in cytosolic [Ca 21] (Fig. 1A), while 20 mM ADP resulted in a modest and transient increase (Fig. 1B). In contrast, both 20 mM UDP and 20 mM UTP elicited rapid and marked elevations in intracellular [Ca 21], with a rapid initial peak followed by a lower and slowly resolving phase (Figs. 1C and 1D, respectively). Importantly, in parallel experiments, neither indo-1-loaded elicited murine peritoneal macrophages nor cells that were nonadherent to the MACS VS 1 column (CD11c 2 cells) displayed significant elevations in intracellular [Ca 21] when treated with 20 mM UTP (Fig. 2). CD11c 2 cells were subsequently proved to be able to respond to exogenous Ca 21-mobilizing agonists by addition of the endosomal Ca 21-ATPase inhibitor, thapsigargin (100 nM) (Fig. 2B), as previously described (25–31). Macrophages were subsequently proved to be able to respond normally to exogenous agonists by addition of 100 nM platelet-activating factor as previously described (29) (Fig. 2C). These data are consistent with the presence of functional nucleotide receptors on the surface of primary dendritic cells that appear to be more sensitive to extracellular UTP and UDP than to ADP and that are nonresponsive to ATP. To further investigate the ability of uridine nucleotides to elevate intracellular [Ca 21], we have studied the effects of a range of concentrations of UTP on cytosolic free [Ca 21]. Changes in intracellular [Ca 21] accompanying addition of 0.2, 2, 20, and 200 mM UTP to cells acutely suspended in Ca 21-containing medium
FIG. 1. Effect of adenine and uracil nucleotides on [Ca 21] i in acutely isolated murine dendritic cells. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 and fluorescence monitored as outlined under Materials and Methods. Where indicated, 20 mM ATP (A), 20 mM ADP (B), 20 mM UDP (C), or 20 mM UTP (D) was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-to-animal variation.
were monitored fluorimetrically with indo-1 and are shown in Fig. 3. UTP elicited elevations in cytosolic free [Ca 21] in a dose-dependent manner with maximal responses seen at a concentration of 20 mM (Fig. 3C). Exposure of cells to higher concentrations of UTP failed to elicit an increase in the peak response in intracellular [Ca 21] (Fig. 3D). While the differential effects of the nucleotide species argue against a direct effect on the Ca 21 permeability of the plasma membrane, we have directly addressed this question by employing the nonspecific P2 antagonist, suramin (1, 6). As shown in Fig. 4B, 5-min prior exposure to 200 mM suramin abolishes the UTPmediated elevation in cytosolic free [Ca 21] seen in the control response in Fig. 4A. Such a result indicates that UTP-mediated elevations in intracellular [Ca 21] occur following interaction with a P2 nucleotide receptor, rather than by a nonspecific increase in the permeability of the plasma membrane to Ca 21. To further delineate the mechanisms responsible for the elevations in cytosolic free [Ca 21] seen following
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
FIG. 2. Differential effect of UTP on [Ca 21] i in CD11c 1 cells, CD11c 2 cells, and elicited macrophages. Indo-1-loaded CD11c 1 primary dendritic cells, CD11c 2 MACS VS 1 column nonadherent cells (CD11c 2) cells, or elicited peritoneal macrophages (F) were suspended in basic Na 1 medium containing 1 mM Ca 21 and fluorescence monitored as outlined under Materials and Methods. Where indicated, 20 mM UTP, 100 nM thapsigargin (THG), or 100 nM PAF was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading variation.
treatment with UTP, cells were exposed to 20 mM UTP in the absence of extracellular Ca 21. In these experiments, a component of the UTP-induced elevation in [Ca 21] remains, albeit significantly reduced (Fig. 4C). An elevation in intracellular [Ca 21] with an identical duration to that seen in these experiments was seen when cells were exposed to 20 mM UTP in Ca 21-containing medium in the presence of the inorganic Ca 21channel blocker Ni 21 (5 mM) (Fig. 4D). The transient nature of the UTP-mediated Ca 21 increases in the presence of Ni 21 or in the absence of external Ca 21 is most likely a result of extrusion of Ca 21 out of the cell across the plasma membrane and sequestration of Ca 21 back into endosomal stores. Hence, it appears that while a component of the Ca 21 changes elicited by UTP is due to an influx of Ca 21 across the plasma membrane as evidenced by the reduction in magnitude and duration of UTP-mediated changes in intracellular [Ca 21] in the absence of external Ca 21, or in the presence of extracellular Ni 21, a significant source of the Ca 21 elevation seems to be due to mobilization of intracellular Ca 21 stores. This finding was supported in additional experiments employ-
151
ing the endosomal Ca 21 ATPase inhibitor thapsigargin. In the absence of external Ca 21, addition of thapsigargin (100 nM) caused a transient increase in intracellular [Ca 21] (Fig. 5) of similar magnitude and duration to that seen in Figs. 4C and 4D. The transient nature of the Ca 21 increase is most likely a result of subsequent extrusion of Ca 21 across the plasma membrane. Importantly, subsequent addition of UTP (20 mM) was without effect (Fig. 5), suggesting that the UTP-releasible endosomal Ca 21 pool is contained within the thapsigargin-sensitive intracellular Ca 21 stores. Taken in concert, these observations are not consistent with the notion that UTP elevates intracellular Ca 21 solely by increasing the permeability of the plasma membrane to Ca 21. Furthermore, this finding points to the involvement of a P2Y and not a P2X receptor in this response since the latter are considered to elevate [Ca 21] via the opening of nonspecific cation channels rather than by the mobilization of intracellular Ca 21 stores (for review see Ref. 1). In contrast to P2X nucleotide receptors, stimulation of P2Y receptors involves the activation of regulatory G proteins. For example, the P2Y 4 nucleotide receptor subtype, which is particularly responsive to UTP, has been demonstrated to be inhibited by pertussis toxin
FIG. 3. UTP initiates elevations in intracellular [Ca 21] in primary dendritic cells in a dose-dependent fashion. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 and fluorescence monitored as outlined under Materials and Methods. Where indicated, 0.2, 2, 20, or 200 mM UTP was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-to-animal variation.
152
MARRIOTT, INSCHO, AND BOST
FIG. 5. UTP releases Ca 21 from thapsigargin-sensitive intracellular stores in primary dendritic cells. Indo-1-loaded dendritic cells were suspended in Ca 21-free Na 1 medium containing 200 mM EGTA and fluorescence monitored as outlined under Materials and Methods. Where indicated, 100 nM thapsigargin (THG) or 20 mM UTP was added.
While previous studies have implicated a role for nucleotide receptors in the modulation of cytokine production from immune cells (2, 48 –50), the effects of nucleotides on the production of cytokines by dendritic cells have not been investigated. To address the ability of nucleotides to modulate cytokine production in primary murine dendritic cells, cells were cultured for 2 h in medium alone or in the presence of 20 mM ATP, ADP, or UTP. Following recovery of mRNA from these cells, the expression of IL-1, IL-6, IL-10, and IL-12p40 mRNAs was analyzed using semi-quantitative RTPCR. As shown in Fig. 7, the expression of mRNAs encoding these cytokines were not appreciably altered
FIG. 4. Effects of the P2 receptor antagonist suramin, removal of extracellular Ca 21, and external Ni 21 on [Ca 21] i changes evoked by UTP. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 (A, B, and D) or Ca 21-free medium in the presence of 200 mM EGTA (C) and fluorescence monitored as outlined under Materials and Methods. Cells in B and D were exposed to 200 mM suramin and 5 mM NiCl 2, respectively, for 5 min prior to UTP addition. Where indicated, 20 mM UTP was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-to-animal variation.
(47). To better define the nucleotide receptor subtype present on dendritic cells we have investigated the ability of UTP to elevate intracellular [Ca 21] following exposure to PTX. Representative results of such an experiment are presented in Fig. 6. Cells were incubated for 5 h in RPMI medium containing 10% FCS in the absence or presence of 200 ng/ml PTX prior to fluorimetric measurement of intracellular [Ca 21]. As shown in Fig. 6, prior exposure to PTX markedly attenuated the UTP-mediated increases in cytosolic free [Ca 21] (Fig. 6B) compared to cells incubated for an identical time in the absence of PTX (Fig. 6A). Such PTX sensitivity is therefore consistent with the presence of a G-protein-linked, P2Y nucleotide receptor on primary murine dendritic cells.
FIG. 6. Effect of pertussis toxin on [Ca 21] i changes evoked by UTP. Dendritic cells were incubated for 5 h in RPMI medium containing 10% FCS in the absence (A) or presence (B) of 200 ng/ml pertussis toxin (PTX) prior to indo-1 loading. Indo-1-loaded dendritic cells were suspended in basic Na 1 medium containing 1 mM Ca 21 plus or minus 200 ng/ml PTX and fluorescence monitored as outlined under Materials and Methods. Where indicated, 20 mM UTP was added. Data are from cell aliquots taken from the same indo-1 loading procedure to control for interloading and possible animal-toanimal variation.
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
FIG. 7. Effect of adenine and uracil nucleotides on cytokine mRNA expression in primary murine dendritic cells. Dendritic cells were cultured with either medium alone (CON), 20 mM ATP, 20 mM ADP, or 20 mM UTP as indicated. Cultures were maintained for 120 min prior to isolation of RNA, and semi-quantitative RT-PCR was performed to detect the expression of IL-1, IL-6, IL-10, or IL-12p40 mRNA. Results are presented as amplified products electrophoresed on ethidium-bromide-stained agarose gels. A positive control for each RT-PCR was also performed using LPS-stimulated macrophages (F). In addition, PCR amplification of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), was performed on 10% of the total cDNA product from each sample to ensure similar efficiences of reverse transcription. This experiment was performed three times with similar results.
by 20 mM ATP compared to those cells in medium only (CON). In contrast, a marked increase in the expression of mRNA encoding IL-6 was seen in dendritic cells exposed to 20 mM ADP (55.5-fold increase over unstimulated cells as determined by densitometric analysis), with modest increases in mRNA encoding IL-1, IL-10, and IL-12p40 (4.0-, 9.1-, and 2.3-fold increases over unstimulated cells, respectively) (Fig. 7). Importantly, dramatic increases were seen in the levels of all cytokine mRNAs investigated in cells exposed to 20 mM UTP (9.3-, 46.9-, 25.2-, and 2.7-fold increases for IL-1, IL-6, IL-10, and IL-12p40, respectively) (Fig. 7). A positive control for each RT-PCR was also performed using LPS-stimulated macrophages (Fig. 7). LPS-treated macrophages were used as a positive control for each RT-PCR as LPS is well documented to initiate the increased expression of mRNAs encoding an array of cytokines by murine peritoneal macrophages (25, 29). It is interesting to note that UTP-stimulated IL-12p40 expression by dendritic cells after 2 h, while LPSstimulated macrophages failed to show an increase. The increases in cytokine message expression could not be ascribed to differences in input RNA or to differences in the efficiency of reverse transcription as evidenced by RT-PCR amplification of the housekeeping gene G3PDH for each sample (Fig. 7). Rather, these data demonstrate the ability of nucleotides to enhance dendritic cell cytokine message expression in a manner that mirrors the ability of each nucleotide to mobilize intracellular [Ca 21] shown in Fig. 1. To determine whether the increased cytokine message expression initiated by nucleotides was mediated via a P2 receptor, we have used two documented competitive P2 antagonists, suramin and PPADS (51, 52).
153
Dendritic cells were cultured in the presence of 20 mM UTP in the presence or absence of either suramin (1 mM) or PPADS (1 mM). Cultures were maintained for 2 h prior to isolation of mRNA, and the expression of IL-1, IL-6, IL-10, and IL-12p40 was analyzed using semi-quantitative RT-PCR. As shown in Fig. 8, the presence of 50-fold excess of either suramin or PPADS attenuated the UTP-mediated expression of IL-1, IL10, and IL-12p40 and virtually abolished the expression of IL-6. Suramin reduced UTP-stimulated increases in cytokine mRNA as determined by densitometric analysis by 31.3, 83.4, 76.4, and 23.3% for IL-1, IL-6, IL-10, and IL-12p40, respectively. PPADS reduced UTP-stimulated increases in cytokine mRNA by 71.1, 93.3, 36.6, and 20.5% for IL-1, IL-6, IL-10, and IL-12p40, respectively. The sensitivity of the UTP-mediated increases in cytokine message expression to these antagonists is consistent with the notion that UTP-induced increases in cytokine message expression occur following interaction with a P2 nucleotide receptor. To investigate whether the increases in IL-1, IL-6, IL-10, and IL-12p40 mRNA expression caused by treatment with UTP seen in Fig. 7 were mirrored by alterations in translation and secretion of these cytokines, specific capture ELISAs were performed. Culture supernatants of untreated dendritic cells or cells treated with ATP (20 mM), UTP (20 mM), or a combination of UTP and the P2 antagonist, suramin (1 mM), for 24 h were assayed for the presence of IL-1, IL-6, IL-10, and IL-12p40. As expected, UTP induced significantly elevated levels of all cytokines assayed in primary murine dendritic cells (Fig. 9). In contrast, ATP failed to elicit any detectable elevations in any of the cytokines as-
FIG. 8. Effect of P2 antagonists on UTP-mediated changes in cytokine mRNA expression in primary murine dendritic cells. Dendritic cells were cultured with either 20 mM UTP or UTP plus either 1 mM suramin (UTP1SURA) or 1 mM PPADS (UTP1PPADS) as indicated. Cultures were maintained for 120 min prior to isolation of RNA, and semi-quantitative RT-PCR was performed to detect the expression of IL-1, IL-6, IL-10, or IL-12p40 mRNA. Results are presented as amplified products electrophoresed on ethidium-bromide-stained agarose gels. In addition, PCR amplification of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), was performed on 10% of the total cDNA product from each sample to ensure similar efficiences of reverse transcription. This experiment was performed three times with similar results.
154
MARRIOTT, INSCHO, AND BOST
FIG. 9. Effect of UTP on secretion of IL-1b, IL-6, IL-10, and IL-12p40 from murine dendritic cells. Dendritic cells were cultured in medium only (0) or with 20 mM ATP, 20 mM UTP, or UTP with the P2 antagonist suramin (1 mM) (UTP1SURA) as indicated. At 24 h after exposure, the supernatant was removed from each culture and the amount of IL-1b (A), IL-6 (B), IL-10 (C), and IL-12p40 (D) present was quantified using an appropriate capture ELISA for each. In addition a negative control for each ELISA was performed using UTP- (20 mM) stimulated CD11c 2, MACS VS 1 column nonadherent cells (CD11c 2). This experiment was performed three times with similar results. Where indicated, cytokine concentrations were below detectable levels.
sayed (Fig. 9). The observation that UTP, but not ATP, elicits cytokine secretion is consistent with this action occurring via pyrimidine nucleotide-specific receptors and argues against a nonspecific effect of this concentration of extracellular nucleotides on cytokine release. In addition, in the presence of a 50-fold excess concentration of the P2 antagonist, suramin, UTP failed to elicit significantly elevated levels of cytokine secretion (Fig. 9). A negative control for each ELISA was performed with cells that were nonadherent to the MACS VS 1 column, and hence predominantly CD11c 2. As shown in Fig. 9, these UTP- (20 mM) stimulated cells failed to significantly increase the production of any of the cytokines assayed. Taken in concert, these results demonstrate the ability of UTP to act via a P2 receptor to elevate cytokine secretion in primary dendritic cells. Furthermore, these findings are consistent with the results presented in Figs. 4, 7, and 8. DISCUSSION It has become apparent that, like ATP, extracellular uridine nucleotides exert effects on many tissues and
cells (for reviews see Refs. 53–55). Indeed, the observation that certain subtypes of nucleotide receptors display much higher affinity for uridine nucleotides than for adenosine nucleotides has lead to the suggestion that released UTP or UDP is used as the predominant nucleotide agonist in some types of cell– cell communication (56, 57). Levels of UTP in tissues may be as high as 10 26 M, i.e., sufficient to activate purinoceptors (58), and increased uridine nucleotide release has been detected from vascular endothelial cells during certain pathological conditions (59). In addition, the contention that uridine nucleotides represent endogenous ligands has been supported by recent studies in which mechanical stimulation was found to cause the cellular release of UTP in sufficient amounts to stimulate P2Y receptor responses (60, 61). To determine whether dendritic cells express functional nucleotide receptors, in vitro studies using an isolated population of CD11c 1 dendritic cells following their in vivo expansion by treatment with flt-3 ligand have been performed. Taken in concert, these in vitro studies demonstrate the presence of a P2Y nucleotide receptor that is predominantly sensitive to pyrimidine nucleotides on dendritic cells. Importantly, activation of this P2Y receptor by UTP initiates IL-1b, IL-6, IL10, and IL-12p40 mRNA expression and secretion. The contention that a P2Y receptor is present on the surface of dendritic cells, and also that this receptor mediates UTP stimulation of cytokine production, is supported by three pieces of evidence. First, UTP-mediated increases in cytosolic free [Ca 21], cytokine mRNA expression and cytokine secretion are inhibited by prior exposure to P2 receptor antagonists. Suramin and PPADS represent the best P2 receptor antagonists currently available. Suramin is a symmetrical polysulfonated napthylamine of urea and has been reported to competitively inhibit P2Y and some P2X receptor subtypes (1, 6). PPADS is chemically dissimilar to suramin and has been reported to act as a noncompetitive P2 receptor antagonist in a range of P2 subtypes (1, 51) including the P2Y 1 subtype (52). As shown in the present study, suramin completely blocked UTP-mediated elevations in intracellular [Ca 21] (Fig. 4B). Unfortunately, the effect of PPADS could not be investigated due to an incompatibility with the fluorimetric methods employed in these studies. Importantly, suramin and PPADS attenuated UTP-elicited elevations in cytokine message expression and secretion, mirroring the ability of suramin to inhibit UTP-mediated rises in cytosolic free Ca 21. Taken in concert, these data indicate that interaction of UTP with functional P2 receptors can elicit marked upregulation of cytokine production by murine dendritic cells. Second and third, UTP mobilizes a thapsigarginsensitive intracellular Ca 21 store and UTP-mediated mobilization of this Ca 21 store occurs via a pertussis-
P2Y-MEDIATED DENDRITIC CELL CYTOKINE PRODUCTION
toxin-sensitive G protein. In contrast to P2X receptors which appear to function as nonspecific ligand-gated cation channels (for review see Ref. 1), P2Y receptors are known to couple to heteromeric G proteins and phosphatidylinositol phospholipase C (57). The primary signaling cascade triggered by these nucleotide receptors is, therefore, via generation of inositol 1,4,5trisphosphate (IP 3) and subsequent release of IP 3-sensitive intracellular Ca 21 stores. The coupling between phospholipase C and P2Y receptors appears to operate via distinct G proteins in differing receptor subtypes (53). For example, while both P2Y 4 and P2Y 6 receptor subtypes are sensitive to uridine nucleotides, the P2Y 4 responses have been shown to be pertussis toxin sensitive (47), but those of P2Y 6 are not (62, 63). In the present study, we demonstrate that UTP initiates elevations in intracellular Ca 21 that are independent of external Ca 21 and that are insensitive to the nonorganic Ca 21-channel blocker, Ni 21. However, the UTPmediated elevations in cytosolic free Ca 21 due to release of an intracellular Ca 21 store are abolished by prior treatment with the potent and selective endosomal Ca 21-ATPase inhibitor, thapsigargin, consistent with the UTP-sensitive Ca 21 store being contained within a common intracellular Ca 21 pool. Importantly, UTP-mediated increases in intracellular [Ca 21] in the present study are sensitive to prior exposure to the G-protein inhibitor, pertussis toxin. Taken in concert, these results are consistent with UTP acting via a P2Y receptor subtype rather than a P2X nucleotide receptor subtype. Based upon the patterns and magnitude of the Ca 21 responses to the P2Y agonists surveyed, three of the six P2Y subtypes can be considered candidates for mediating dendritic cell responses to nucleotides, P2Y 3, P2Y 4, and P2Y 6. Both P2Y 1 (56), and P2Y 5 (64) subtypes display rank-order potency profiles of ATP.ADP.UTP, an order opposite to that seen in the present study. In accord with the present findings, P2Y 2 receptors are responsive to UTP (1, 65). However, P2Y 2 receptors are also highly sensitive to ATP and not responsive to either ADP or UDP (1, 65). As such, none of these receptor subtypes can fully account for the order of sensitivity to various nucleotides that we have seen in primary murine dendritic cells. The presence of the P2Y 6 receptor may account for the present results in that these receptors are reported to be highly sensitive to UDP and insensitive to ATP (65). However, the observation that Ca 21 responses to UTP in dendritic cells are markedly reduced by exposure to pertussis toxin (Fig. 6) argues against such a conclusion as this subtype has previously been demonstrated to be insensitive to this G-protein inhibitor (62, 63). The P2Y 3 receptor has been reported to be 10 times more sensitive to UDP than UTP and ADP, with ATP exhibiting only partial agonist activity (64), although the sensitivity of this receptor subtype to per-
155
tussis toxin was not investigated. However, there have been no reports of mammalian orthologues to the cloned avian P2Y 3 receptor, and it has been suggested that this receptor may be the functional avian homologue of the mammalian P2Y 6 receptor (66). In contrast, P2Y 4 receptors have been reported to be more responsive to UTP than UDP, (53, 65), but are known to be inhibited by pertussis toxin (63). Taken together, while most closely resembling the P2Y 4 and P2Y 6 receptor subtypes, the responses of primary dendritic cells to nucleotides in the present study are not in total accord with any documented P2Y subtype. Further studies must be undertaken to delineate the specific P2Y receptor subtype present in murine dendritic cells. Expression of transcripts encoding a human uridinesensitive subtype of the G-protein coupled P2Y receptor family, P2Y 6, has been detected in spleen, thymus, and leukocytes leading to the suggestion of its involvement in the immune system (53). Indeed, Clifford and co-workers (44) have proposed that the use of uridine vs adenosine nucleotides may be an advantage during inflammation. In their scenario, it is envisioned that the advantage lies in the fact that uridine nucleotides are not degraded into products such as AMP and adenosine, both of which may initiate adenosine receptor (A 2)-mediated inhibition of proinflammatory leukocyte functions as previously documented (48 –50, 62, 67). Such a suggestion is compelling in the light of the results presented in the present study. Given the recent finding that dendritic cells can serve as a significant source of cytokine production (10, 11, 14 –19), the present observation that extracellular UTP can stimulate significant production of an array of cytokines via a P2Y receptor may point to uridine nucleotides as being important endogenous ligands in the regulation of dendritic cell function. REFERENCES 1. 2.
3. 4. 5.
6. 7. 8.
Abbracchio, M. P., and Burnstock, G., Pharmacol. Ther. 6, 445, 1994. Ferrari, D., Chiozzi, P., Falzoni, S., Dal Susino, M., Melchiorri, L., Baricordi, O. R., and De Virgilio, F., J. Immunol. 159, 1451, 1997. Perregaux, D. G., and Gabel, C. A., J. Immunol. 160, 2469, 1998. Ward, P. A., Cunningham, T. W., McCulloch, K. K., and Johnson, K. J., Lab. Invest. 58, 438, 1988. Schmid-Antomarchi, H., Schmid-Alliana, A., Romey, G., Ventura, M-A., Breittmayer, V., Millet, M-A., Husson, H., Moghrabi, B., Lazdunski, M., and Rossi, B., J. Immunol. 159, 6209, 1997. Dubyak, G. R., and El-Moatassim, C., Am. J. Physiol. 265, C577, 1993. Padeh, S., Cohen, A., and Roifman, C. M., J. Immunol. 146, 1626, 1991. McWilliam, A. S., Nelson, D., Thomas, J. A., and Holt, P. G., J. Exp. Med. 179, 1331, 1994.
156 9. 10.
11. 12. 13. 14.
15. 16. 17.
18.
19.
20. 21.
22.
23.
24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38.
MARRIOTT, INSCHO, AND BOST Ruedl, C., Rieser, C., Bock, G., Wick, G., and Wolf, H., Eur. J. Immunol. 26, 1801, 1996. Sousa, C. R., Hieny, S., Scharton-Kersten, T., Jankovic, D., Charest, H., Germain, R. N., and Sher, A., J. Exp. Med. 186, 1819, 1997. Marriott, I., Hammond, T. G., Thomas, E. K., and Bost, K. L., Eur. J. Immunol. 29, 1107, 1999. Steinman, R. M., Annu. Rev. Immunol. 9, 271, 1991. Cella, M., Sallusto, F., and Lanzavecchia, A., Curr. Opin. Immunol. 9, 10, 1997. Macatonia, S. E., Hosken, N. A., Litton, M., Vieira, P., Hsieh, C. S., Culpepper, J. A., Wysocka, M., Trinchieri, G., Murphy, K. M., and O’Garra, A., J. Immunol. 154, 5071, 1995. Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A., and Alber, G., J. Exp. Med. 184, 747, 1996. Filgueira, L., Nestle, F. O., Rittig, M., Joller, H. I., and Groscurth, P., J. Immunol. 157, 2998, 1996. Heutler, C., Koch, F., Stanzl, U., Topar, G., Wysocka, M., Trinchieri, G., Enk, A., Steinman, R. M., Romani, N., and Schuler, G., Eur. J. Immunol. 26, 659, 1996. Koch, F., Stanzl, U., Jennewein, P., Janke, K., Heufler, C., Kampgen, E., Romani, N., and Schuler, G., J. Exp. Med. 184, 741, 1996. Winzler, C., Rovere, P., Rescigno, M., Granucci, F., Penna, G., Adorini, L., Zimmermann, V. S., Davoust, J., and RicciardiCastagnoli, P., J. Exp. Med. 185, 317, 1997. Drakes, M. L., Lu, L., Subbotin, V. M., and Thomson, A. W., J. Immunol. 159, 4268, 1997. Maraskovsky, E., Brasel, K., Teepe, M., Roux, E. R., Lyman, S. D., Shortman, K., and McKenna, H. J., J. Exp. Med. 184, 1953, 1996. Pulendran, B., Lingappa, J., Kennedy, M. K., Smith, J., Teepe, M., Rudensky, A., Maliszewski, C. R., and Maraskovsky, E., J. Immunol. 159, 2222, 1997. Shurin, M. R., Pandharipande, P. P., Zorina, T. D., Haluszczak, C., Subbotin, V. M., Hunter, O., Brumfield, A., Storkus, W. J., Maraskovsky, E., and Lotze, M. T., Cell. Immunol. 179, 174, 1997. Williams, D. E., Blood 90, 5022, 1997. Bost, K. L., and Mason, M. J., J. Immunol. 155, 285, 1995. Mason, M. J., Garcia Rodriguez, C., and Grinstein, S., J. Biol. Chem. 266, 20856, 1991. Mason, M. J., Mahaut-Smith, M. P., and Grinstein, S., J. Biol. Chem. 266, 10872, 1991. Marriott, I., Bost, K. L., and Mason, M. J., J. Cell. Physiol. 161, 441, 1994. Marriott, I., Bost, K. L., and Mason, M. J., J. Cell. Physiol. 177, 232, 1998. Marriott, I., and Mason, M. J., Am. J. Physiol. 269, C766, 1995. Marriott, I., and Mason, M. J., J. Biol. Chem. 271, 26732, 1996. MacDougall, S. L., Grinstein, S., and Gelfand, E. W., J. Clin. Invest. 81, 449, 1988. Grynkiewicz, G., Poenie, M., and Tsien, R. Y., J. Biol. Chem. 260, 3440, 1985. Marriott, I., and Bost, K. L., Cell. Immunol. 183, 113, 1998. Kincy-Cain, T., and Bost, K. L., J. Immunol. 157, 255, 1996. Bost, K. L., and Clements, J. C., Infect. Immun. 63, 1076, 1995. Kincy-Cain, T., and Bost, K. L., J. Immunol. 158, 2334, 1997. Telford, J. L., Macchia, G., Massone, A., Corinci, V., Palla, E., and Melli, M., Nucleic Acids Res. 14, 9955, 1986.
39.
40. 41.
42. 43. 44. 45. 46. 47. 48.
49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64.
65. 66. 67.
Van Snick, J., Cayphas, S., Szikora, J. P., Renauld, J. C., Van Roost, E., Boon, T., and Simpson, R. J., Eur. J. Immunol. 18, 193, 1988. Kim, J. M., Brannon, C. I., Copeland, N. G., Jenkins, N. A., Khan, T. A., and Moore, K. W., J. Immunol. 148, 3618, 1992. Schoenhaut, D. S., Chua, A. O., Wolitzky, A. G., Quinn, P. M., Dwyer, C. M., McComas, W., Familletti, P. C., Gately, M. K., and Gubler, U., J. Immunol. 148, 3433, 1992. Chong, C., Bost, K. L., and Clements, J. D., Infect. Immun. 64, 54, 1996. Bost, K. L., Clarke, B. L., Xu, J., Kiyono, H., McGhee, J. R., and Pascual, D. W., J. Immunol. 145, 4326, 1990. Clifford, E. E., Martin, K. A., Dalal, P., Thomas, R., and Dubyak, G. R., Am. J. Physiol. 273, C973, 1997. Falzoni, S., Munerati, M., and Ferrari, D., Spisani, S., Moretti, S., and Di Virgilio, F., J. Clin. Invest. 95, 1207, 1995. Miyagi, Y., Kobayashi, S., Nishimura, J., Fukui, M., and Kanaide, H., J. Physiol. 492, 751, 1996. Communi, D., Motte, S., Boeynaems, J. M., and Pirotton, S., Eur. J. Pharmacol. 317, 383, 1996. McWhinney, C. D., Dudley, M. W., Bowlin, T. L., Peet, N. P., Schook, L., Bradshaw, M., De, D. R., Borcherding, M., and Edwards III, C. K., Eur. J. Pharmacol. 310, 209, 1996. Hasko´, G., Szabo´, C., Ne´meth, Z. H., Kvetan, V., McCarthy Pastores, S., and Vizi, E. S., J. Immunol. 157, 4634, 1996. Ritchie, P. K., Spangelo, B. L., Krzymowski, D. K., Rossiter, T. B., Kurth, E., and Judd, A. M., Cytokine 9, 187, 1997. Lambrecht, G., J. Auton. Pharmacol. 16, 341, 1996. Hansmann, G., Bultmann, R., Tuluc, F., and Starke, K., Naunyn Schmiedebergs Arch. Pharmacol. 356, 641, 1997. Communi, D., and Boeynaems, J-M., Trends Pharmacol. Sci. 18, 83, 1997. Anderson, C. M., and Parkinson, F. E., Trends Pharmacol. Sci. 18, 387, 1997. Heilbronn, E., Knoblauch, B. H. A., and Mu¨ller, C. E., Neurochem. Res. 22, 1041, 1997. Burnstock, G., and King, B. F., Drug. Dev. Res. 38, 67, 1996. Harden, T. K., Boyer, J. L., and Nicholas, R. A., Annu. Rev. Pharmacol. Toxicol. 35, 541, 1995. Traut, T. W., Physiological concentrations of purines and pyrimidines. Mol. Cell. Biochem. 140, 1, 1994. Seifert, R., and Schultz, G., TiPS 10, 365, 1989. Enomoto, K., Furuya, K., Yamagishi, S., Oka, T., and Maeno, T., Pflu¨gers Arch. 427, 533, 1994. Lazarowski, E. R., Homolya, L., Boucher, R. C., and Harden, T. K., J. Biol. Chem. 272, 24348, 1997. Chang, K., Haraoka, K., Kumada, M., and Takuwa, Y., J. Biol. Chem. 270, 26152, 1995. Robaye, B., Boeynaems, J-M., and Communi, D., Eur. J. Pharmacol. 329, 231, 1997. Webb, T. E., Henderson, D., King, B. F., Wang, S., Simon, J., Bateson, A. N., Burnstock, G., and Barnard, E. A., Mol. Pharmacol. 50, 258, 1996. Nicholas, R. A., Watt, W. C., Lazarowski, E. R., Li, Q., and Harden, T. K., Mol. Pharmacol. 50, 224, 1996. Li, Q., Olesky, M., Palmer, R. K., Harden, T. K., Nicholas, R. A., Mol. Pharmacol. 54, 541, 1998. Le Moine, O., Stordeur, P., Schandene´, L., Marchant, A., de Groot, D., Goldman, M., and Devie`re, J., J. Immunol. 156, 4408, 1996.