- Email: [email protected]
HIV-1 infection despite immediate combination antiviral therapy after infusion of contaminated white cells
HIV-1 Infection Despite Immediate Combination Antiviral Therapy After Infusion of Contaminated White Cells Darwin L. Palmer, MD, Brian L. Hjelle, MD, Albuquerque, New Mexico, Clayton A. Wiley, MD, PhD, ~aJo/la, Cdifornia, Sarah Allen, MD, Albuquerque, New Mexico, William Wachsman, MD, PhD, San Diego, California, Ray G. Mills, BS, Larry E. Davis, MD, Toby L. Merlin, MD, Albuquerque, New Mexico We present a sixth human case in which primary human immunodeficiency virus (HIV-l) infection occurred, despite antiretroviral prophylaxis, after accidental inoculation of infected blood. In the prior five instances, variables such as large virus dose, late administration of antivirals, viral resistance to zidovudine, and pre-existent immunosuppression, may have played a role in the treatment failure. In this case, high-dosage oral zidovudine was given within minutes of the accident and replaced 2% days later with interferon alpha and dideoxyinosine (ddl). Despite aggressive treatment, HIV-1 infection was demonstrated in blood, spleen, and brain tissue at autopsy 16 days later. Of the tissues studied, detection of HIV-1 was most prominent in the spleen. Doublelabel immunocytochemistry confirmed the morphologic impression that while some of the infected spleen cells were CDS-positive T cells, the majority were macrophages. Thus, current single or dual (zidovudine, ddl-interferon) therapies for accidental HIV-1 inoculation may not be effective in preventing early infection. Further trials in animals appear warranted to evaluate protection by other strategies, such as passive immunity or combinations of agents that penetrate the brain and attack HIV-1 viral replication at differing sites. ur understanding of the time course and site(s) of organ involvement is incomplete in primary human immunodeficiency virus (HIV-l) infection1 Although HIV viremia is present in primary disease, it
0
From the Medical (DLP), Pathology (BLH, TLM), and Neurology (LED), Services of the Veterans Adminrstration Medical Center (VAMC), and the Departments of Medicrne (DLP, SA), Pathology (BLH, TLM), Neurology (LED), and Microbiology (RGM), University of New Mexico School of Medicine. Albuoueraue. ,, New Mexico. and the Deoartment of Pathologv (CAW), Division of Neuropathology, and Division of Hematology-Oncology &VW). Unrversitv of California at San Diego School of Medicine, La Jolla, California, and ihe Research Service CWk, San Diego VAMC, San Diego, California. William Wachsman, MD, is a recipient of a Veterans Administration Clinical investigator Award. Requests for reprints should be addressed to Darwin L. Palmer, MD, (ill), Veterans Administration Medical Center, 2100 Ridgecrest Drive SE, Albuquerque, New Mexico 87108. Manuscript submitted July 28, 1993, and accepted in revised form March 21, 1994.
September
is thereafter often absent in early asymptomatic patients. Both plasma and mononuclear-cell-associated HIV-l is again abundant in later stages of disease2 and may correspond with declining CD4 count. Generally, the earliest HIV-l detection documented after viral inoculation is in blood, both as free and as cell-associated viru~.~ During the early, clinically latent stage of infection, HlV nucleic acids can be readily found in biopsy samples from lymphoid organs4s5 The germinal centers of lymph nodes and the macrophages lining the splenic sinuses have particularly high levels of viral RNA and DNA. Little is known about the kinetics of initial viral invasion of these or other organs after infection, since humans have not been systematically sampled immediately after infection. However, invasion of the macaque monkey central nervous system occurs within 1 week of inoculation with simian immunodeficiency virus6 Preventive therapy for accidentally introduced HIV-l infected blood remains controversial.T* Data from animal studies have shown suppression of mouse or feline leukemia viremia and diseasegJOand actual prevention of HIV-1 infection in chimeric severe combined immunodeficieney (SCID) mice transplanted with human tissuei when zidovudine is started within 45 to 60 minutes after inoculation. Lange et all2 reported a case of HIV-l contaminated blood administration with failure of zidovudine to prevent infection despite rapid initiation of drug treatment after exposure. Durand et ali3 reported a similar failure of zidovudine, (given after a 6-hour interval) that followed blood injection in a suicide attempt. Three HIV-l antibody seroconversions despite early zidovudine therapy occurred after needle stick or cannula injury.1~16 We report here a sixth case of iatrogenic HIV-l infection that developed after an infusion of white blood cells (WBC) secondary to a specimen mixup. Despite early, multiple agent antiretroviral therapy, we documented proviral DNA in blood, spleen, and brain within 15 days, which has not previously been documented. The lack of efficacy of early zidovudine and later synergistic treatment with dideoxyinosine (dd1) and interferon alpha does not support the use of these drugs in prophylactic treatment, although the HIV strain in this ease demonstrated moderate zidovudine resistance.
1994
The American
Journal
of Medicine”
Volume
97
289
ANTIVIRAL
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL
CASEREPORT The recipient, a 63-year-old man with a prosthetic left hip, was transferred to our hospital for evaluation of hip pain and fever. The patient had a history of alcohol-induced liver disease complicated by cirrhosis, portal hypertension, and ascites, as well as pancytopenia and red blood cell macrocytosis. A bone marrow biopsy performed 1 year earlier revealed mild megaloblastic changes; hematologic abnormalities were felt to be consistent with alcohol effects. On admission the patient had an anterior thigh abscess with probable communication to the hip prosthesis. The abscess was incised and drained and antibiotic therapy was started for an infection due to Staphylococcus aureus. A radio-labeled indium lllIn WBC scan was ordered to clarify the diagnosis and extent of osteomyelitis. On the day this patient underwent imaging, a second patient (the index patient) with the acquired immunodeficiency syndrome (AIDS), was also was scheduled for inIn WBC scan. The index patient had the same last name and was on the same hospital ward. An accidental sample mixup occurred and the recipient was erroneously injected with 5 mL of lnIn WBCs from the index patient. The mistake was recognized within 15 minutes, and the recipient patient was seen immediately by an infectious disease consultant. The time between the contaminated WBC infusion and the start of an oral dose of 400 mg of zidovudine was 45 minutes. Zidovudine was continued at 200 mg orally every 4 hours. On the assumption that the injected HIV-l strain was zidovudine-resistant,17 the recipient was switched 2?4 days later to a combination of 2’3’ -ddI (250 mg orally every 12 hours) when drugs, which were at the time experimental, could be made available. Recombinant interferon alpha was given, 30 million units intramuscularly three times per week. These agents were selected because of possible synergistic action in vitro.lsJg Blood levels of ddI were obtained after 1 week of therapy. Viral cultures were performed on blood drawn on days 1,8, and 15 after the contaminated infusion. Following initiation of zidovudine and subsequent treatment with ddI and interferon alpha, the patient had no symptoms attributed to the antiviral therapy.20-22 Specifically, there was no nausea, abdominal pain, emesis, diarrhea, headache, myalgia, or symptoms suggesting peripheral neuropathy. However, the patient continued to complain of his presenting symptoms of left hip pain, had low-grade fevers, and swelling of his left leg. During his second week of hospitalization, he became lethargic and somnolent, which was attributed to hepatic encephalopathy with an increasing serum ammonia level. These symptoms were not felt to be suggestive of the acute retroviral syndrome,23 since he developed no other new problems. In addition, there was no laboratory ev290
September
1994
The American
Journal
of Medicine@
Volume
idence of either zidovudine, ddI, or interferon-alpha toxicity.2@22 There was an increase in anemia, but no other change in the already existing pancytopenia, no worsening of liver function tests, nor elevation of serum amylase. He received two units of packed red blood cells 1 week after initiating zidovudine. Two days after the accidental injection, a sample of donor blood was again processed for InIn WBC scanning. An aliquot of the WBCs was counted by hemocytometer, characterized microscopically for WBC type, and quantitatively cultured for HIV-1.24,25 The recipient patient expired 15 days after the transfusion from complications of alcoholic liver disease and hepatorenal failure. Permission for the autopsy was granted by the family. The index patient from whom the white cells were obtained was a severely ill, 34-year-old HIV-l infected homosexual man who had developed an AIDS-defining illness 15 months earlier, with a syndrome of severe wasting. Antibody to HIV-l had been detected 5 years earlier and he had been receiving zidovudine at 100 mg five times daily for the prior 18 months with a l-month hiatus 6 months earlier. A lower extremity abscess following trauma had progressed into a nonhealing ulcer with suspected underlying osteomyelitis. His CD4 lymphocyte count 6 weeks before this incident was 9 cells per microliter of blood.
MATERIALSAND METHODS Assay of Dideoxyinosine Assay of blood level of dd1 by high pressure liquid chromatography was performed on day 10 after viral inoculation and 7 days after starting ddI therapy (Dr. Kathy Knap, Kinetics and Pharmacy Laboratory, Bristol-Myers Squibb Corporation, Wallingford, Connecticut). Blood was drawn 30, 70, 130, and 180 minutes after regular oral dosage of 250 mg ddI.
Virus Culture and Detection Peripheral blood mononuclear cells (PBMC) were purified by density gradient centrifugation of recipient patient, index patient, and seronegative control bloods as described.26 For bone marrow and spleen cell preparations, cells were taken up in media by trituration with a pipet, and mononuclear cells purified as for PBMC preparations. For qualitative cultures, lo7 patient mononuclear cells were cocultivated with an equal number of phytohemagglutinin (PHA)-stimulated PBMC from pooled seronegative donors at a final concentration of 2 X lO?mL in coculture medium (RPMI-1640, 80%; FBS, 20%; human interleukin 2 [IL 21, 10?/o).25Quantitative coculture of index patient PBMC was performed in duplicate using an endpoint dilution method following the consensus protocol of the AIDS Clinical Trials Group Virology Laboratories. Brain tissue obtained at autopsy was processed within 97
ANTIVIRAL THERAPY FAILS TO PREVENT HIV-l/PALMER
2 to 3 hours. After the tissue was washed to remove as much blood as possible it was homogenized. Brain tissue homogenate equivalent to 50 mg was inoculated per lo6 PI&stimulated PBMC in coculture mediuni.“7 Production of HIV-l was monitored biweekly with assays of culture supernatant for p24 antigen by enzyme immunoassay (EIA) as per manufacturers instructions (NEK-060; DuPont NEN, Biller@ Massachusetts). An HIV-l coculture was scored positive when two consecutive p24 antigen results were either “out of range” or >30 pg/mL, with the second value being at least 3 times greater than the initial value. In some samples, DNA was prepared from coculture cell lysates for polymerase chain reaction (PCR).
Tissue lmmunostaining Paraffin-embedded tissues from autopsy were studied with immunocytochemistry and PCR for HIV-l antigens and nucleic acids. These were restricted to spleen, brain, and bone marrow because of lack of availability of properly stored tissue. Previous studies have shown that the most sensitive immunocytochemistry assay for HIV-l in paraffin sections employs an antibody to gp41 (Genetic Systems, Seattle, Washington).28~2g As the amount of tissue initially embedded in paraffin was limited, additional spleen tissue that had been retained in 10% formalin fixative for 1 year was subsequently embedded and studied for double-label immunocytochemistry. The methodology for this procedure has been previously described.2g In brief, after immunolabeling for HIV-l gp41 by using a horseradish peroxidase-tagged system developed with 3,3’ diaminobenzidine,30)31 the sections were immunolabeled in a second round of reactions with antibodies to T cells (CD3), macrophages (HAM), or a lectin specific for endothelial cells and macrophages (RCA-l) by using alkaline phosphatase-conjugated secondary antibodies.
Polymerase Chain Reaction DNA preparation and PCR were performed as previously described.26a32HIV-l long terminal repeat (LTR) consensus primers included the sense primer 5’ AGACAAGA(I’C)ATCCTI’GATCTGTGG and the antisense primer 5’ AGCACCATCCAAAGGTCAGTGG. PCR reactions were carried out in 25 pL volume with 4 mm01 magnesium chloride (MgCl,), 1 mmol/L of each deoxynucleotide triphosphate (dNTP), and 1.6 nmol/L of each primer. Amplification was for 6 cycles at 97”C, 4073, and 7O”C, then 40 cycles at 94°C 55”C, and 72°C (all cycles 1 minute in length). Cycling was followed by extension for 6 minutes at 72°C. Amplified product was detected with the 32P end-labeled oligonucleotide LTRPROBE (5’ ACACACAAGGCTACTI’CCCTGATTGGCAGAACTACACA) in a “dot-blot” format.“6!32 September
ET AL
Zidovudine Sensitivity Assays Virus recovered from primary PBMC cocultures was adapted for growth in the MT-2 cell line from which early passage cell-free supernatants were used to infect HeLa CD4+ cell line HT46C in a focal immunoassay as described1”“3~34with the addition of various concentrations of zidovudine (0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1.0, 5.0, and 10.0 pmoL!L). (HT46C cells were the generous gift of Dr. Bruce Chesebro; Rocky Mountain NIH, Hamilton, Montana, and zidovudine [ZDV] was provided by Burroughs Wellcome Co, Research Triangle Park, North Carolina.) The 50% inhibition dose (ID-50) levels of cultured viruses were calculated by linear regression analysis using nonZDV treated cells as positive controls and compared with that of the prototype HIV-1IIIb (LAI) considered to be zidovudine-sensitive.17,35 Viral pol genes were not sequenced to con&m the phenotypic zidovudine resistance described here.
RESULTS The patient died of complications of alcoholic liver disease 15 days after the HIV-l exposure. At autopsy 1 day later, samples of liver, bone marrow, and brain were frozen at minus 70°C for subsequent viral culture and polymerase chain reaction. The liver showed severe hepatic cirrhosis. Osteomyelitis of the left hip with abscess, fistula, and extension to the periosteum and hip prosthesis was also found. Lymphadenopathy was absent except in the left groin. The central nervous system showed mild lymphocytic meningitis and mild perivascular cuffing.32 The brain parenchyma itself was unremarkable with the exception of a localized area of fibrosis in the right frontal lobe from a gunshot wound incurred many years earlier, As expected in light of this patient’s severe liver disease, his spleen was enlarged and the esophagus had varices. The bone marrow was unremarkable. The other major organ systems were normal. Tests to assess HIV-l infection were done from the day of the errant infusion through subsequent premortem days. A CD4 lymphocyte count of 220 cells per microliter was measured 4 days after the WBC transfusion occurred. The presence of HIV-l proviral DNA was detected by the polymerase chain reaction in PBMC obtained 9 days after transfusion. HIV-l enzyme-linked immunosorbent assay (ELISA) and Western blot analysis (Cambridge Bioscience, Worcester, Massachusetts) was performed on day 1, 8, and 15 after HIV-l infusion, but antibodies were not detected at any point (Figure 1). Total WBC concentration in the WBC-indium labeled infusate obtained from the source patient after the accident, was 44,950/mm3 with a differential count showing 97% segmented neutrophils, 2% lymphocytes, and 1% eosinophils. Assayed by high-pressure liquid 1994
The American
Journal
of Medicine@
Volume
97
291
ANTIVIRAL
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL I
HIV Abe
0
FCR 0
0
cd
0
0
0 0
0
0
0
-
.
- . .
isolate was 50% inhibited at between 0.5 and 1.0 umol/L (data not shown). We do not consider this difference to be significant. Both isolates were more resistant to zidovudine than was the prototype HIV-1 isolate HIV IIIb, which demonstrated a 50% reduction of plaque production at 0.01 pmovL. Both donor and recipient isolate are classified as moderately zidovudine resistant.15
COMMENTS f HIV, WBC ,infusion , /
,
0
6
2
4
,
,
,
i&s
,
10
12
,
, Autopsy Death , t,
14
t(
+s
Figure 1. Clinical course of patient with primary human immunodeficiency virus (HIV-l) contaminated white-cell infusion. Blood samples were assayed for HIV-1 antibody (Ab) by enzymelinked immunosorbent assay (ELlSA); by polymerase chain reaction (PCR) HIV-1 DNA amplification; and by cell culture for HIV-l. Cultures were initially negative, becoming positive on days 9 and 114;brain tissue was positive on culture at autopsy, as was spleen, for immunostaining by gp41. Zidovudine (AZT) was given for the first 2% days, then dideoxyinosine (ddl) and interferon alpha were substituted.
chromatography, ddI levels in serum were 49,342,420, and 391 ngknL at 30, 70, 130, and 180 minutes. Expected levels (at a t,,Z of 1.4 hours) after oral dosage would be approximately 600,800,300, and 100 ng/mL.
Viral Culture and Polymerase Chain Reaction Virus was isolated by PBMC coculture from the index patient’s blood (day 0). Virus was not found in recipient blood at day 0, 1, or 8, but was found at day 15. At autopsy (day 16) HIV-l was isolated from brain but not spleen.
Tissue lmmunostaining Only the spleen (Figure 2) and rare cells in the brain25 showed convincing immunostaining for HIV1 gp41. Bone marrow sections were negative. Spleen sections from HIV-l seronegative controls did not show any staining (Figure 3). Immunostained cells were predominantly located within discrete foci in the red pulp and had a consistent morphology of abundant cytoplasm. Double-label immunocytochemistry performed on paraffin sections from blocks of tissue that had been in 10% formalin fiiative for 1 year did not label well with the second primary antibody. However, in regions where both labels stained, some HIV-l gp41 positive cells were CD3 positive (ie, T cells) but the majority were HAM or RCA-l positive (ie, macrophages) (Figure 4).
Zidovudine Sensitivity Assays The index patient’s HIV-l isolate became 50% inhibited in plaque production capacity at zidovudine concentrations of 0.5 pmol&, whereas the recipient 292
September
1994
The American
Journal
of Medicine@
Volume
This report describes the failme of early antiviral treatment to prevent infection after human HIV-l viral inoculation. This failure occurred despite early high-dosage treatment with zidovudine and later simultaneous use of two agents demonstrated to be effective and possibly synergistic by both in vitro and animal studies.21,22,36Moreover, brain and spleen infection occurred within 16 days despite previous demonstrations of effectiveness of zidovudine and interferon alpha both in vitrol* and in central nervous system infection.37 HIV-l is a dual-tropic virus, with some strains capable of growing only in activated T cells, while others grow well within both activated T cells and macrophages. In the blood, HIV-l is most frequently recovered from T cells, while in the tissues macrophages may comprise a large reservoir of virus. Finding HIV-l predominantly within the spleen macrophages of this case raises the possibility that HIV-l infection of these cells may be critical to early replication. Failure of prophylactic antiviral therapy may have been due to several features of this case, which may be common in many HIV-l parenteral blood exposures. Such features include a very large viral inoculum; virustatic therapy; resistance of the HIV-l strain due to prior zidovudine therapy; and relative preexisting imm:mosuppression of the recipient. The donor viral inoculum in this case was determined from WBC culture as 600- to 700-tissue culture infectious doses. This large inoculum may favor infection by zidovudine-resistant variants, as may the immediate treatment administered to the recipient. A high-viral inoculum, possibly precluding antiretroviral efficacy, also occurred in the other five published cases.12-16 The HIV-l strains in this case showed moderatelevel zidovudine resistance with ID-50 levels of 0.5 to 1.0 pmol/L, which were 50- to loo-fold higher than those of a standard laboratory strain of HIV-l. At doses given this patient, HIV-1 inhibitory levels should have been achieved; however zidovudine serum assays were not performed. Unless an antiviral agent is present prior to the initial replicative cycle, viral DNA is rapidly and permanently integrated into the host genome and the effect of zidovudine thereafter may only be suppressive.“g,36 97
ANTIVIRAL
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL
Figure 2. Paraffin section of patient’s spleen immunostained for human immunodeficiency virus (HIV) gp41. A focus of stained cells (black) is surrounded by unstained cells. Most of the immunostaining fills the cytoplasm of infected cells. The abundance of cell cytoplasm is consistent with an activated cell of macrophage phenotype. (magnification x 200; counterstained with hematoxylin.)
Although its clinical importance is as yet unclear, HIV-l resistance is common in patients receiving zidovudine for at least 6 months.17 Because of this possibility, we chose to substitute ddI and interferon-alpha therapy, after 2X days of zidovudine therapy when ddI became available. Resistant strains have been known to retain some sensitivity to ddI after developing zidovudine resistance.“’ Synergism between alpha interferon and zidovudine has been demonstrated both in vitro and clinically in Kaposi’s sarcoma.18Jg~22 In this case, dd1 plasma levels obtained at day 7 of oral therapy showed a slow rise, (possibly due to prior food intake) but were considered to be well within the therapeutic range. Data on ddI effect on HIV-1 in brain is limited; however, Yarchoan et al37 have recently described 5 AIDS patients whose cognitive impairment decreased during ddI therapy. Finally, the recipient patient had a pre-existing immune deficit, possibly contributing to prophylaxis failure, with alcohol-induced leukopenia, anemia, and thrombocytopenia. His CD4 count, done 4 days after HIV-1 exposure, revealed only 220 cell&L, probably reflecting the state of immune deficiency caused by his chronic alcoholic liver disease,38 although this can be a transient effect of acute HIV infection. PreSeptember
existing immunologic depression may enhance early infection by HIV-1.3g It is unclear whether the early brain replication32 demonstrated in the case represents the natural pathophysiolo&0,40 of early HIV-l infection. The detection of virus in the brain suggests viral replication because of the absence of virus in early blood samples (‘possibly a clearance phenomenon) with their subsequent detection in blood cultures just prior to death. In addition, the mild lymphocytic meningitis seen postmortem is compatible with early HIV-l infection.25*40 Evaluating the usefulness of prophylactic antiviral therapy for inadvertent HIV-1 exposure has been difficult because of the lack of HIV-1 animal models (other than the chimpanzee) that do not have immune modification. The SCID mouse modell’ may work well for evaluating antiretroviral prophylaxis of human tissue, but is not a natural, immunologically intact, animal model. Human studies are difficult for a number of reasons. The low infectivity rate (0.4%) of needle sticks means that a large number of subjects are needed and placebo therapy is unacceptable to many.7as In addition, zidovudine prophylaxis for highrisk needle-stick injury results in frequent (50%) but mild and reversible adverse effects in health care 1994
The American
Journal
of Medicine@
Volume
97
293
ANTIVIRAL THERAPY FAILS TO PREVENT HIV-l/PALMER
ET AL
Figure 3. Paraffin section of a control spleen immunostained for human immunodeficiency detected. (magnification x 200; counterstained with hematoxylin.)
virus (HIV) gp41. No immunostaining is
Figure 4. Paraffin section of patient’s spleen immunostained for human macrophage marker (purple) and for human immunodeficiency virus (HIV) gp41 (brown). Numerous macrophages are labeled purple while a few are double-labeled for HIV gp41 antigen (black) (arrows). (magnification x 240; not counterstained.)
workers41 Cumulative case reports indicate that rapid oral zidovudine given after large volume blood exposure is not effective in preventing infection. Since such accidents will undoubtedly continue, al294
ternative prophylactic measures should be considered. Such a regimen might include immune globulin (or monoclonal antibody) to confer passive immunity against circulating free viru~.~~
September 1994 The American Journal of Medicine@ Volume 97
ANTIVIRAL
ACKNOWLEDGMENT Supported
by the Department
of Veterans Affairs.
REFERENCES 1. Panteleo G, Graziosi C, Fauci AS. The immunopathogenesis of human immunodeficiency virus infection. NEJM. 1993;328:327-335 2. Coombs RW, Collier AC, Allain JP, et al. Plasma viremia in human immunodeficiency virus infection. NEJM. 1989;321:1626-1631. 3. Darr ES, Mondgil T, Meyer RD, Ho DD. Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection. NEJM. 1991;324:961-964. 4. Pantaleo G, Graziosi C, Demarest JF, et al. HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of the disease. Nature. 1993;362:355-358. 5. Embretson J, Zupancic M, Ribas JL, et al. Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS. Nature. 1993;362:359-362. 6. Chakrabarti L, Hurtel M, Maire M-A, et al. Early viral replication in the brain of SIV-infected rhesus monkeys. Am J Path. 1991;139:1273-1280. 7. Henderson DK, Gerberding JL. Prophylactic zidovudine after occupational exposure to the human immunodeficiency virus: an interim analysis. J Infect Dis. 1989;160:321-327. 8. CDC Public Health Service statement on management of occupational exposure to human immunodeficiency virus, including considerations regarding zidovudine post exposure use. MMMWR. 1990;39:1-11. 9. Ruprecht RM, D’Brine LG, Rossoni LD, Nusinoff-Lehrman S. Suppression of mouse viremia and retroviral disease by 3’.azido-3’-deoxythymidine. Nature. 1986;323:467-469. 10. Tavares L, Roneker C, Johnston K, et al. 3’-Azido-3’.deoxythymidine in feline leukemia virus-infected cats: a model for therapy and prophylaxis of AIDS. Cancer Res. 1987;47:3190-3194. 11. Shih CC, Kaneshima H, Rabin L, et al. Post exposure prophylaxis with zidovudine suppresses human immunodeficiency virus type 1 infection in SCID hu mice in a time-dependent manner. J /nfectDis. 1991;163:625-627. 12. Lange JMA, Boucher CAB, Hollak CEM, et al. Failure of zidovudine prophylaxis after accidental exposure to HIV-l. NEJM. 1990;322:1375-1377. 13. Durand E, Le Jeunne C, Hugues FC. Failure of prophylactic zidovudine after suicidal self-inoculation of HIV-infected blood. NEJM. 1991;324:1062. 14. Looke DFM, Grove DI. Failed prophylactic zidovudine after needle stick injury. Lancet. 1990;335:1280. 15. Jones PD. HIV transmission by stabbing despite zidovudine prophylaxis. Lancet. 1991;338:884. 16. Anonymous. HIV seroconversion after occupational exposure despite early prophylactic zidovudine therapy. Lancet 1993;341:1077-1078. 17. Larder BA, Darby G, Richman DD. HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science. 1989;243: 1731-1734. 18. Hartshorn KL, Vogt MW, Chou TC, et al. Synergistic inhibition of human immunodeficiency virus in vitro by azidothymidine and recombinant alpha-A interferon. Antimicrob Agents Chemother. 1987;31:168-172. 19. Kovacs JA, Deyton L, Davey R, et al. Combined zidovudine and interferon-a therapy in patients with Kaposi sarcoma and the acquired immunodeficiency syndrome (AIDS). Ann Intern Med. 1989;111:280-287. 20. Richman DD, Fischl MA, Grieco MH, et al. The toxicity of zidovudine (AZT) in the treatment of patients with AIDS and AIDS-related complex, NEJM. 1987;317:192-197. 21. Lambett JS, Geidlin M, Reichman RC, et al. 2’, 3’.Dideoxy-inosine (ddl) in patients with the acquired immunodeficiency syndrome of AIDS-related complex. NEJM. 1990;322:1333-1340. 22. Krown SE, Gold JWM, Niedzwiedi D, et al. Interferon alpha with zidovudine:
September
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL
safety, tolerance and clinical and virological effects in patients with Kaposi sarcoma associated with the acquired immunodeficiency syndrome (AIDS). Ann InternMed. 1990;112:812-821. 23. Cooper DA, Gold J, Maclean P, et al. Acute AIDS retrovirus infection, Definition of a clinical illness associated with seroconversion. Lancet. 1985; 1:537-540 24. Ho DD, Mondgil T, Alam M. Quantitation of human immunodeficiency virus Type I in the blood of infected persons. NE&f. 1989;321:1621-1625, 25. Jackson JB, Coombs RW, Sannerud K, et al. Rapid and sensitive viral culture method for human immunodeficiency virus type I. J Clin Microbial. 1988;26:1416-1418. 26. Hjelle B, Scalf R, Swanson S. High frequency of human T-cell leukemialymphoma virus type II infection in New Mexico blood donors: determination by sequencespecific oligonucleotide hybridization. Blood. 1990;76:450-454. 27. Gartner S, Popovic M. Virus isolation and production. In: Aldovini A, Walker BD, eds. Techniques in HIVResearch. New York: Stockton Press; 1990:53-70. 28. Kure K, Weidenheim KM, Lyman WD, Dickson DW. Morphology and distribution of HIV-l gp41 positive microglia in subacute AIDS encephalitis. Pattern of involvement resembling a multisystem degeneration. Acta Neuropathol (Bed). 1990;80:393-400. 29. Masliah E, Achim CL, Ge N, et al. Spectrum of HIV associated neocortical damage. Ann Neural. 1992;32 321329. 30. Morey M, Powell H, Wiley C. Distribution of neurotropic murine leukemia virus in chronically infected mice. J Neuropathol Exp Neural. 1988;47:305. Abstract. 31. Wiley C, Schrier RD, Nelson JA, et al. Cellular localization of human immunodeficiency virus infection within the brains of acquired immune deficiency syndrome patients. Proc Nat1 Acad Sci. USA. 1986;83:7089-7093. 32. Davis LE, Hjelle BL, Miller VE, et al. Early viral brain invasion in iatrogenic human immunodeficiency virus infection. Neurology. 1992;42:1736-1739. 33. Chesebro B, Wehrly K. Development of a sensitive quantitative focal assay for human immunodeficiency virus infectivity. J Virol. 1988;62:3779-3788. 34. Royer R, Mills R, Deck L, et al. Inhibition of human immunodeficiency virus type 1 replication by derivatives of gossypol. Pharmacol Res. 1991;24: 407-412. 35. Larder BA, Chesebro B, Richman DD. Susceptibilities of zidovudinesusceptible and resistant human immunodeficiency virus isolates to antiviral agents determined by using a quantitative plaque reduction assay. Antimicrob Agents Chemother. 1990;34:436-441. 36. Johnson VA, Barlow MA, Merrill DP, et al. Three-drug synergistic inhibition of HIV-1 replication in vitro by zidovudine, recombinant soluble CD4, and recombinant interferon-alpha A. J Infect Dis. 1990;161:1059-1067. 37. Yarchoan R, Berg G, Browers P, et al. Response of humanimmunodeficiency-virus-associated neurological disease to 3’-azido-3’.deoxy thymidine. Lancet. 1987;1:132-135. 38. Smith FE, Palmer DL. Alcoholism, infection and altered host defenses: A review of clinical and experimental observations. J Chronic Dis. 1976; 29:3549. 39. Ludlam CA, Tucker J, Steele CM, et al. Human T-lymphotrophic virus type Ill (HTLV-III) infection in seronegative hemophiliacs after transfusion of factor V. Lancet. 1985;2:233-236. 40. Tindall, Cooper DA, Donovan B, Penny R. Primary human immunodeficiency virus infection. Clinical and serologic aspects. In: Sande MA, Volberding PA, eds. Medical Management of AIDS. Infectious Disease Clinics of North America. Philadelphia: WB Saunders Co; 1988:329-341. 41. Puro V, lppolito G, Guzzanti E et al. Zidovudine prophylaxis after accidental exposure to HIV: the Italian experience. AIDS. 1992,6:963-969. 42. Emini EA, Schleif WA, Nunberg JH, et al. Prevention of HIV-l infection in chimpanzees by 98120 V3 domain-specific monoclonal antibody. Nature. 1992;355:728-730.
1994
The American
Journal
of Medicine@
Volume
97
295
0
From the Medical (DLP), Pathology (BLH, TLM), and Neurology (LED), Services of the Veterans Adminrstration Medical Center (VAMC), and the Departments of Medicrne (DLP, SA), Pathology (BLH, TLM), Neurology (LED), and Microbiology (RGM), University of New Mexico School of Medicine. Albuoueraue. ,, New Mexico. and the Deoartment of Pathologv (CAW), Division of Neuropathology, and Division of Hematology-Oncology &VW). Unrversitv of California at San Diego School of Medicine, La Jolla, California, and ihe Research Service CWk, San Diego VAMC, San Diego, California. William Wachsman, MD, is a recipient of a Veterans Administration Clinical investigator Award. Requests for reprints should be addressed to Darwin L. Palmer, MD, (ill), Veterans Administration Medical Center, 2100 Ridgecrest Drive SE, Albuquerque, New Mexico 87108. Manuscript submitted July 28, 1993, and accepted in revised form March 21, 1994.
September
is thereafter often absent in early asymptomatic patients. Both plasma and mononuclear-cell-associated HIV-l is again abundant in later stages of disease2 and may correspond with declining CD4 count. Generally, the earliest HIV-l detection documented after viral inoculation is in blood, both as free and as cell-associated viru~.~ During the early, clinically latent stage of infection, HlV nucleic acids can be readily found in biopsy samples from lymphoid organs4s5 The germinal centers of lymph nodes and the macrophages lining the splenic sinuses have particularly high levels of viral RNA and DNA. Little is known about the kinetics of initial viral invasion of these or other organs after infection, since humans have not been systematically sampled immediately after infection. However, invasion of the macaque monkey central nervous system occurs within 1 week of inoculation with simian immunodeficiency virus6 Preventive therapy for accidentally introduced HIV-l infected blood remains controversial.T* Data from animal studies have shown suppression of mouse or feline leukemia viremia and diseasegJOand actual prevention of HIV-1 infection in chimeric severe combined immunodeficieney (SCID) mice transplanted with human tissuei when zidovudine is started within 45 to 60 minutes after inoculation. Lange et all2 reported a case of HIV-l contaminated blood administration with failure of zidovudine to prevent infection despite rapid initiation of drug treatment after exposure. Durand et ali3 reported a similar failure of zidovudine, (given after a 6-hour interval) that followed blood injection in a suicide attempt. Three HIV-l antibody seroconversions despite early zidovudine therapy occurred after needle stick or cannula injury.1~16 We report here a sixth case of iatrogenic HIV-l infection that developed after an infusion of white blood cells (WBC) secondary to a specimen mixup. Despite early, multiple agent antiretroviral therapy, we documented proviral DNA in blood, spleen, and brain within 15 days, which has not previously been documented. The lack of efficacy of early zidovudine and later synergistic treatment with dideoxyinosine (dd1) and interferon alpha does not support the use of these drugs in prophylactic treatment, although the HIV strain in this ease demonstrated moderate zidovudine resistance.
1994
The American
Journal
of Medicine”
Volume
97
289
ANTIVIRAL
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL
CASEREPORT The recipient, a 63-year-old man with a prosthetic left hip, was transferred to our hospital for evaluation of hip pain and fever. The patient had a history of alcohol-induced liver disease complicated by cirrhosis, portal hypertension, and ascites, as well as pancytopenia and red blood cell macrocytosis. A bone marrow biopsy performed 1 year earlier revealed mild megaloblastic changes; hematologic abnormalities were felt to be consistent with alcohol effects. On admission the patient had an anterior thigh abscess with probable communication to the hip prosthesis. The abscess was incised and drained and antibiotic therapy was started for an infection due to Staphylococcus aureus. A radio-labeled indium lllIn WBC scan was ordered to clarify the diagnosis and extent of osteomyelitis. On the day this patient underwent imaging, a second patient (the index patient) with the acquired immunodeficiency syndrome (AIDS), was also was scheduled for inIn WBC scan. The index patient had the same last name and was on the same hospital ward. An accidental sample mixup occurred and the recipient was erroneously injected with 5 mL of lnIn WBCs from the index patient. The mistake was recognized within 15 minutes, and the recipient patient was seen immediately by an infectious disease consultant. The time between the contaminated WBC infusion and the start of an oral dose of 400 mg of zidovudine was 45 minutes. Zidovudine was continued at 200 mg orally every 4 hours. On the assumption that the injected HIV-l strain was zidovudine-resistant,17 the recipient was switched 2?4 days later to a combination of 2’3’ -ddI (250 mg orally every 12 hours) when drugs, which were at the time experimental, could be made available. Recombinant interferon alpha was given, 30 million units intramuscularly three times per week. These agents were selected because of possible synergistic action in vitro.lsJg Blood levels of ddI were obtained after 1 week of therapy. Viral cultures were performed on blood drawn on days 1,8, and 15 after the contaminated infusion. Following initiation of zidovudine and subsequent treatment with ddI and interferon alpha, the patient had no symptoms attributed to the antiviral therapy.20-22 Specifically, there was no nausea, abdominal pain, emesis, diarrhea, headache, myalgia, or symptoms suggesting peripheral neuropathy. However, the patient continued to complain of his presenting symptoms of left hip pain, had low-grade fevers, and swelling of his left leg. During his second week of hospitalization, he became lethargic and somnolent, which was attributed to hepatic encephalopathy with an increasing serum ammonia level. These symptoms were not felt to be suggestive of the acute retroviral syndrome,23 since he developed no other new problems. In addition, there was no laboratory ev290
September
1994
The American
Journal
of Medicine@
Volume
idence of either zidovudine, ddI, or interferon-alpha toxicity.2@22 There was an increase in anemia, but no other change in the already existing pancytopenia, no worsening of liver function tests, nor elevation of serum amylase. He received two units of packed red blood cells 1 week after initiating zidovudine. Two days after the accidental injection, a sample of donor blood was again processed for InIn WBC scanning. An aliquot of the WBCs was counted by hemocytometer, characterized microscopically for WBC type, and quantitatively cultured for HIV-1.24,25 The recipient patient expired 15 days after the transfusion from complications of alcoholic liver disease and hepatorenal failure. Permission for the autopsy was granted by the family. The index patient from whom the white cells were obtained was a severely ill, 34-year-old HIV-l infected homosexual man who had developed an AIDS-defining illness 15 months earlier, with a syndrome of severe wasting. Antibody to HIV-l had been detected 5 years earlier and he had been receiving zidovudine at 100 mg five times daily for the prior 18 months with a l-month hiatus 6 months earlier. A lower extremity abscess following trauma had progressed into a nonhealing ulcer with suspected underlying osteomyelitis. His CD4 lymphocyte count 6 weeks before this incident was 9 cells per microliter of blood.
MATERIALSAND METHODS Assay of Dideoxyinosine Assay of blood level of dd1 by high pressure liquid chromatography was performed on day 10 after viral inoculation and 7 days after starting ddI therapy (Dr. Kathy Knap, Kinetics and Pharmacy Laboratory, Bristol-Myers Squibb Corporation, Wallingford, Connecticut). Blood was drawn 30, 70, 130, and 180 minutes after regular oral dosage of 250 mg ddI.
Virus Culture and Detection Peripheral blood mononuclear cells (PBMC) were purified by density gradient centrifugation of recipient patient, index patient, and seronegative control bloods as described.26 For bone marrow and spleen cell preparations, cells were taken up in media by trituration with a pipet, and mononuclear cells purified as for PBMC preparations. For qualitative cultures, lo7 patient mononuclear cells were cocultivated with an equal number of phytohemagglutinin (PHA)-stimulated PBMC from pooled seronegative donors at a final concentration of 2 X lO?mL in coculture medium (RPMI-1640, 80%; FBS, 20%; human interleukin 2 [IL 21, 10?/o).25Quantitative coculture of index patient PBMC was performed in duplicate using an endpoint dilution method following the consensus protocol of the AIDS Clinical Trials Group Virology Laboratories. Brain tissue obtained at autopsy was processed within 97
ANTIVIRAL THERAPY FAILS TO PREVENT HIV-l/PALMER
2 to 3 hours. After the tissue was washed to remove as much blood as possible it was homogenized. Brain tissue homogenate equivalent to 50 mg was inoculated per lo6 PI&stimulated PBMC in coculture mediuni.“7 Production of HIV-l was monitored biweekly with assays of culture supernatant for p24 antigen by enzyme immunoassay (EIA) as per manufacturers instructions (NEK-060; DuPont NEN, Biller@ Massachusetts). An HIV-l coculture was scored positive when two consecutive p24 antigen results were either “out of range” or >30 pg/mL, with the second value being at least 3 times greater than the initial value. In some samples, DNA was prepared from coculture cell lysates for polymerase chain reaction (PCR).
Tissue lmmunostaining Paraffin-embedded tissues from autopsy were studied with immunocytochemistry and PCR for HIV-l antigens and nucleic acids. These were restricted to spleen, brain, and bone marrow because of lack of availability of properly stored tissue. Previous studies have shown that the most sensitive immunocytochemistry assay for HIV-l in paraffin sections employs an antibody to gp41 (Genetic Systems, Seattle, Washington).28~2g As the amount of tissue initially embedded in paraffin was limited, additional spleen tissue that had been retained in 10% formalin fixative for 1 year was subsequently embedded and studied for double-label immunocytochemistry. The methodology for this procedure has been previously described.2g In brief, after immunolabeling for HIV-l gp41 by using a horseradish peroxidase-tagged system developed with 3,3’ diaminobenzidine,30)31 the sections were immunolabeled in a second round of reactions with antibodies to T cells (CD3), macrophages (HAM), or a lectin specific for endothelial cells and macrophages (RCA-l) by using alkaline phosphatase-conjugated secondary antibodies.
Polymerase Chain Reaction DNA preparation and PCR were performed as previously described.26a32HIV-l long terminal repeat (LTR) consensus primers included the sense primer 5’ AGACAAGA(I’C)ATCCTI’GATCTGTGG and the antisense primer 5’ AGCACCATCCAAAGGTCAGTGG. PCR reactions were carried out in 25 pL volume with 4 mm01 magnesium chloride (MgCl,), 1 mmol/L of each deoxynucleotide triphosphate (dNTP), and 1.6 nmol/L of each primer. Amplification was for 6 cycles at 97”C, 4073, and 7O”C, then 40 cycles at 94°C 55”C, and 72°C (all cycles 1 minute in length). Cycling was followed by extension for 6 minutes at 72°C. Amplified product was detected with the 32P end-labeled oligonucleotide LTRPROBE (5’ ACACACAAGGCTACTI’CCCTGATTGGCAGAACTACACA) in a “dot-blot” format.“6!32 September
ET AL
Zidovudine Sensitivity Assays Virus recovered from primary PBMC cocultures was adapted for growth in the MT-2 cell line from which early passage cell-free supernatants were used to infect HeLa CD4+ cell line HT46C in a focal immunoassay as described1”“3~34with the addition of various concentrations of zidovudine (0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1.0, 5.0, and 10.0 pmoL!L). (HT46C cells were the generous gift of Dr. Bruce Chesebro; Rocky Mountain NIH, Hamilton, Montana, and zidovudine [ZDV] was provided by Burroughs Wellcome Co, Research Triangle Park, North Carolina.) The 50% inhibition dose (ID-50) levels of cultured viruses were calculated by linear regression analysis using nonZDV treated cells as positive controls and compared with that of the prototype HIV-1IIIb (LAI) considered to be zidovudine-sensitive.17,35 Viral pol genes were not sequenced to con&m the phenotypic zidovudine resistance described here.
RESULTS The patient died of complications of alcoholic liver disease 15 days after the HIV-l exposure. At autopsy 1 day later, samples of liver, bone marrow, and brain were frozen at minus 70°C for subsequent viral culture and polymerase chain reaction. The liver showed severe hepatic cirrhosis. Osteomyelitis of the left hip with abscess, fistula, and extension to the periosteum and hip prosthesis was also found. Lymphadenopathy was absent except in the left groin. The central nervous system showed mild lymphocytic meningitis and mild perivascular cuffing.32 The brain parenchyma itself was unremarkable with the exception of a localized area of fibrosis in the right frontal lobe from a gunshot wound incurred many years earlier, As expected in light of this patient’s severe liver disease, his spleen was enlarged and the esophagus had varices. The bone marrow was unremarkable. The other major organ systems were normal. Tests to assess HIV-l infection were done from the day of the errant infusion through subsequent premortem days. A CD4 lymphocyte count of 220 cells per microliter was measured 4 days after the WBC transfusion occurred. The presence of HIV-l proviral DNA was detected by the polymerase chain reaction in PBMC obtained 9 days after transfusion. HIV-l enzyme-linked immunosorbent assay (ELISA) and Western blot analysis (Cambridge Bioscience, Worcester, Massachusetts) was performed on day 1, 8, and 15 after HIV-l infusion, but antibodies were not detected at any point (Figure 1). Total WBC concentration in the WBC-indium labeled infusate obtained from the source patient after the accident, was 44,950/mm3 with a differential count showing 97% segmented neutrophils, 2% lymphocytes, and 1% eosinophils. Assayed by high-pressure liquid 1994
The American
Journal
of Medicine@
Volume
97
291
ANTIVIRAL
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL I
HIV Abe
0
FCR 0
0
cd
0
0
0 0
0
0
0
-
.
- . .
isolate was 50% inhibited at between 0.5 and 1.0 umol/L (data not shown). We do not consider this difference to be significant. Both isolates were more resistant to zidovudine than was the prototype HIV-1 isolate HIV IIIb, which demonstrated a 50% reduction of plaque production at 0.01 pmovL. Both donor and recipient isolate are classified as moderately zidovudine resistant.15
COMMENTS f HIV, WBC ,infusion , /
,
0
6
2
4
,
,
,
i&s
,
10
12
,
, Autopsy Death , t,
14
t(
+s
Figure 1. Clinical course of patient with primary human immunodeficiency virus (HIV-l) contaminated white-cell infusion. Blood samples were assayed for HIV-1 antibody (Ab) by enzymelinked immunosorbent assay (ELlSA); by polymerase chain reaction (PCR) HIV-1 DNA amplification; and by cell culture for HIV-l. Cultures were initially negative, becoming positive on days 9 and 114;brain tissue was positive on culture at autopsy, as was spleen, for immunostaining by gp41. Zidovudine (AZT) was given for the first 2% days, then dideoxyinosine (ddl) and interferon alpha were substituted.
chromatography, ddI levels in serum were 49,342,420, and 391 ngknL at 30, 70, 130, and 180 minutes. Expected levels (at a t,,Z of 1.4 hours) after oral dosage would be approximately 600,800,300, and 100 ng/mL.
Viral Culture and Polymerase Chain Reaction Virus was isolated by PBMC coculture from the index patient’s blood (day 0). Virus was not found in recipient blood at day 0, 1, or 8, but was found at day 15. At autopsy (day 16) HIV-l was isolated from brain but not spleen.
Tissue lmmunostaining Only the spleen (Figure 2) and rare cells in the brain25 showed convincing immunostaining for HIV1 gp41. Bone marrow sections were negative. Spleen sections from HIV-l seronegative controls did not show any staining (Figure 3). Immunostained cells were predominantly located within discrete foci in the red pulp and had a consistent morphology of abundant cytoplasm. Double-label immunocytochemistry performed on paraffin sections from blocks of tissue that had been in 10% formalin fiiative for 1 year did not label well with the second primary antibody. However, in regions where both labels stained, some HIV-l gp41 positive cells were CD3 positive (ie, T cells) but the majority were HAM or RCA-l positive (ie, macrophages) (Figure 4).
Zidovudine Sensitivity Assays The index patient’s HIV-l isolate became 50% inhibited in plaque production capacity at zidovudine concentrations of 0.5 pmol&, whereas the recipient 292
September
1994
The American
Journal
of Medicine@
Volume
This report describes the failme of early antiviral treatment to prevent infection after human HIV-l viral inoculation. This failure occurred despite early high-dosage treatment with zidovudine and later simultaneous use of two agents demonstrated to be effective and possibly synergistic by both in vitro and animal studies.21,22,36Moreover, brain and spleen infection occurred within 16 days despite previous demonstrations of effectiveness of zidovudine and interferon alpha both in vitrol* and in central nervous system infection.37 HIV-l is a dual-tropic virus, with some strains capable of growing only in activated T cells, while others grow well within both activated T cells and macrophages. In the blood, HIV-l is most frequently recovered from T cells, while in the tissues macrophages may comprise a large reservoir of virus. Finding HIV-l predominantly within the spleen macrophages of this case raises the possibility that HIV-l infection of these cells may be critical to early replication. Failure of prophylactic antiviral therapy may have been due to several features of this case, which may be common in many HIV-l parenteral blood exposures. Such features include a very large viral inoculum; virustatic therapy; resistance of the HIV-l strain due to prior zidovudine therapy; and relative preexisting imm:mosuppression of the recipient. The donor viral inoculum in this case was determined from WBC culture as 600- to 700-tissue culture infectious doses. This large inoculum may favor infection by zidovudine-resistant variants, as may the immediate treatment administered to the recipient. A high-viral inoculum, possibly precluding antiretroviral efficacy, also occurred in the other five published cases.12-16 The HIV-l strains in this case showed moderatelevel zidovudine resistance with ID-50 levels of 0.5 to 1.0 pmol/L, which were 50- to loo-fold higher than those of a standard laboratory strain of HIV-l. At doses given this patient, HIV-1 inhibitory levels should have been achieved; however zidovudine serum assays were not performed. Unless an antiviral agent is present prior to the initial replicative cycle, viral DNA is rapidly and permanently integrated into the host genome and the effect of zidovudine thereafter may only be suppressive.“g,36 97
ANTIVIRAL
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL
Figure 2. Paraffin section of patient’s spleen immunostained for human immunodeficiency virus (HIV) gp41. A focus of stained cells (black) is surrounded by unstained cells. Most of the immunostaining fills the cytoplasm of infected cells. The abundance of cell cytoplasm is consistent with an activated cell of macrophage phenotype. (magnification x 200; counterstained with hematoxylin.)
Although its clinical importance is as yet unclear, HIV-l resistance is common in patients receiving zidovudine for at least 6 months.17 Because of this possibility, we chose to substitute ddI and interferon-alpha therapy, after 2X days of zidovudine therapy when ddI became available. Resistant strains have been known to retain some sensitivity to ddI after developing zidovudine resistance.“’ Synergism between alpha interferon and zidovudine has been demonstrated both in vitro and clinically in Kaposi’s sarcoma.18Jg~22 In this case, dd1 plasma levels obtained at day 7 of oral therapy showed a slow rise, (possibly due to prior food intake) but were considered to be well within the therapeutic range. Data on ddI effect on HIV-1 in brain is limited; however, Yarchoan et al37 have recently described 5 AIDS patients whose cognitive impairment decreased during ddI therapy. Finally, the recipient patient had a pre-existing immune deficit, possibly contributing to prophylaxis failure, with alcohol-induced leukopenia, anemia, and thrombocytopenia. His CD4 count, done 4 days after HIV-1 exposure, revealed only 220 cell&L, probably reflecting the state of immune deficiency caused by his chronic alcoholic liver disease,38 although this can be a transient effect of acute HIV infection. PreSeptember
existing immunologic depression may enhance early infection by HIV-1.3g It is unclear whether the early brain replication32 demonstrated in the case represents the natural pathophysiolo&0,40 of early HIV-l infection. The detection of virus in the brain suggests viral replication because of the absence of virus in early blood samples (‘possibly a clearance phenomenon) with their subsequent detection in blood cultures just prior to death. In addition, the mild lymphocytic meningitis seen postmortem is compatible with early HIV-l infection.25*40 Evaluating the usefulness of prophylactic antiviral therapy for inadvertent HIV-1 exposure has been difficult because of the lack of HIV-1 animal models (other than the chimpanzee) that do not have immune modification. The SCID mouse modell’ may work well for evaluating antiretroviral prophylaxis of human tissue, but is not a natural, immunologically intact, animal model. Human studies are difficult for a number of reasons. The low infectivity rate (0.4%) of needle sticks means that a large number of subjects are needed and placebo therapy is unacceptable to many.7as In addition, zidovudine prophylaxis for highrisk needle-stick injury results in frequent (50%) but mild and reversible adverse effects in health care 1994
The American
Journal
of Medicine@
Volume
97
293
ANTIVIRAL THERAPY FAILS TO PREVENT HIV-l/PALMER
ET AL
Figure 3. Paraffin section of a control spleen immunostained for human immunodeficiency detected. (magnification x 200; counterstained with hematoxylin.)
virus (HIV) gp41. No immunostaining is
Figure 4. Paraffin section of patient’s spleen immunostained for human macrophage marker (purple) and for human immunodeficiency virus (HIV) gp41 (brown). Numerous macrophages are labeled purple while a few are double-labeled for HIV gp41 antigen (black) (arrows). (magnification x 240; not counterstained.)
workers41 Cumulative case reports indicate that rapid oral zidovudine given after large volume blood exposure is not effective in preventing infection. Since such accidents will undoubtedly continue, al294
ternative prophylactic measures should be considered. Such a regimen might include immune globulin (or monoclonal antibody) to confer passive immunity against circulating free viru~.~~
September 1994 The American Journal of Medicine@ Volume 97
ANTIVIRAL
ACKNOWLEDGMENT Supported
by the Department
of Veterans Affairs.
REFERENCES 1. Panteleo G, Graziosi C, Fauci AS. The immunopathogenesis of human immunodeficiency virus infection. NEJM. 1993;328:327-335 2. Coombs RW, Collier AC, Allain JP, et al. Plasma viremia in human immunodeficiency virus infection. NEJM. 1989;321:1626-1631. 3. Darr ES, Mondgil T, Meyer RD, Ho DD. Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection. NEJM. 1991;324:961-964. 4. Pantaleo G, Graziosi C, Demarest JF, et al. HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of the disease. Nature. 1993;362:355-358. 5. Embretson J, Zupancic M, Ribas JL, et al. Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS. Nature. 1993;362:359-362. 6. Chakrabarti L, Hurtel M, Maire M-A, et al. Early viral replication in the brain of SIV-infected rhesus monkeys. Am J Path. 1991;139:1273-1280. 7. Henderson DK, Gerberding JL. Prophylactic zidovudine after occupational exposure to the human immunodeficiency virus: an interim analysis. J Infect Dis. 1989;160:321-327. 8. CDC Public Health Service statement on management of occupational exposure to human immunodeficiency virus, including considerations regarding zidovudine post exposure use. MMMWR. 1990;39:1-11. 9. Ruprecht RM, D’Brine LG, Rossoni LD, Nusinoff-Lehrman S. Suppression of mouse viremia and retroviral disease by 3’.azido-3’-deoxythymidine. Nature. 1986;323:467-469. 10. Tavares L, Roneker C, Johnston K, et al. 3’-Azido-3’.deoxythymidine in feline leukemia virus-infected cats: a model for therapy and prophylaxis of AIDS. Cancer Res. 1987;47:3190-3194. 11. Shih CC, Kaneshima H, Rabin L, et al. Post exposure prophylaxis with zidovudine suppresses human immunodeficiency virus type 1 infection in SCID hu mice in a time-dependent manner. J /nfectDis. 1991;163:625-627. 12. Lange JMA, Boucher CAB, Hollak CEM, et al. Failure of zidovudine prophylaxis after accidental exposure to HIV-l. NEJM. 1990;322:1375-1377. 13. Durand E, Le Jeunne C, Hugues FC. Failure of prophylactic zidovudine after suicidal self-inoculation of HIV-infected blood. NEJM. 1991;324:1062. 14. Looke DFM, Grove DI. Failed prophylactic zidovudine after needle stick injury. Lancet. 1990;335:1280. 15. Jones PD. HIV transmission by stabbing despite zidovudine prophylaxis. Lancet. 1991;338:884. 16. Anonymous. HIV seroconversion after occupational exposure despite early prophylactic zidovudine therapy. Lancet 1993;341:1077-1078. 17. Larder BA, Darby G, Richman DD. HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science. 1989;243: 1731-1734. 18. Hartshorn KL, Vogt MW, Chou TC, et al. Synergistic inhibition of human immunodeficiency virus in vitro by azidothymidine and recombinant alpha-A interferon. Antimicrob Agents Chemother. 1987;31:168-172. 19. Kovacs JA, Deyton L, Davey R, et al. Combined zidovudine and interferon-a therapy in patients with Kaposi sarcoma and the acquired immunodeficiency syndrome (AIDS). Ann Intern Med. 1989;111:280-287. 20. Richman DD, Fischl MA, Grieco MH, et al. The toxicity of zidovudine (AZT) in the treatment of patients with AIDS and AIDS-related complex, NEJM. 1987;317:192-197. 21. Lambett JS, Geidlin M, Reichman RC, et al. 2’, 3’.Dideoxy-inosine (ddl) in patients with the acquired immunodeficiency syndrome of AIDS-related complex. NEJM. 1990;322:1333-1340. 22. Krown SE, Gold JWM, Niedzwiedi D, et al. Interferon alpha with zidovudine:
September
THERAPY
FAILS
TO PREVENT
HIV-l/PALMER
ET AL
safety, tolerance and clinical and virological effects in patients with Kaposi sarcoma associated with the acquired immunodeficiency syndrome (AIDS). Ann InternMed. 1990;112:812-821. 23. Cooper DA, Gold J, Maclean P, et al. Acute AIDS retrovirus infection, Definition of a clinical illness associated with seroconversion. Lancet. 1985; 1:537-540 24. Ho DD, Mondgil T, Alam M. Quantitation of human immunodeficiency virus Type I in the blood of infected persons. NE&f. 1989;321:1621-1625, 25. Jackson JB, Coombs RW, Sannerud K, et al. Rapid and sensitive viral culture method for human immunodeficiency virus type I. J Clin Microbial. 1988;26:1416-1418. 26. Hjelle B, Scalf R, Swanson S. High frequency of human T-cell leukemialymphoma virus type II infection in New Mexico blood donors: determination by sequencespecific oligonucleotide hybridization. Blood. 1990;76:450-454. 27. Gartner S, Popovic M. Virus isolation and production. In: Aldovini A, Walker BD, eds. Techniques in HIVResearch. New York: Stockton Press; 1990:53-70. 28. Kure K, Weidenheim KM, Lyman WD, Dickson DW. Morphology and distribution of HIV-l gp41 positive microglia in subacute AIDS encephalitis. Pattern of involvement resembling a multisystem degeneration. Acta Neuropathol (Bed). 1990;80:393-400. 29. Masliah E, Achim CL, Ge N, et al. Spectrum of HIV associated neocortical damage. Ann Neural. 1992;32 321329. 30. Morey M, Powell H, Wiley C. Distribution of neurotropic murine leukemia virus in chronically infected mice. J Neuropathol Exp Neural. 1988;47:305. Abstract. 31. Wiley C, Schrier RD, Nelson JA, et al. Cellular localization of human immunodeficiency virus infection within the brains of acquired immune deficiency syndrome patients. Proc Nat1 Acad Sci. USA. 1986;83:7089-7093. 32. Davis LE, Hjelle BL, Miller VE, et al. Early viral brain invasion in iatrogenic human immunodeficiency virus infection. Neurology. 1992;42:1736-1739. 33. Chesebro B, Wehrly K. Development of a sensitive quantitative focal assay for human immunodeficiency virus infectivity. J Virol. 1988;62:3779-3788. 34. Royer R, Mills R, Deck L, et al. Inhibition of human immunodeficiency virus type 1 replication by derivatives of gossypol. Pharmacol Res. 1991;24: 407-412. 35. Larder BA, Chesebro B, Richman DD. Susceptibilities of zidovudinesusceptible and resistant human immunodeficiency virus isolates to antiviral agents determined by using a quantitative plaque reduction assay. Antimicrob Agents Chemother. 1990;34:436-441. 36. Johnson VA, Barlow MA, Merrill DP, et al. Three-drug synergistic inhibition of HIV-1 replication in vitro by zidovudine, recombinant soluble CD4, and recombinant interferon-alpha A. J Infect Dis. 1990;161:1059-1067. 37. Yarchoan R, Berg G, Browers P, et al. Response of humanimmunodeficiency-virus-associated neurological disease to 3’-azido-3’.deoxy thymidine. Lancet. 1987;1:132-135. 38. Smith FE, Palmer DL. Alcoholism, infection and altered host defenses: A review of clinical and experimental observations. J Chronic Dis. 1976; 29:3549. 39. Ludlam CA, Tucker J, Steele CM, et al. Human T-lymphotrophic virus type Ill (HTLV-III) infection in seronegative hemophiliacs after transfusion of factor V. Lancet. 1985;2:233-236. 40. Tindall, Cooper DA, Donovan B, Penny R. Primary human immunodeficiency virus infection. Clinical and serologic aspects. In: Sande MA, Volberding PA, eds. Medical Management of AIDS. Infectious Disease Clinics of North America. Philadelphia: WB Saunders Co; 1988:329-341. 41. Puro V, lppolito G, Guzzanti E et al. Zidovudine prophylaxis after accidental exposure to HIV: the Italian experience. AIDS. 1992,6:963-969. 42. Emini EA, Schleif WA, Nunberg JH, et al. Prevention of HIV-l infection in chimpanzees by 98120 V3 domain-specific monoclonal antibody. Nature. 1992;355:728-730.
1994
The American
Journal
of Medicine@
Volume
97
295