- Email: [email protected]
High protein diet alleviates the high pH stress in Chinese mitten crab Eriocheir sinensis
Aquaculture 516 (2020) 734523
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
High protein diet alleviates the high pH stress in Chinese mitten crab Eriocheir sinensis
T
Changle Qia, Fenglu Hana, Xiaodan Wanga, Chang Xub, Zhipeng Huanga, Erchao Lib, Jian G. Qinc, Liqiao Chena,∗ a
Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, Shanghai, 200062, PR China Department of Aquaculture, College of Marine Sciences, Hainan University, Haikou, Hainan, 570228, PR China c College of Science and Engineering, Flinders University, Adelaide, SA, 5001, Australia b
A R T I C LE I N FO
A B S T R A C T
Keywords: Protein level High pH Inflammatory response Apoptotic factor Chinese mitten crab
This study evaluates whether a higher level of dietary protein could alleviate pH stress in Chinese mitten crab. Three diets with protein levels at 30%, 35% and 40% were used to feed crab for 8 weeks to determine the differential effect of dietary protein on growth, antioxidant capacity, inflammatory response and apoptotic factors at normal pH (7.8) and high pH (9.5) values. The pH elevation depressed growth performance in terms of weight gain (WG), specific growth rate (SGR) and feed conversion rate (FCR), but this effect significantly depended on the level of dietary protein. The higher level of protein significantly improved WG, SGR and FCR at high pH. Besides, high pH weakened the antioxidant capacity of crab fed the 30% protein diet by decreasing glutathione (GSH) in the hepatopancreas, and resulting significantly higher malondialdehyde crab fed 30% protein than those fed other two protein levels. The dependent effect of dietary protein and pH was also found in antioxidant capacity. The higher protein diet increased GSH, superoxide dismutase and glutathione S-transferase in the hepatopancreas at high pH. In addition, high pH triggered pro-inflammatory and pro-apoptotic factors in the 30% protein group by upregulating the pro-apoptotic and pro-inflammatory genes including lipopolysaccharide-induced TNF-alpha factor, p38 mitogen-activated protein kinase, a disintegrin and metalloproteinase domain-containing protein 17, Bcl-2-associated X and Cysteine-aspartic acid protease 3. The higher protein diets downregulated pro-apoptotic and pro-inflammatory genes at high pH. In conclusion, the high pH caused a marked growth retardation and poor feed efficiency, triggered oxidative stress and pro-inflammatory and increased pro-apoptotic factors in crab fed the low protein diet. Higher protein diets alleviated the negative effect of pH in the Chinese mitten crab. This study suggests that a higher protein diet can counteract the negative effect of high pH in Chinese mitten crab farming.
1. Introduction The Chinese mitten crab (Eriocheir sinensis) is an important crustacean species in freshwater aquaculture, and have been well received by consumers because of its high nutritional value and unique flavor (Wang et al., 2016). The production was over 750,000 tons in 2017 in China (Ministry of Agriculture and Rural Affairs and China Society of Fisheries, 2018). In tensive farming, aquatic plants such as Elodea Canadensis, Vallisneria natans and Hydrilla verticillata are planted in ponds to provide shelters for crab, and almost 60% of the pond area is covered hydrophytes (Gong et al., 2015). However, the photosynthesis of aquatic plants can enhance pH in the water, which in turn stress crab
during daytime (Boyd, 1990). Sometimes, the pH value in crab ponds can exceed 10.5 (Wang et al., 2018) and become an environmental stress factor in crab farming. The excessive high pH level in a pond can adversely affect aquatic animals. High pH stress can depress growth and molting (Liu et al., 2016), decrease antioxidant capacity (Han et al., 2016; Zhou et al., 2009), cause oxidative stress (Wang et al., 2009; Wang et al., 2012) and apoptotic response (Wang et al., 2011; Wang et al., 2018), reduce immunity (Yu et al., 2011), impair intestine barrier function (Duan et al., 2019) and even lead to mortality (Allan and Maguire, 1992; Furtado et al., 2015). Meanwhile, high pH also can inhibit ammonia excretion from aquatic animals (Chen and Kou, 1996; Weihrauch and O'Donnell,
∗ Corresponding author. Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, Shanghai, 200241, PR China. E-mail address: [email protected] (L. Chen).
https://doi.org/10.1016/j.aquaculture.2019.734523 Received 28 July 2019; Received in revised form 11 September 2019; Accepted 16 September 2019 Available online 23 October 2019 0044-8486/ © 2019 Published by Elsevier B.V.
Aquaculture 516 (2020) 734523
C. Qi, et al.
2017) and subsequently cause hyperammonemia to cause physiological abnormality (Shaw, 1981). Thus, improvement of stress resistance is an ideal way to reduce the risk of mortality when aquatic animals encounter high pH stress in the environment. Nutrient manipulation in the diet is reportedly able to improve the ability of aquatic animals to resist high pH stress. In fish, dietary vitamin C can increase the non-specific immunity of largemouth bass Micropterus salmoides (Xie et al., 2006). In crustaceans, the diet supplemented with astaxanthin can alleviate the oxidative damage and apoptosis induced by a chronic high pH stress in Chinese mitten crab (Wang et al., 2018). However, most previous studies have focused on the effects of food additives on alleviation of high pH stress. There has been little research on the alleviation of high pH stress by manipulating dietary energy substances. When an animal is exposed to an environmental stressor, more energy will be needed to cope with the stress (Hossain et al., 2012). Protein is the most important energy substance of aquatic animals, especially in crustaceans (Halver and Hardy, 2002; NRC, 2011). A higher level of protein in diets is beneficial to increase the ability of salinity resistance in the Pacific white shrimp (Litopenaeus vannamei) (Li et al., 2011). In fish, the blunt snout bream (Megalobrama amblycephala) has a better ability to resist heat stress when food contains adequate protein (Habte-Tsion et al., 2017). Nevertheless, we do not have adequate knowledge on whether a higher level of dietary protein in diets can alleviate the stress of high pH in crustacean. In this study, we aim to investigate the possibility of using high dietary protein to alleviate the stress of pH in the Chinese mitten crab. The animal responses were evaluated by measuring growth performance, whole-body proximate composition, antioxidative capacity, inflammatory and apoptotic factors.
Table 1 Formulation and chemical proximate composition of experimental diets (dry matter basis, %). Ingredients
30% protein
35% protein
40% protein
Caseina Gelatinb Corn starchc Cholesterold Soybean lecithind Fish oil Soybean oile Sodium carboxymethylcellulose Cellulose Vitamin premixf Mineral premixg Butylated hydroxytoluene Betained Proximate analysis Moisture Crude protein Crude lipid
28.00 4.67 25.00 0.30 2.00 3.00 3.00 2.00 22.93 3.00 3.00 0.10 3.00
33.00 5.50 25.00 0.30 2.00 3.00 3.00 2.00 17.10 3.00 3.00 0.10 3.00
38.00 6.33 25.00 0.30 2.00 3.00 3.00 2.00 11.27 3.00 3.00 0.10 3.00
9.97 30.31 8.45
9.95 35.25 8.39
9.93 40.17 8.44
a
Casein: Gansu hualing dairy Co., Ltd, Gansu, China. Gelatin: Baotou Dongbao Bio-Tech Co., Ltd, Baotou, China. c Corn starch: Beijing gusong food Co., Ltd, Beijing, China. d Sangon Biotech (Shanghai) Co., Ltd, Shanghai, China. e Soybean oil: Cofco food marketing Co. Ltd, Beijing, China. f Vitamin premix (per 100 g premix): retinol acetate, 0.043 g; thiamin hydrochloride, 0.15 g; riboflavin, 0.0625 g; Ca pantothenate, 0.3 g; niacin, 0.3 g; pyridoxine hydrochloride, 0.225 g; para-aminobenzoic acid, 0.1 g; ascorbic acid, 0.5 g; biotin, 0.005 g; folic acid, 0.025 g; cholecalciferol, 0.0075 g; α-tocopherol acetate, 0.5 g; menadione, 0.05 g; inositol, 1 g. All ingredients are filled with α-cellulose to 100 g (Han et al., 2019). g Mineral premix (per 100 g premix): KH2PO4, 21.5 g; NaH2PO4, 10.0 g; Ca (H2PO4)2, 26.5 g; CaCO3, 10.5 g; KCl, 2.8 g; MgSO4·7H2O, 10.0 g; AlCl3·6H2O, 0.024 g; ZnSO4·7H2O, 0.476 g; MnSO4·6H2O, 0.143 g; KI, 0.023 g; CuCl2·2H2O, 0.015 g; CoCl2·6H2O, 0.14 g Calcium lactate, 16.50 g; Fe-citrate, 1 g. All ingredients are diluted with α-cellulose to 100 g (Han et al., 2019). b
2. Material and methods 2.1. Experimental diets The formulation and chemical proximate composition of experimental diets are shown in Table 1. Three purified isoenergetic and isolipidic diets were formulated to contain 30%, 35% and 40% protein. The process was as follows: All ingredients were ground into power and sieved through a 60 mesh strainer, weighed according to the experimental formulation, and then mixed all ingredients thoroughly with an electric mixer. Subsequently oil and distilled water were added to make a dough and then pelleted with a screw-press pelletizer using a 2.0 mm die. Pellets were air dried at room temperature for approximately 48 h to a moisture content < 10%. After drying, all diets were packed in bags and stored at −20 °C until to use.
weight were hand-fed to crabs three times at 7:00, 16:00 and 24:00, with 20%, 20% and 60% of the full daily ration, respectively. Feces were removed in the morning (09:00), and the water of 30% tank volume was exchanged daily. Dead crabs were immediately removed from the tank, weighed and recorded. Feed intake of each tank was recorded throughout the trial period to calculate feed conversion ratio. During the experimental period, the water temperature was measured using an digital thermometer (Odatime KT 300, Baode instrument Co. Ltd., Chaozhou, China) and varied from 25 °C to 27 °C. Dissolved oxygen (DO) was measured using a commercial assay kit (LH2105, Hangzhou Lohand biological Co. Ltd., Hangzhou, China). DO was above 7 mg L−1 during the whole experimental period. Ammonia was measured using a commercial assay kit (LH2007, Hangzhou Lohand biological Co. Ltd., Hangzhou, China), and the ammonia content in the water was below 0.05 mg L−1. At the end, all the crabs from each tank were anesthetized with crushed pieces of ice, and then counted and group-weighed by tank after fasting for 24 h. Five crabs from each tank were euthanized and stored at −20 °C for whole-body proximate analysis. Another 10 crabs per tank were euthanized and then the hemolymph was taken from the leg joints of each crab with a 1.0 mL syringe. The hemolymph was placed in a 4 °C refrigerator for 5 h, and then the coagulated hemolymph was stirred up with a syringe needle and centrifuged with a highspeed refrigerated centrifuge for 10 min (8000 r/min). Serum was carefully collected with a pipette and kept at −80 °C for analysis. Concurrently, hepatopancreas samples were put into liquid nitrogen immediately and then stored at −80 °C for the analyses of enzyme and gene expression. Weight gain, specific growth rate, feed intake, feed conversion ratio and survival were calculated according to the following formulas:
2.2. Growth trial, sampling and growth evaluation Crabs used in this experiment were obtained from a local farm in Chongming, Shanghai. Prior to the trial, all crabs were stocked in 300 L tanks (100 × 80 × 60 cm), and fed with a commercial diet to acclimatize for one week in a factory farming workshop in Huzhou, Zhejiang. The water used in this experiment was filtered with a quartz sand filter (Xinyi Water Treatment Equipment Factory, Huzhou, China) and aerated fully before use. The control pH in the water ranged from 7.7 to 7.9. The high pH water was set at 9.5 by gradually adding a 1 M NaOH solution, and the pH level was checked and adjusted every 8 h using a portable pH meter (SIN-PH-100, Hangzhou). Crabs were fasted for 24 h before the start of the feeding trial and then 840 crabs (1.19 ± 0.11 g, mean ± S.D.) with intact appendages were randomly distributed into 24 tanks and each tank containing 35 crabs. Each experimental diet was randomly allotted to eight tanks, where crabs in four tanks were cultivated at normal pH (pH = 7.8), and the other four tanks were cultivated at high pH (pH = 9.5). Four bundles of corrugated plastic pipes and arched tiles were placed in each tank as shelters to reduce attacking behavior. Diets with a daily ration of 4% body 2
Aquaculture 516 (2020) 734523
C. Qi, et al.
CFX96 Real-Time PCR system (Bio-rad, Richmond, CA). PCR conditions were as follows: 94 °C for 3 min, and following 40 cycles at 94 °C for 15 s and 60 °C for 50 s, and 72 °C for 20 s. Samples were run in triplicate and normalized to the control gene β-actin. Gene expression levels were calculated by the 2–ΔΔCT comparative CT method (Livak and Schmittgen, 2001).
Weight gain (WG, %) = (final weight - initial weight) × 100/initial weight; Specific growth rate (SGR, %) = 100 * (LN final weight - LN initial weight)/days; Feed intake (FI, g) = Total feed weight/final number; Feed conversion ratio (FCR) = feed intake/(final weight - initial weight); Survival (%) = 100 × final number/initial number.
2.5. Statistical analysis Statistical analysis was performed using the SPSS 23.0 for Windows (SPSS, Michigan Avenue, Chicago, IL, USA). Data were analyzed by two-way analysis of variance (ANOVA) to determine if there was any interaction between dietary protein level and water pH level. At the same pH condition, one-way analysis of variance (ANOVA) was used to analyze the significant differences among crabs fed the diets with different protein level after normality test and homogeneity of variance. When the means of each treatment were significantly different, Duncan's multiple range test was used to compare means among these treatments. At the same protein level, independent-samples T test was used to determine significant differences between crabs cultivated at normal pH and those cultivated at high pH. Significance was set at P < 0.05. The data were represented as the mean ± standard error of mean (S.E.).
2.3. Chemical composition analysis of experimental diets and crabs Chemical compositions of the experimental diets and crabs wholebody were determined by the standard procedures using proximate composition analysis (AOAC, 2005). Four duplicate samples were measured in each treatment (n = 4). Moisture was determined after own dry at 105 °C. Crude protein was quantified using a KjeltecTM 8200 (Foss, Hoganas, Sweden). Crude lipid was extracted using a 1000 mL Soxhlet extraction tube (Fujian minbo toughened glass Co. Ltd., Fujian, China). Ash was analyzed using a muffle furnace (PCD-E3000 Serials, Peaks, Japan) at 550 °C for 6 h. 2.4. Enzyme activity assay The enzyme activities in the hepatopancreas were measured using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) in accordance with the instructions of the manufacturer. The source and information of each kit used in this study were as follows: superoxide dismutase (SOD; Cat. No. A001-1), malondialdehyde (MDA; Cat. No. A003-1), reduced glutathione (GSH; Cat. No. A006-2-1), glutathione S-transferase (GST; Cat. No. A004-1-1) and total protein (TP; Cat. No. A045-2).
3. Results 3.1. Growth performance Weight gain (WG), specific growth rate (SGR), feed intake (FI), feed conversion rate (FCR) and survival of the Chinese mitten crab fed the experimental diets for 8 weeks are shown in Fig. 1. At normal pH (pH = 7.8), WG, SGR and FCR were not significantly affected by dietary protein level, but at high pH (pH = 9.5), WG and SGR significantly increased with the increase of dietary protein (P < 0.05). A significantly lower FCR was obtained in crabs fed the 35% protein and 40% protein diets compared with those fed the 30% protein diet (P < 0.05). There were no significant main effects of water pH on the WG and SGR; however, in the 30% protein diets, crabs at high pH had significantly lower WG and SGR compared with those at normal pH (P < 0.05). There was a significant main effect of water pH on FCR (P < 0.05), and in the 30% protein diets, crabs at high pH had a significant higher FCR compared with those at normal pH (P < 0.05). The significant interactive effect was obtained between dietary protein level and water pH in terms of WG, SGR and FCR (P < 0.05). The feed intake and survival of crabs were not significantly affected by the dietary protein level and water pH. There was no significant interactive effect between dietary protein level and water pH on the feed intake and crab survival.
2.4.1. Analysis of gene expression Total RNA was extracted from the hepatopancreas using the RNAiso Plus (CAT # 9109, Takara, Japan) according to the manufacturer's protocol. The total RNA concentration and quality were estimated using the Nano Drop 2000 spectrophotometer (Thermo, USA). If the ratio of A260/A280 was between 1.8 to 2.0, the sample was used for reverse transcribed using a PrimeScript™ RT master mix reagent kit (Perfect Real Time, Takara, Japan). The specific primers for the genes of E. sinensis were designed based on the transcriptome sequencing results and NCBI data base using NCBI Primer BLAST (Table 2). The RT-PCR amplification reactions were performed in a volume of 10 μL containing 5 μL 2 × SYBR Premix Ex TaqTM, 0.25 μL of 10 mM forward primer, 0.25 μL of 10 mM reverse primer and 4.5 μL of diluted cDNA, using the Table 2 Primer sequences used for real-time PCR. Primers name
Sequences (5′-3′)
Product size
References
LITAF F LITAF R p38-MAPK F p38-MAPK R ADAM 17 F ADAM 17 R Bcl-2 F Bcl-2 R Bax F Bax R Caspase 3 F Caspase 3 R β-actin F β-actin R
ATCAGCTCCCCCACCCTATG GTTGTTGGAGCAGCACCTTG CACTCATGGGTGCTGACCTC TACTTGAGGCCTCGCAACAC GATGTCCGCAACCTGCTAGA CAGGATGCCCCCTTCAAACT CATCATCTCCCTCTTCGCGG CAGTCCCATCACGTCGATCA AGAGATGAAGCAGACCACGC TTCTACGGTGGGTGAGTCCA AGGAAAAGTTCACGCCGCTA GGCTGCCTTCTGTCAGGATT TGGGTATGGAATCCGTTGGC AGACAGAACGTTGTTGGCGA
102 bp
KF892539.1
100 bp
KF582665.1
102 bp
KC007532.1
100 bp
c141679_g4
106 bp
c143681_g1
103 bp
MH183147.1
101 bp
KM244725.1
3.2. Whole-body composition There were no significant main effects of dietary protein level and pH on the whole-body protein, lipid, ash and moisture content (Fig. 2). No significant interactive effect was obtained between protein level and water pH in terms of whole-body protein, lipid, ash and moisture content of whole-body crab. 3.3. Antioxidative capacity The significant main effects of dietary protein level on malondialdehyde (MDA), superoxide dismutase (SOD), reduced glutathione (GSH) and glutathione S-transferase (GST) in the hepatopancreas of crabs were obtained (P < 0.05; Fig. 3). Crabs fed the 30% protein diet had significantly higher MDA content in both high pH and normal pH condition compared with those fed the 35% protein and 40% protein diets (P < 0.05). At high pH, crabs fed the 35% protein diet showed
Notes: LITAF: lipopolysaccharide-induced TNF-alpha factor; p38-MAPK: p38 mitogen-activated protein kinase; ADAM 17: A Disintegrin and metalloproteinase domain-containing protein 10; Bcl 2: B-cell lymphoma 2; Bax: Bcl-2-associated X; Caspase 3: Cysteine-aspartic acid protease 3. 3
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 1. The growth performance of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5). SGR: specific growth rate. Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
significant main effects of pH on ADAM 17 and Bax were found (P < 0.05). In the 30% protein and 40% protein diets, crabs cultivated at high pH had higher ADAM 17 gene expression than those at normal pH, but the differences were not significant. In the 30% protein diet, crabs cultivated at high pH had significantly higher Bax gene expression than those at normal pH (P < 0.05). In the 30% protein diet, crabs at high pH had significantly higher caspase 3 gene expression than those at normal pH (P < 0.05). There were no significant interactive effects between dietary protein level and pH on ADAM 17, Bcl-2, Bax and caspase 3.
significantly higher SOD than those fed the 30% protein diet (P < 0.05). At normal pH, crabs fed the 35% protein diet had significantly higher GSH and GST than those fed the 30% protein diet (P < 0.05). At high pH, significantly lower GSH was found in crabs fed the 30% protein diet than those fed the 35% protein and 40% protein diets (P < 0.05). Water pH had the significant main effect on MDA (P < 0.05). In the 30% protein diets, crabs at high pH had significantly MDA than those at normal pH (P < 0.05). In the 30% protein diets, crabs at high pH had significantly lower SGH than those at normal pH (P < 0.05). Significant interactive effects between dietary protein level and water pH were found in MDA and GSH (P < 0.05).
4. Discussion 3.4. Inflammatory response and apoptotic factors In the present study, dietary protein level significantly affected the growth of crabs at high pH in the water. Protein deficiency in the diets resulted growth retardation. The result was in accordance with the previous studies on tilapia (Oreochromis niloticus) (Hooley et al., 2014) and sea urchin (Strongylocentrotus intermedius) (Zuo et al., 2017). However, the growth was not significantly affected by dietary protein level at normal pH. It is speculated that 30% protein can already support the maximal growth of crab at normal pH, so that it showed no significant growth differences among each protein level. But when crabs are exposed to high pH, some protein may be used to response to high pH stress, and the low protein diet (30% protein) may no longer meet the nutritional needs for crabs and result in growth reduction. In addition, high pH stress also decreased the growth of crabs in the 30% protein group. It is similar to the result on juvenile Chinese mitten crab (Liu et al., 2016). The possible reason may be due to high pH stress that
As showed in the Fig. 4, the relative expression of p38-MAPK significantly increased with the increase of dietary protein at normal pH (P < 0.05). However, at high pH, the relative expression of p38-MAPK decreased with the increase of dietary protein, and crabs fed the 30% protein diet had a significantly higher gene expression of p38-MAPK than those fed the 40% protein diet (P < 0.05). In the 30% protein diet, the p38-MAPK gene expression was significantly upregulated in crabs cultivated at high pH than those cultivated at normal pH (P < 0.05). The significant interactive effect was found between dietary protein level and pH on p38-MAPK (P < 0.05). The significant main effect (P < 0.05) of water pH was found on the relative expression of Lipopolysaccharide-induced TNF-alpha factor (LITAF), and in the 35% protein diet, crabs cultivated at high pH had a significantly higher LITAF gene expression than those at normal pH (P < 0.05). The 4
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 2. The whole-body proximate composition of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5) (fresh matter basis). Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
did not reach lethal level. Growth performance is related to the healthy status of aquatic animals. Oxidative damage and antioxidative capacity are important indexes to reflect the healthy status of aquatic animals. The level of malondialdehyde is used as a reference of oxidative damage as it is one of the end products of lipid peroxidation (Lushchak, 2011). In the present study, high pH stress increased malondialdehyde in the hepatopancreas, suggesting that high pH stress may be related to lipid peroxidation. The similar results were also reported in Litopenaeus vannamei (Duan et al., 2019; Han et al., 2018) and Procambarus clarkia (Tao et al., 2016). It seems that environmental stress can generate reactive oxygen species (ROS) (Martins et al., 2014), and oxidative stress can cause lipid peroxidation (Lushchak, 2011; Winston, 1991). In addition, the pH effect depended on dietary protein levels, and high pH stress no longer significantly increased the malondialdehyde content in crabs fed the 35% protein and 40% protein diets. The higher dietary protein level significantly decreased the malondialdehyde of crabs. It indicates that both water pH and dietary protein level can affect lipid peroxidation in crab. To reduce the stress effect, organisms have developed some defense mechanisms (Davies, 2000). For instance, glutathione can function alone or with other enzymes to cope with oxidative stress (Dar and Barzilai, 2009). Our result showed that glutathione in the hepatopancreas at high pH was significantly lower in the crab fed 30% protein. It is likely that the high pH stress reduced the antioxidant capacity though reducing the content of glutathione. Dietary protein has a positive role to enhance anti-stress capacity (Liu et al., 2012). For instance, the higher protein level in diet can increase glutathione in Pelteobagrus fulvidraco larvae (Zhang et al., 2018).
causes a series of metabolic abnormalities and oxidative stress (Saha et al., 2002; Wilson et al., 1998), and crabs may use extra energy to repair damaged cells and less energy allocation to growth (Houck and Cech Jr 2004). In the present study, there was a significant interaction between dietary protein and pH on growth. Dietary protein level can affect the negative effects of high pH stress on growth. Specifically, the higher protein level in diets alleviated growth reduction caused by high pH stress. A previous study reported that dietary protein level could affect feed efficiency in juvenile hybrid sturgeon (Acipenser baerii ♀ × A. gueldenstaedtii ♂) (Guo et al., 2012). In the present study, the feed efficiency increased with the increase of dietary protein level at high pH. A possible reason is that some dietary protein may be allocated to response to high pH stress, so that the low protein diet may no longer meet the nutritional needs for crabs and result in growth reduction. However, the high protein diet may still can provide sufficient protein for growth. As a result the weight gain of crab fed the high protein diet is higher than those fed the low protein diet. Meanwhile, there were no significant differences in feed intake. Therefore, according to the feed efficiency calculation formula, the feed efficiency of crab fed the high protein diet was higher than those fed the low protein diet. Besides, the high pH stress decreased feed efficiency in Chinese mitten crab but the higher protein level in diets counteracted the negative effect from high pH stress. As a result, high pH stress can cause slow growth and poor feed efficiency in Chinese mitten crab, but the high protein diet counteracted the negative effects while the low protein level increased the negative effects. The survival of crab was not affected by water pH, which is in contrast to the previous studies (Chen and Chen, 2003; Liu et al., 2016). The possible explanation is that the pH level in this study 5
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 3. The antioxidative capacity of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5). SOD: Superoxide dismutase; GSH: Reduced glutathione; GST: Glutathione S-transferase. Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
regulation and they were upregulated when crabs were fed the 30% protein diets at high pH. It indicates that the oxidative stress caused by high pH and low protein stress can also lead to an inflammatory response in Chinese mitten crab through the p38-MAPK - ADAM 17 LITAF pathway. Oxidative stress and inflammatory response are often accompanied by apoptosis (Ma et al., 2014). Because p38-MAPK can also lead to the P53 activation in the apoptotic response (Jean Luc et al., 2005). The p38-MAPK can stimulate the pro-apoptotic protein (e.g., Bax, Bak) and inhibit the anti-apoptotic protein (e.g., Bcl-2, BclXL) to regulate the release of cytochrome c, caspases and apoptosis (Bragado et al., 2007; Owens et al., 2009). In the present study, factors involved in the apoptosis regulation including Bax and caspase 3 were upregulated where oxidative stress occurred, suggesting that the oxidative stress can induce an apoptotic response through the p38-MAPK Bax - caspase 3 pathway.
In the present study, the high dietary protein also increased glutathione in the crab, indicating that a moderately higher protein in the diet can enhance the first line of defense to cope with oxidative stress, especially at high pH. Superoxide dismutase and glutathione S-transferase are important enzymes in the second line of defense (Dar and Barzilai, 2009). In the present study, the 30% protein diet caused a marked reduction of superoxide dismutase and glutathione S-transferase. This result suggests that adequate dietary protein level can improve the antioxidant capacity of Chinese mitten crab by increasing the activities of superoxide dismutase and glutathione S-transferase. In summary, the high pH stress disturbed the antioxidant system and enhanced the lipid peroxidation of crab, especially in the low protein group. The antioxidant capacity interacted with dietary protein level, and higher protein can enhance the antioxidant capacity and reduce lipid peroxidation in the Chinese mitten crab. Besides, the oxidative stress can induce inflammatory response (Feng et al., 2015). The p38-MAPK (mitogen-activated protein kinase) signaling pathway is an important factor responding to environmental stress and regulating inflammatory response in organisms (Sanjay et al., 2003). Specifically, p38-MAPK can activate the ADAM 17 gene (Xu and Derynck, 2010) to modulate inflammation by elevating the levels of cytokines such as TNFα, IL-1 beta and IL-6 (Scheller et al., 2011; Schieven, 2005). In the present study, genes such as p38-MAPK, LITAF (lipopolysaccharide-induced tumor necrosis factor-alpha factor) (Merrill et al., 2011) and ADAM 17 were involved in inflammation
5. Conclusion The high pH stress caused growth retardation and poor feed efficiency in the Chinese mitten crab, and the negative effects of pH were counteracted by dietary protein. The higher level of dietary protein suppressed the negative effect of pH on growth while the lower level of protein did not. The slow growth was concomitant with poor antioxidant capacity, inflammatory response and apoptotic response. The lower dietary protein (30%) triggered oxidative stress and pro6
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 4. The inflammation and apoptosis of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5). p38-MAPK: p38 mitogen-activated protein kinase; LITAF: Lipopolysaccharide-induced TNF-alpha factor; ADAM 17: A Disintegrin and metalloproteinase domain-containing protein 17; Bcl 2: B-cell lymphoma 2; Bax: Bcl-2-associated X; Caspase 3: Cysteine-aspartic acid protease 3. Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
inflammatory and pro-apoptotic factors at high pH by decreasing antioxidative enzyme activities and upregulating the expressions of proapoptotic and pro-inflammatory genes such as lipopolysaccharide-induced TNF-alpha factor, p38 mitogen-activated protein kinase, a disintegrin and metalloproteinase domain-containing protein 17, Bcl-2associated X and Cysteine-aspartic acid protease 3. A higher protein (35%–40%) is needed in the Chinese mitten crab diet when pH is over 9.5.
Boyd, C.E., 1990. Water Quality in Ponds for Aquaculture. Birmingham Publishing Co., Birmingham, Alabama, USA. Bragado, P., et al., 2007. Apoptosis by cisplatin requires p53 mediated p38α MAPK activation through ROS generation. Apoptosis 12, 1733–1742. Chen, J.C., Kou, C.T., 1996. Nitrogenous excretion in Macrobrachium rosenbergii at different pH levels. Aquaculture 144, 155–164. Chen, S.M., Chen, J.C., 2003. Effects of pH on survival, growth, molting and feeding of giant freshwater prawn Macrobrachium rosenbergii. Aquaculture 218, 613–623. Dar, I., Barzilai, A., 2009. Cellular Responses to Oxidative Stress. Springer Netherlands. Davies, K.J., 2000. Oxidative stress, antioxidant defenses, and damage removal, repair, and replacement systems. IUBMB Life 50, 279–289. Duan, Y., et al., 2019. Changes in the intestine barrier function of Litopenaeus vannamei in response to pH stress. Fish Shellfish Immunol. 88, 142–149. Feng, L., et al., 2015. Changes in barrier health status of the gill for grass carp (Ctenopharyngodon idella) during valine deficiency: regulation of tight junction protein transcript, antioxidant status and apoptosis-related gene expression. Fish Shellfish Immunol. 45, 239–249. Furtado, P.S., et al., 2015. Acute effects of extreme pH and its influences on the survival and biochemical biomarkers of juvenile White Shrimp, Litopenaeus vannamei. Mar. Freshw. Behav. Physiol. 48, 417–429. Gong, Z., et al., 2015. Effects of high pH on antioxidant capacity and astaxanthin content in Eriocheir sinensis. Freshw. Fish. 45, 20–24. Guo, Z., et al., 2012. Effects of dietary protein level on growth performance, nitrogen and energy budget of juvenile hybrid sturgeon, Acipenser baerii ♀ × A. gueldenstaedtii ♂. Aquaculture 338–341, 89–95. Habte-Tsion, H.M., et al., 2017. Adequate dietary protein level enhances stress resistance and immune status of blunt snout bream (Megalobrama amblycephala Yih, 1955). J. Appl. Ichthyol. 33, 75–83. Halver, J.E., Hardy, R.W., 2002. Fish Nutrition. Academic press, California, USA. Han, C., et al., 2016. Gene expression and activities of antioxidant enzymes in liver of hybrid Tilapia, Oreochromis niloticus × Oreochromis aureus, under acute pH stress. J. World Aquac. Soc. 47, 260–267. Han, F., et al., 2019. Effects of glycinin and β-conglycinin on growth performance and intestinal health in juvenile Chinese mitten crabs (Eriocheir sinensis). Fish Shellfish
Declaration of competing interest We declare that we have no competing interests. Acknowledgment This research was supported by grants from National Key R & D Program of China (2018YFD0900400), China Agricultural Research System (CARS-48), the National Natural Science Foundation of China (No. 31572629) and Agriculture Research System of Shanghai, China (Grant No. 201804). References Allan, G.L., Maguire, G.B., 1992. Effects of pH and salinity on survival, growth and osmoregulation in Penaeus monodon Fabricius. Aquaculture 107, 33–47. AOAC, 2005. Official Methods of Analysis of AOAC International, eighteenth ed. Association of Official Analytical Chemists, Washington DC, USA.
7
Aquaculture 516 (2020) 734523
C. Qi, et al.
Scheller, J., et al., 2011. ADAM17: a molecular switch to control inflammation and tissue regeneration. Trends Immunol. 32, 380–387. Schieven, G.L., 2005. The biology of p38 kinase: a central role in inflammation. Curr. Top. Med. Chem. 5, 921–928. Shaw, T.L., 1981. Acute toxicity of increased pH to the freshwater shrimp Paratya curvirostris. N. Z. J. Mar. Freshw. Res. 15, 91–93. Tao, Y., et al., 2016. Acute toxicity of high pH stress and its effect on enzymes activity and histological structure of gill and hepatopancreas in Procambarus clarkii. J. Fish. China/Shuichan Xuebao. 40, 1694–1704. Wang, S., et al., 2016. Comparison of flavour qualities of three sourced Eriocheir sinensis. Food Chem. 200, 24–31. Wang, W.N., et al., 2009. Oxidative stress, DNA damage and antioxidant enzyme gene expression in the Pacific white shrimp, Litopenaeus vannamei when exposed to acute pH stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 150, 428–435. Wang, W.N., et al., 2012. The respiratory burst activity and expression of catalase in white shrimp, Litopenaeus vannamei, during long-term exposure to pH stress. Ecotoxicology 21, 1609–1616. Wang, Y., et al., 2011. The responsive expression of a caspase gene in Chinese shrimp Fenneropenaeus chinensis against pH stress. Aquacult. Res. 42, 1214–1230. Wang, Z., et al., 2018. Supplementation of dietary astaxanthin alleviated oxidative damage induced by chronic high pH stress, and enhanced carapace astaxanthin concentration of Chinese mitten crab Eriocheir sinensis. Aquaculture 483, 230–237. Weihrauch, D., O'Donnell, M., 2017. Acid-Base Balance and Nitrogen Excretion in Invertebrates. Springer International Publishing, Switzerland. Wilson, J.M., et al., 1998. Inhibition of ammonia excretion and production in rainbow trout during severe alkaline exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 121, 99–109. Winston, G.W., 1991. Oxidants and antioxidants in aquatic animals. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 100, 173–176. Xie, Y., et al., 2006. Effects of vitamin C on non-specific immunity of largemouth bass under high pH stress. Feed Ind 25–27. Xu, P., Derynck, R., 2010. Direct activation of TACE-mediated ectodomain shedding by p38 MAP Kinase regulates EGF receptor-dependent cell proliferation. Mol. Cell 37, 551–566. Yu, Y.Q., et al., 2011. Effects of pH stress on five non-specific immune parameters of Chinese mitten crab (Eriocheir sinensis). Freshw. Fish. 41, 70–74. Zhang, J., et al., 2018. Effects of dietary lipid and protein levels on growth and physiological metabolism of Pelteobagrus fulvidraco larvae under recirculating aquaculture system (RAS). Aquaculture 495, 458–464. Zhou, J., et al., 2009. Glutathione S-transferase in the white shrimp Litopenaeus vannamei : characterization and regulation under pH stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 150, 224–230. Zuo, R., et al., 2017. Higher dietary protein increases growth performance, anti-oxidative enzymes activity and transcription of heat shock protein 70 in the juvenile sea urchin (Strongylocentrotus intermedius) under a heat stress. Aquacult. Fish. 2, 18–23.
Immunol. 84, 269–279. Han, S.Y., et al., 2018. A comparative study on oxidative stress response in the hepatopancreas and midgut of the white shrimp Litopenaeus vannamei under gradual changes to low or high pH environment. Fish Shellfish Immunol. 76, 27–34. Hooley, C.G., et al., 2014. Examination of the effects of dietary protein and lipid levels on growth and stress tolerance of juvenile tilapia, Oreochromis niloticus. J. World Aquac. Soc. 45, 115–126. Hossain, Z., et al., 2012. Comparative proteome analysis of high and low cadmium accumulating soybeans under cadmium stress. Amino Acids 43, 2393–2416. Houck, A., Cech Jr., J.J., 2004. Effects of dietary methylmercury on juvenile Sacramento blackfish bioenergetics. Aquat. Toxicol. 69, 107–123. Jean Luc, P., et al., 2005. Essential role of p53 phosphorylation by p38 MAPK in apoptosis induction by the HIV-1 envelope. J. Exp. Med. 201, 279–289. Li, E., et al., 2011. Glutamate dehydrogenase and Nã+-K∼+ ATPase expression and growth response of Litopenaeus vannamei to different salinities and dietary protein levels. Chin. J. Oceanol. Limnol. 29, 343–349. Liu, B., et al., 2012. Effects of anthraquinone extract from Rheum officinale Bail on the physiological responses and HSP70 gene expression of Megalobrama amblycephala under Aeromonas hydrophila infection. Fish Shellfish Immunol. 32, 1–7. Liu, J.S., et al., 2016. The effect of pH on the molting, growth and related gene expression in juvenile mitten crab, Eriocheir sinensis. Freshw. Fish. 46, 96–100. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Lushchak, V.I., 2011. Environmentally induced oxidative stress in aquatic animals. Aquat. Toxicol. 101, 13–30. Ma, J.Q., et al., 2014. Hepatoprotective properties of sesamin against CCl4 induced oxidative stress-mediated apoptosis in mice via JNK pathway. Food Chem. Toxicol. 64, 41–48. Martins, Á.C.d.S., et al., 2014. Modulation of antioxidant and detoxification responses induced by lipoic acid in the Pacific white shrimp Litopenaeus vannamei (Boone, 1931) subjected to hypoxia and re-oxygenation. Mar. Freshw. Behav. Physiol. 47, 335–348. Merrill, J.C., et al., 2011. Whole-body deletion of LPS-induced TNF-α factor (LITAF) markedly improves experimental endotoxic shock and inflammatory arthritis. Proc. Natl. Acad. Sci. U.S.A. 108, 21247–21252. Ministry of Agriculture and Rural Affairs, B.o.f.a.f.m., China Society of Fisheries, N.F.T.E.C., 2018. China Fishery Statistical Yearbook. China Agriculture Press, Beijing, China. NRC, 2011. Nutrient Requirements of Fish and Shrimp. National academies press, Washington. Owens, T.W., et al., 2009. Apoptosis commitment and activation of mitochondrial Bax during anoikis is regulated by p38MAPK. Cell Death Differ. 16, 1551–1562. Saha, N., et al., 2002. Effect of alkalinity (pH 10) on ureogenesis in the air-breathing walking catfish, Clarias batrachus. Comp. Biochem. Physiol. Mol. Integr. Physiol. 132, 353–364. Sanjay, K., et al., 2003. p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat. Rev. Drug Discov. 2, 717–726.
8
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
High protein diet alleviates the high pH stress in Chinese mitten crab Eriocheir sinensis
T
Changle Qia, Fenglu Hana, Xiaodan Wanga, Chang Xub, Zhipeng Huanga, Erchao Lib, Jian G. Qinc, Liqiao Chena,∗ a
Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, Shanghai, 200062, PR China Department of Aquaculture, College of Marine Sciences, Hainan University, Haikou, Hainan, 570228, PR China c College of Science and Engineering, Flinders University, Adelaide, SA, 5001, Australia b
A R T I C LE I N FO
A B S T R A C T
Keywords: Protein level High pH Inflammatory response Apoptotic factor Chinese mitten crab
This study evaluates whether a higher level of dietary protein could alleviate pH stress in Chinese mitten crab. Three diets with protein levels at 30%, 35% and 40% were used to feed crab for 8 weeks to determine the differential effect of dietary protein on growth, antioxidant capacity, inflammatory response and apoptotic factors at normal pH (7.8) and high pH (9.5) values. The pH elevation depressed growth performance in terms of weight gain (WG), specific growth rate (SGR) and feed conversion rate (FCR), but this effect significantly depended on the level of dietary protein. The higher level of protein significantly improved WG, SGR and FCR at high pH. Besides, high pH weakened the antioxidant capacity of crab fed the 30% protein diet by decreasing glutathione (GSH) in the hepatopancreas, and resulting significantly higher malondialdehyde crab fed 30% protein than those fed other two protein levels. The dependent effect of dietary protein and pH was also found in antioxidant capacity. The higher protein diet increased GSH, superoxide dismutase and glutathione S-transferase in the hepatopancreas at high pH. In addition, high pH triggered pro-inflammatory and pro-apoptotic factors in the 30% protein group by upregulating the pro-apoptotic and pro-inflammatory genes including lipopolysaccharide-induced TNF-alpha factor, p38 mitogen-activated protein kinase, a disintegrin and metalloproteinase domain-containing protein 17, Bcl-2-associated X and Cysteine-aspartic acid protease 3. The higher protein diets downregulated pro-apoptotic and pro-inflammatory genes at high pH. In conclusion, the high pH caused a marked growth retardation and poor feed efficiency, triggered oxidative stress and pro-inflammatory and increased pro-apoptotic factors in crab fed the low protein diet. Higher protein diets alleviated the negative effect of pH in the Chinese mitten crab. This study suggests that a higher protein diet can counteract the negative effect of high pH in Chinese mitten crab farming.
1. Introduction The Chinese mitten crab (Eriocheir sinensis) is an important crustacean species in freshwater aquaculture, and have been well received by consumers because of its high nutritional value and unique flavor (Wang et al., 2016). The production was over 750,000 tons in 2017 in China (Ministry of Agriculture and Rural Affairs and China Society of Fisheries, 2018). In tensive farming, aquatic plants such as Elodea Canadensis, Vallisneria natans and Hydrilla verticillata are planted in ponds to provide shelters for crab, and almost 60% of the pond area is covered hydrophytes (Gong et al., 2015). However, the photosynthesis of aquatic plants can enhance pH in the water, which in turn stress crab
during daytime (Boyd, 1990). Sometimes, the pH value in crab ponds can exceed 10.5 (Wang et al., 2018) and become an environmental stress factor in crab farming. The excessive high pH level in a pond can adversely affect aquatic animals. High pH stress can depress growth and molting (Liu et al., 2016), decrease antioxidant capacity (Han et al., 2016; Zhou et al., 2009), cause oxidative stress (Wang et al., 2009; Wang et al., 2012) and apoptotic response (Wang et al., 2011; Wang et al., 2018), reduce immunity (Yu et al., 2011), impair intestine barrier function (Duan et al., 2019) and even lead to mortality (Allan and Maguire, 1992; Furtado et al., 2015). Meanwhile, high pH also can inhibit ammonia excretion from aquatic animals (Chen and Kou, 1996; Weihrauch and O'Donnell,
∗ Corresponding author. Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, Shanghai, 200241, PR China. E-mail address: [email protected] (L. Chen).
https://doi.org/10.1016/j.aquaculture.2019.734523 Received 28 July 2019; Received in revised form 11 September 2019; Accepted 16 September 2019 Available online 23 October 2019 0044-8486/ © 2019 Published by Elsevier B.V.
Aquaculture 516 (2020) 734523
C. Qi, et al.
2017) and subsequently cause hyperammonemia to cause physiological abnormality (Shaw, 1981). Thus, improvement of stress resistance is an ideal way to reduce the risk of mortality when aquatic animals encounter high pH stress in the environment. Nutrient manipulation in the diet is reportedly able to improve the ability of aquatic animals to resist high pH stress. In fish, dietary vitamin C can increase the non-specific immunity of largemouth bass Micropterus salmoides (Xie et al., 2006). In crustaceans, the diet supplemented with astaxanthin can alleviate the oxidative damage and apoptosis induced by a chronic high pH stress in Chinese mitten crab (Wang et al., 2018). However, most previous studies have focused on the effects of food additives on alleviation of high pH stress. There has been little research on the alleviation of high pH stress by manipulating dietary energy substances. When an animal is exposed to an environmental stressor, more energy will be needed to cope with the stress (Hossain et al., 2012). Protein is the most important energy substance of aquatic animals, especially in crustaceans (Halver and Hardy, 2002; NRC, 2011). A higher level of protein in diets is beneficial to increase the ability of salinity resistance in the Pacific white shrimp (Litopenaeus vannamei) (Li et al., 2011). In fish, the blunt snout bream (Megalobrama amblycephala) has a better ability to resist heat stress when food contains adequate protein (Habte-Tsion et al., 2017). Nevertheless, we do not have adequate knowledge on whether a higher level of dietary protein in diets can alleviate the stress of high pH in crustacean. In this study, we aim to investigate the possibility of using high dietary protein to alleviate the stress of pH in the Chinese mitten crab. The animal responses were evaluated by measuring growth performance, whole-body proximate composition, antioxidative capacity, inflammatory and apoptotic factors.
Table 1 Formulation and chemical proximate composition of experimental diets (dry matter basis, %). Ingredients
30% protein
35% protein
40% protein
Caseina Gelatinb Corn starchc Cholesterold Soybean lecithind Fish oil Soybean oile Sodium carboxymethylcellulose Cellulose Vitamin premixf Mineral premixg Butylated hydroxytoluene Betained Proximate analysis Moisture Crude protein Crude lipid
28.00 4.67 25.00 0.30 2.00 3.00 3.00 2.00 22.93 3.00 3.00 0.10 3.00
33.00 5.50 25.00 0.30 2.00 3.00 3.00 2.00 17.10 3.00 3.00 0.10 3.00
38.00 6.33 25.00 0.30 2.00 3.00 3.00 2.00 11.27 3.00 3.00 0.10 3.00
9.97 30.31 8.45
9.95 35.25 8.39
9.93 40.17 8.44
a
Casein: Gansu hualing dairy Co., Ltd, Gansu, China. Gelatin: Baotou Dongbao Bio-Tech Co., Ltd, Baotou, China. c Corn starch: Beijing gusong food Co., Ltd, Beijing, China. d Sangon Biotech (Shanghai) Co., Ltd, Shanghai, China. e Soybean oil: Cofco food marketing Co. Ltd, Beijing, China. f Vitamin premix (per 100 g premix): retinol acetate, 0.043 g; thiamin hydrochloride, 0.15 g; riboflavin, 0.0625 g; Ca pantothenate, 0.3 g; niacin, 0.3 g; pyridoxine hydrochloride, 0.225 g; para-aminobenzoic acid, 0.1 g; ascorbic acid, 0.5 g; biotin, 0.005 g; folic acid, 0.025 g; cholecalciferol, 0.0075 g; α-tocopherol acetate, 0.5 g; menadione, 0.05 g; inositol, 1 g. All ingredients are filled with α-cellulose to 100 g (Han et al., 2019). g Mineral premix (per 100 g premix): KH2PO4, 21.5 g; NaH2PO4, 10.0 g; Ca (H2PO4)2, 26.5 g; CaCO3, 10.5 g; KCl, 2.8 g; MgSO4·7H2O, 10.0 g; AlCl3·6H2O, 0.024 g; ZnSO4·7H2O, 0.476 g; MnSO4·6H2O, 0.143 g; KI, 0.023 g; CuCl2·2H2O, 0.015 g; CoCl2·6H2O, 0.14 g Calcium lactate, 16.50 g; Fe-citrate, 1 g. All ingredients are diluted with α-cellulose to 100 g (Han et al., 2019). b
2. Material and methods 2.1. Experimental diets The formulation and chemical proximate composition of experimental diets are shown in Table 1. Three purified isoenergetic and isolipidic diets were formulated to contain 30%, 35% and 40% protein. The process was as follows: All ingredients were ground into power and sieved through a 60 mesh strainer, weighed according to the experimental formulation, and then mixed all ingredients thoroughly with an electric mixer. Subsequently oil and distilled water were added to make a dough and then pelleted with a screw-press pelletizer using a 2.0 mm die. Pellets were air dried at room temperature for approximately 48 h to a moisture content < 10%. After drying, all diets were packed in bags and stored at −20 °C until to use.
weight were hand-fed to crabs three times at 7:00, 16:00 and 24:00, with 20%, 20% and 60% of the full daily ration, respectively. Feces were removed in the morning (09:00), and the water of 30% tank volume was exchanged daily. Dead crabs were immediately removed from the tank, weighed and recorded. Feed intake of each tank was recorded throughout the trial period to calculate feed conversion ratio. During the experimental period, the water temperature was measured using an digital thermometer (Odatime KT 300, Baode instrument Co. Ltd., Chaozhou, China) and varied from 25 °C to 27 °C. Dissolved oxygen (DO) was measured using a commercial assay kit (LH2105, Hangzhou Lohand biological Co. Ltd., Hangzhou, China). DO was above 7 mg L−1 during the whole experimental period. Ammonia was measured using a commercial assay kit (LH2007, Hangzhou Lohand biological Co. Ltd., Hangzhou, China), and the ammonia content in the water was below 0.05 mg L−1. At the end, all the crabs from each tank were anesthetized with crushed pieces of ice, and then counted and group-weighed by tank after fasting for 24 h. Five crabs from each tank were euthanized and stored at −20 °C for whole-body proximate analysis. Another 10 crabs per tank were euthanized and then the hemolymph was taken from the leg joints of each crab with a 1.0 mL syringe. The hemolymph was placed in a 4 °C refrigerator for 5 h, and then the coagulated hemolymph was stirred up with a syringe needle and centrifuged with a highspeed refrigerated centrifuge for 10 min (8000 r/min). Serum was carefully collected with a pipette and kept at −80 °C for analysis. Concurrently, hepatopancreas samples were put into liquid nitrogen immediately and then stored at −80 °C for the analyses of enzyme and gene expression. Weight gain, specific growth rate, feed intake, feed conversion ratio and survival were calculated according to the following formulas:
2.2. Growth trial, sampling and growth evaluation Crabs used in this experiment were obtained from a local farm in Chongming, Shanghai. Prior to the trial, all crabs were stocked in 300 L tanks (100 × 80 × 60 cm), and fed with a commercial diet to acclimatize for one week in a factory farming workshop in Huzhou, Zhejiang. The water used in this experiment was filtered with a quartz sand filter (Xinyi Water Treatment Equipment Factory, Huzhou, China) and aerated fully before use. The control pH in the water ranged from 7.7 to 7.9. The high pH water was set at 9.5 by gradually adding a 1 M NaOH solution, and the pH level was checked and adjusted every 8 h using a portable pH meter (SIN-PH-100, Hangzhou). Crabs were fasted for 24 h before the start of the feeding trial and then 840 crabs (1.19 ± 0.11 g, mean ± S.D.) with intact appendages were randomly distributed into 24 tanks and each tank containing 35 crabs. Each experimental diet was randomly allotted to eight tanks, where crabs in four tanks were cultivated at normal pH (pH = 7.8), and the other four tanks were cultivated at high pH (pH = 9.5). Four bundles of corrugated plastic pipes and arched tiles were placed in each tank as shelters to reduce attacking behavior. Diets with a daily ration of 4% body 2
Aquaculture 516 (2020) 734523
C. Qi, et al.
CFX96 Real-Time PCR system (Bio-rad, Richmond, CA). PCR conditions were as follows: 94 °C for 3 min, and following 40 cycles at 94 °C for 15 s and 60 °C for 50 s, and 72 °C for 20 s. Samples were run in triplicate and normalized to the control gene β-actin. Gene expression levels were calculated by the 2–ΔΔCT comparative CT method (Livak and Schmittgen, 2001).
Weight gain (WG, %) = (final weight - initial weight) × 100/initial weight; Specific growth rate (SGR, %) = 100 * (LN final weight - LN initial weight)/days; Feed intake (FI, g) = Total feed weight/final number; Feed conversion ratio (FCR) = feed intake/(final weight - initial weight); Survival (%) = 100 × final number/initial number.
2.5. Statistical analysis Statistical analysis was performed using the SPSS 23.0 for Windows (SPSS, Michigan Avenue, Chicago, IL, USA). Data were analyzed by two-way analysis of variance (ANOVA) to determine if there was any interaction between dietary protein level and water pH level. At the same pH condition, one-way analysis of variance (ANOVA) was used to analyze the significant differences among crabs fed the diets with different protein level after normality test and homogeneity of variance. When the means of each treatment were significantly different, Duncan's multiple range test was used to compare means among these treatments. At the same protein level, independent-samples T test was used to determine significant differences between crabs cultivated at normal pH and those cultivated at high pH. Significance was set at P < 0.05. The data were represented as the mean ± standard error of mean (S.E.).
2.3. Chemical composition analysis of experimental diets and crabs Chemical compositions of the experimental diets and crabs wholebody were determined by the standard procedures using proximate composition analysis (AOAC, 2005). Four duplicate samples were measured in each treatment (n = 4). Moisture was determined after own dry at 105 °C. Crude protein was quantified using a KjeltecTM 8200 (Foss, Hoganas, Sweden). Crude lipid was extracted using a 1000 mL Soxhlet extraction tube (Fujian minbo toughened glass Co. Ltd., Fujian, China). Ash was analyzed using a muffle furnace (PCD-E3000 Serials, Peaks, Japan) at 550 °C for 6 h. 2.4. Enzyme activity assay The enzyme activities in the hepatopancreas were measured using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) in accordance with the instructions of the manufacturer. The source and information of each kit used in this study were as follows: superoxide dismutase (SOD; Cat. No. A001-1), malondialdehyde (MDA; Cat. No. A003-1), reduced glutathione (GSH; Cat. No. A006-2-1), glutathione S-transferase (GST; Cat. No. A004-1-1) and total protein (TP; Cat. No. A045-2).
3. Results 3.1. Growth performance Weight gain (WG), specific growth rate (SGR), feed intake (FI), feed conversion rate (FCR) and survival of the Chinese mitten crab fed the experimental diets for 8 weeks are shown in Fig. 1. At normal pH (pH = 7.8), WG, SGR and FCR were not significantly affected by dietary protein level, but at high pH (pH = 9.5), WG and SGR significantly increased with the increase of dietary protein (P < 0.05). A significantly lower FCR was obtained in crabs fed the 35% protein and 40% protein diets compared with those fed the 30% protein diet (P < 0.05). There were no significant main effects of water pH on the WG and SGR; however, in the 30% protein diets, crabs at high pH had significantly lower WG and SGR compared with those at normal pH (P < 0.05). There was a significant main effect of water pH on FCR (P < 0.05), and in the 30% protein diets, crabs at high pH had a significant higher FCR compared with those at normal pH (P < 0.05). The significant interactive effect was obtained between dietary protein level and water pH in terms of WG, SGR and FCR (P < 0.05). The feed intake and survival of crabs were not significantly affected by the dietary protein level and water pH. There was no significant interactive effect between dietary protein level and water pH on the feed intake and crab survival.
2.4.1. Analysis of gene expression Total RNA was extracted from the hepatopancreas using the RNAiso Plus (CAT # 9109, Takara, Japan) according to the manufacturer's protocol. The total RNA concentration and quality were estimated using the Nano Drop 2000 spectrophotometer (Thermo, USA). If the ratio of A260/A280 was between 1.8 to 2.0, the sample was used for reverse transcribed using a PrimeScript™ RT master mix reagent kit (Perfect Real Time, Takara, Japan). The specific primers for the genes of E. sinensis were designed based on the transcriptome sequencing results and NCBI data base using NCBI Primer BLAST (Table 2). The RT-PCR amplification reactions were performed in a volume of 10 μL containing 5 μL 2 × SYBR Premix Ex TaqTM, 0.25 μL of 10 mM forward primer, 0.25 μL of 10 mM reverse primer and 4.5 μL of diluted cDNA, using the Table 2 Primer sequences used for real-time PCR. Primers name
Sequences (5′-3′)
Product size
References
LITAF F LITAF R p38-MAPK F p38-MAPK R ADAM 17 F ADAM 17 R Bcl-2 F Bcl-2 R Bax F Bax R Caspase 3 F Caspase 3 R β-actin F β-actin R
ATCAGCTCCCCCACCCTATG GTTGTTGGAGCAGCACCTTG CACTCATGGGTGCTGACCTC TACTTGAGGCCTCGCAACAC GATGTCCGCAACCTGCTAGA CAGGATGCCCCCTTCAAACT CATCATCTCCCTCTTCGCGG CAGTCCCATCACGTCGATCA AGAGATGAAGCAGACCACGC TTCTACGGTGGGTGAGTCCA AGGAAAAGTTCACGCCGCTA GGCTGCCTTCTGTCAGGATT TGGGTATGGAATCCGTTGGC AGACAGAACGTTGTTGGCGA
102 bp
KF892539.1
100 bp
KF582665.1
102 bp
KC007532.1
100 bp
c141679_g4
106 bp
c143681_g1
103 bp
MH183147.1
101 bp
KM244725.1
3.2. Whole-body composition There were no significant main effects of dietary protein level and pH on the whole-body protein, lipid, ash and moisture content (Fig. 2). No significant interactive effect was obtained between protein level and water pH in terms of whole-body protein, lipid, ash and moisture content of whole-body crab. 3.3. Antioxidative capacity The significant main effects of dietary protein level on malondialdehyde (MDA), superoxide dismutase (SOD), reduced glutathione (GSH) and glutathione S-transferase (GST) in the hepatopancreas of crabs were obtained (P < 0.05; Fig. 3). Crabs fed the 30% protein diet had significantly higher MDA content in both high pH and normal pH condition compared with those fed the 35% protein and 40% protein diets (P < 0.05). At high pH, crabs fed the 35% protein diet showed
Notes: LITAF: lipopolysaccharide-induced TNF-alpha factor; p38-MAPK: p38 mitogen-activated protein kinase; ADAM 17: A Disintegrin and metalloproteinase domain-containing protein 10; Bcl 2: B-cell lymphoma 2; Bax: Bcl-2-associated X; Caspase 3: Cysteine-aspartic acid protease 3. 3
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 1. The growth performance of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5). SGR: specific growth rate. Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
significant main effects of pH on ADAM 17 and Bax were found (P < 0.05). In the 30% protein and 40% protein diets, crabs cultivated at high pH had higher ADAM 17 gene expression than those at normal pH, but the differences were not significant. In the 30% protein diet, crabs cultivated at high pH had significantly higher Bax gene expression than those at normal pH (P < 0.05). In the 30% protein diet, crabs at high pH had significantly higher caspase 3 gene expression than those at normal pH (P < 0.05). There were no significant interactive effects between dietary protein level and pH on ADAM 17, Bcl-2, Bax and caspase 3.
significantly higher SOD than those fed the 30% protein diet (P < 0.05). At normal pH, crabs fed the 35% protein diet had significantly higher GSH and GST than those fed the 30% protein diet (P < 0.05). At high pH, significantly lower GSH was found in crabs fed the 30% protein diet than those fed the 35% protein and 40% protein diets (P < 0.05). Water pH had the significant main effect on MDA (P < 0.05). In the 30% protein diets, crabs at high pH had significantly MDA than those at normal pH (P < 0.05). In the 30% protein diets, crabs at high pH had significantly lower SGH than those at normal pH (P < 0.05). Significant interactive effects between dietary protein level and water pH were found in MDA and GSH (P < 0.05).
4. Discussion 3.4. Inflammatory response and apoptotic factors In the present study, dietary protein level significantly affected the growth of crabs at high pH in the water. Protein deficiency in the diets resulted growth retardation. The result was in accordance with the previous studies on tilapia (Oreochromis niloticus) (Hooley et al., 2014) and sea urchin (Strongylocentrotus intermedius) (Zuo et al., 2017). However, the growth was not significantly affected by dietary protein level at normal pH. It is speculated that 30% protein can already support the maximal growth of crab at normal pH, so that it showed no significant growth differences among each protein level. But when crabs are exposed to high pH, some protein may be used to response to high pH stress, and the low protein diet (30% protein) may no longer meet the nutritional needs for crabs and result in growth reduction. In addition, high pH stress also decreased the growth of crabs in the 30% protein group. It is similar to the result on juvenile Chinese mitten crab (Liu et al., 2016). The possible reason may be due to high pH stress that
As showed in the Fig. 4, the relative expression of p38-MAPK significantly increased with the increase of dietary protein at normal pH (P < 0.05). However, at high pH, the relative expression of p38-MAPK decreased with the increase of dietary protein, and crabs fed the 30% protein diet had a significantly higher gene expression of p38-MAPK than those fed the 40% protein diet (P < 0.05). In the 30% protein diet, the p38-MAPK gene expression was significantly upregulated in crabs cultivated at high pH than those cultivated at normal pH (P < 0.05). The significant interactive effect was found between dietary protein level and pH on p38-MAPK (P < 0.05). The significant main effect (P < 0.05) of water pH was found on the relative expression of Lipopolysaccharide-induced TNF-alpha factor (LITAF), and in the 35% protein diet, crabs cultivated at high pH had a significantly higher LITAF gene expression than those at normal pH (P < 0.05). The 4
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 2. The whole-body proximate composition of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5) (fresh matter basis). Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
did not reach lethal level. Growth performance is related to the healthy status of aquatic animals. Oxidative damage and antioxidative capacity are important indexes to reflect the healthy status of aquatic animals. The level of malondialdehyde is used as a reference of oxidative damage as it is one of the end products of lipid peroxidation (Lushchak, 2011). In the present study, high pH stress increased malondialdehyde in the hepatopancreas, suggesting that high pH stress may be related to lipid peroxidation. The similar results were also reported in Litopenaeus vannamei (Duan et al., 2019; Han et al., 2018) and Procambarus clarkia (Tao et al., 2016). It seems that environmental stress can generate reactive oxygen species (ROS) (Martins et al., 2014), and oxidative stress can cause lipid peroxidation (Lushchak, 2011; Winston, 1991). In addition, the pH effect depended on dietary protein levels, and high pH stress no longer significantly increased the malondialdehyde content in crabs fed the 35% protein and 40% protein diets. The higher dietary protein level significantly decreased the malondialdehyde of crabs. It indicates that both water pH and dietary protein level can affect lipid peroxidation in crab. To reduce the stress effect, organisms have developed some defense mechanisms (Davies, 2000). For instance, glutathione can function alone or with other enzymes to cope with oxidative stress (Dar and Barzilai, 2009). Our result showed that glutathione in the hepatopancreas at high pH was significantly lower in the crab fed 30% protein. It is likely that the high pH stress reduced the antioxidant capacity though reducing the content of glutathione. Dietary protein has a positive role to enhance anti-stress capacity (Liu et al., 2012). For instance, the higher protein level in diet can increase glutathione in Pelteobagrus fulvidraco larvae (Zhang et al., 2018).
causes a series of metabolic abnormalities and oxidative stress (Saha et al., 2002; Wilson et al., 1998), and crabs may use extra energy to repair damaged cells and less energy allocation to growth (Houck and Cech Jr 2004). In the present study, there was a significant interaction between dietary protein and pH on growth. Dietary protein level can affect the negative effects of high pH stress on growth. Specifically, the higher protein level in diets alleviated growth reduction caused by high pH stress. A previous study reported that dietary protein level could affect feed efficiency in juvenile hybrid sturgeon (Acipenser baerii ♀ × A. gueldenstaedtii ♂) (Guo et al., 2012). In the present study, the feed efficiency increased with the increase of dietary protein level at high pH. A possible reason is that some dietary protein may be allocated to response to high pH stress, so that the low protein diet may no longer meet the nutritional needs for crabs and result in growth reduction. However, the high protein diet may still can provide sufficient protein for growth. As a result the weight gain of crab fed the high protein diet is higher than those fed the low protein diet. Meanwhile, there were no significant differences in feed intake. Therefore, according to the feed efficiency calculation formula, the feed efficiency of crab fed the high protein diet was higher than those fed the low protein diet. Besides, the high pH stress decreased feed efficiency in Chinese mitten crab but the higher protein level in diets counteracted the negative effect from high pH stress. As a result, high pH stress can cause slow growth and poor feed efficiency in Chinese mitten crab, but the high protein diet counteracted the negative effects while the low protein level increased the negative effects. The survival of crab was not affected by water pH, which is in contrast to the previous studies (Chen and Chen, 2003; Liu et al., 2016). The possible explanation is that the pH level in this study 5
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 3. The antioxidative capacity of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5). SOD: Superoxide dismutase; GSH: Reduced glutathione; GST: Glutathione S-transferase. Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
regulation and they were upregulated when crabs were fed the 30% protein diets at high pH. It indicates that the oxidative stress caused by high pH and low protein stress can also lead to an inflammatory response in Chinese mitten crab through the p38-MAPK - ADAM 17 LITAF pathway. Oxidative stress and inflammatory response are often accompanied by apoptosis (Ma et al., 2014). Because p38-MAPK can also lead to the P53 activation in the apoptotic response (Jean Luc et al., 2005). The p38-MAPK can stimulate the pro-apoptotic protein (e.g., Bax, Bak) and inhibit the anti-apoptotic protein (e.g., Bcl-2, BclXL) to regulate the release of cytochrome c, caspases and apoptosis (Bragado et al., 2007; Owens et al., 2009). In the present study, factors involved in the apoptosis regulation including Bax and caspase 3 were upregulated where oxidative stress occurred, suggesting that the oxidative stress can induce an apoptotic response through the p38-MAPK Bax - caspase 3 pathway.
In the present study, the high dietary protein also increased glutathione in the crab, indicating that a moderately higher protein in the diet can enhance the first line of defense to cope with oxidative stress, especially at high pH. Superoxide dismutase and glutathione S-transferase are important enzymes in the second line of defense (Dar and Barzilai, 2009). In the present study, the 30% protein diet caused a marked reduction of superoxide dismutase and glutathione S-transferase. This result suggests that adequate dietary protein level can improve the antioxidant capacity of Chinese mitten crab by increasing the activities of superoxide dismutase and glutathione S-transferase. In summary, the high pH stress disturbed the antioxidant system and enhanced the lipid peroxidation of crab, especially in the low protein group. The antioxidant capacity interacted with dietary protein level, and higher protein can enhance the antioxidant capacity and reduce lipid peroxidation in the Chinese mitten crab. Besides, the oxidative stress can induce inflammatory response (Feng et al., 2015). The p38-MAPK (mitogen-activated protein kinase) signaling pathway is an important factor responding to environmental stress and regulating inflammatory response in organisms (Sanjay et al., 2003). Specifically, p38-MAPK can activate the ADAM 17 gene (Xu and Derynck, 2010) to modulate inflammation by elevating the levels of cytokines such as TNFα, IL-1 beta and IL-6 (Scheller et al., 2011; Schieven, 2005). In the present study, genes such as p38-MAPK, LITAF (lipopolysaccharide-induced tumor necrosis factor-alpha factor) (Merrill et al., 2011) and ADAM 17 were involved in inflammation
5. Conclusion The high pH stress caused growth retardation and poor feed efficiency in the Chinese mitten crab, and the negative effects of pH were counteracted by dietary protein. The higher level of dietary protein suppressed the negative effect of pH on growth while the lower level of protein did not. The slow growth was concomitant with poor antioxidant capacity, inflammatory response and apoptotic response. The lower dietary protein (30%) triggered oxidative stress and pro6
Aquaculture 516 (2020) 734523
C. Qi, et al.
Fig. 4. The inflammation and apoptosis of juvenile Chinese mitten crab fed the experimental diets at normal (pH = 7.8)/high pH (pH = 9.5). p38-MAPK: p38 mitogen-activated protein kinase; LITAF: Lipopolysaccharide-induced TNF-alpha factor; ADAM 17: A Disintegrin and metalloproteinase domain-containing protein 17; Bcl 2: B-cell lymphoma 2; Bax: Bcl-2-associated X; Caspase 3: Cysteine-aspartic acid protease 3. Columns with different superscripts are significantly different (P < 0.05). Lowercase means significant differences among crabs fed different protein diets at normal pH (P < 0.05). Capital letter means significant differences among crabs fed different protein diets at high pH (P < 0.05).
inflammatory and pro-apoptotic factors at high pH by decreasing antioxidative enzyme activities and upregulating the expressions of proapoptotic and pro-inflammatory genes such as lipopolysaccharide-induced TNF-alpha factor, p38 mitogen-activated protein kinase, a disintegrin and metalloproteinase domain-containing protein 17, Bcl-2associated X and Cysteine-aspartic acid protease 3. A higher protein (35%–40%) is needed in the Chinese mitten crab diet when pH is over 9.5.
Boyd, C.E., 1990. Water Quality in Ponds for Aquaculture. Birmingham Publishing Co., Birmingham, Alabama, USA. Bragado, P., et al., 2007. Apoptosis by cisplatin requires p53 mediated p38α MAPK activation through ROS generation. Apoptosis 12, 1733–1742. Chen, J.C., Kou, C.T., 1996. Nitrogenous excretion in Macrobrachium rosenbergii at different pH levels. Aquaculture 144, 155–164. Chen, S.M., Chen, J.C., 2003. Effects of pH on survival, growth, molting and feeding of giant freshwater prawn Macrobrachium rosenbergii. Aquaculture 218, 613–623. Dar, I., Barzilai, A., 2009. Cellular Responses to Oxidative Stress. Springer Netherlands. Davies, K.J., 2000. Oxidative stress, antioxidant defenses, and damage removal, repair, and replacement systems. IUBMB Life 50, 279–289. Duan, Y., et al., 2019. Changes in the intestine barrier function of Litopenaeus vannamei in response to pH stress. Fish Shellfish Immunol. 88, 142–149. Feng, L., et al., 2015. Changes in barrier health status of the gill for grass carp (Ctenopharyngodon idella) during valine deficiency: regulation of tight junction protein transcript, antioxidant status and apoptosis-related gene expression. Fish Shellfish Immunol. 45, 239–249. Furtado, P.S., et al., 2015. Acute effects of extreme pH and its influences on the survival and biochemical biomarkers of juvenile White Shrimp, Litopenaeus vannamei. Mar. Freshw. Behav. Physiol. 48, 417–429. Gong, Z., et al., 2015. Effects of high pH on antioxidant capacity and astaxanthin content in Eriocheir sinensis. Freshw. Fish. 45, 20–24. Guo, Z., et al., 2012. Effects of dietary protein level on growth performance, nitrogen and energy budget of juvenile hybrid sturgeon, Acipenser baerii ♀ × A. gueldenstaedtii ♂. Aquaculture 338–341, 89–95. Habte-Tsion, H.M., et al., 2017. Adequate dietary protein level enhances stress resistance and immune status of blunt snout bream (Megalobrama amblycephala Yih, 1955). J. Appl. Ichthyol. 33, 75–83. Halver, J.E., Hardy, R.W., 2002. Fish Nutrition. Academic press, California, USA. Han, C., et al., 2016. Gene expression and activities of antioxidant enzymes in liver of hybrid Tilapia, Oreochromis niloticus × Oreochromis aureus, under acute pH stress. J. World Aquac. Soc. 47, 260–267. Han, F., et al., 2019. Effects of glycinin and β-conglycinin on growth performance and intestinal health in juvenile Chinese mitten crabs (Eriocheir sinensis). Fish Shellfish
Declaration of competing interest We declare that we have no competing interests. Acknowledgment This research was supported by grants from National Key R & D Program of China (2018YFD0900400), China Agricultural Research System (CARS-48), the National Natural Science Foundation of China (No. 31572629) and Agriculture Research System of Shanghai, China (Grant No. 201804). References Allan, G.L., Maguire, G.B., 1992. Effects of pH and salinity on survival, growth and osmoregulation in Penaeus monodon Fabricius. Aquaculture 107, 33–47. AOAC, 2005. Official Methods of Analysis of AOAC International, eighteenth ed. Association of Official Analytical Chemists, Washington DC, USA.
7
Aquaculture 516 (2020) 734523
C. Qi, et al.
Scheller, J., et al., 2011. ADAM17: a molecular switch to control inflammation and tissue regeneration. Trends Immunol. 32, 380–387. Schieven, G.L., 2005. The biology of p38 kinase: a central role in inflammation. Curr. Top. Med. Chem. 5, 921–928. Shaw, T.L., 1981. Acute toxicity of increased pH to the freshwater shrimp Paratya curvirostris. N. Z. J. Mar. Freshw. Res. 15, 91–93. Tao, Y., et al., 2016. Acute toxicity of high pH stress and its effect on enzymes activity and histological structure of gill and hepatopancreas in Procambarus clarkii. J. Fish. China/Shuichan Xuebao. 40, 1694–1704. Wang, S., et al., 2016. Comparison of flavour qualities of three sourced Eriocheir sinensis. Food Chem. 200, 24–31. Wang, W.N., et al., 2009. Oxidative stress, DNA damage and antioxidant enzyme gene expression in the Pacific white shrimp, Litopenaeus vannamei when exposed to acute pH stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 150, 428–435. Wang, W.N., et al., 2012. The respiratory burst activity and expression of catalase in white shrimp, Litopenaeus vannamei, during long-term exposure to pH stress. Ecotoxicology 21, 1609–1616. Wang, Y., et al., 2011. The responsive expression of a caspase gene in Chinese shrimp Fenneropenaeus chinensis against pH stress. Aquacult. Res. 42, 1214–1230. Wang, Z., et al., 2018. Supplementation of dietary astaxanthin alleviated oxidative damage induced by chronic high pH stress, and enhanced carapace astaxanthin concentration of Chinese mitten crab Eriocheir sinensis. Aquaculture 483, 230–237. Weihrauch, D., O'Donnell, M., 2017. Acid-Base Balance and Nitrogen Excretion in Invertebrates. Springer International Publishing, Switzerland. Wilson, J.M., et al., 1998. Inhibition of ammonia excretion and production in rainbow trout during severe alkaline exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 121, 99–109. Winston, G.W., 1991. Oxidants and antioxidants in aquatic animals. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 100, 173–176. Xie, Y., et al., 2006. Effects of vitamin C on non-specific immunity of largemouth bass under high pH stress. Feed Ind 25–27. Xu, P., Derynck, R., 2010. Direct activation of TACE-mediated ectodomain shedding by p38 MAP Kinase regulates EGF receptor-dependent cell proliferation. Mol. Cell 37, 551–566. Yu, Y.Q., et al., 2011. Effects of pH stress on five non-specific immune parameters of Chinese mitten crab (Eriocheir sinensis). Freshw. Fish. 41, 70–74. Zhang, J., et al., 2018. Effects of dietary lipid and protein levels on growth and physiological metabolism of Pelteobagrus fulvidraco larvae under recirculating aquaculture system (RAS). Aquaculture 495, 458–464. Zhou, J., et al., 2009. Glutathione S-transferase in the white shrimp Litopenaeus vannamei : characterization and regulation under pH stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 150, 224–230. Zuo, R., et al., 2017. Higher dietary protein increases growth performance, anti-oxidative enzymes activity and transcription of heat shock protein 70 in the juvenile sea urchin (Strongylocentrotus intermedius) under a heat stress. Aquacult. Fish. 2, 18–23.
Immunol. 84, 269–279. Han, S.Y., et al., 2018. A comparative study on oxidative stress response in the hepatopancreas and midgut of the white shrimp Litopenaeus vannamei under gradual changes to low or high pH environment. Fish Shellfish Immunol. 76, 27–34. Hooley, C.G., et al., 2014. Examination of the effects of dietary protein and lipid levels on growth and stress tolerance of juvenile tilapia, Oreochromis niloticus. J. World Aquac. Soc. 45, 115–126. Hossain, Z., et al., 2012. Comparative proteome analysis of high and low cadmium accumulating soybeans under cadmium stress. Amino Acids 43, 2393–2416. Houck, A., Cech Jr., J.J., 2004. Effects of dietary methylmercury on juvenile Sacramento blackfish bioenergetics. Aquat. Toxicol. 69, 107–123. Jean Luc, P., et al., 2005. Essential role of p53 phosphorylation by p38 MAPK in apoptosis induction by the HIV-1 envelope. J. Exp. Med. 201, 279–289. Li, E., et al., 2011. Glutamate dehydrogenase and Nã+-K∼+ ATPase expression and growth response of Litopenaeus vannamei to different salinities and dietary protein levels. Chin. J. Oceanol. Limnol. 29, 343–349. Liu, B., et al., 2012. Effects of anthraquinone extract from Rheum officinale Bail on the physiological responses and HSP70 gene expression of Megalobrama amblycephala under Aeromonas hydrophila infection. Fish Shellfish Immunol. 32, 1–7. Liu, J.S., et al., 2016. The effect of pH on the molting, growth and related gene expression in juvenile mitten crab, Eriocheir sinensis. Freshw. Fish. 46, 96–100. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Lushchak, V.I., 2011. Environmentally induced oxidative stress in aquatic animals. Aquat. Toxicol. 101, 13–30. Ma, J.Q., et al., 2014. Hepatoprotective properties of sesamin against CCl4 induced oxidative stress-mediated apoptosis in mice via JNK pathway. Food Chem. Toxicol. 64, 41–48. Martins, Á.C.d.S., et al., 2014. Modulation of antioxidant and detoxification responses induced by lipoic acid in the Pacific white shrimp Litopenaeus vannamei (Boone, 1931) subjected to hypoxia and re-oxygenation. Mar. Freshw. Behav. Physiol. 47, 335–348. Merrill, J.C., et al., 2011. Whole-body deletion of LPS-induced TNF-α factor (LITAF) markedly improves experimental endotoxic shock and inflammatory arthritis. Proc. Natl. Acad. Sci. U.S.A. 108, 21247–21252. Ministry of Agriculture and Rural Affairs, B.o.f.a.f.m., China Society of Fisheries, N.F.T.E.C., 2018. China Fishery Statistical Yearbook. China Agriculture Press, Beijing, China. NRC, 2011. Nutrient Requirements of Fish and Shrimp. National academies press, Washington. Owens, T.W., et al., 2009. Apoptosis commitment and activation of mitochondrial Bax during anoikis is regulated by p38MAPK. Cell Death Differ. 16, 1551–1562. Saha, N., et al., 2002. Effect of alkalinity (pH 10) on ureogenesis in the air-breathing walking catfish, Clarias batrachus. Comp. Biochem. Physiol. Mol. Integr. Physiol. 132, 353–364. Sanjay, K., et al., 2003. p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat. Rev. Drug Discov. 2, 717–726.
8