- Email: [email protected]
Identification and expression analysis of mical family genes in zebrafish
JOURNAL OF
GENETICS AND GENOMICS J. Genet. Genomics 37 (2010) 685−693
www.jgenetgenomics.org
Identification and expression analysis of mical family genes in zebrafish Yulin Xue a, Chikin Kuok a, An Xiao a, Zuoyan Zhu a, Shuo Lin a, b, Bo Zhang a, * a
Key Laboratory of Cell Proliferation and Differentiation, Center of Developmental Biology and Genetics, College of Life Sciences, Peking University, Ministry of Education, Beijing 100871, China b Department of Molecular, Cell, and Developmental Biology, University of California, Los Angeles, Los Angeles, CA 90095-1606, USA Received for publication 27 May 2010; revised 1 July 2010; accepted 6 July 2010
Abstract Mical (molecule interacting with CasL) represent a conserved family of cytosolic multidomain proteins that has been shown to be associated with a variety of cellular processes, including axon guidance, cell movement, cell-cell junction formation, vesicle trafficking and cancer cell metastasis. However, the expression and function of these genes during embryonic development have not been comprehensively characterized, especially in vertebrate species, although some limited in vivo studies have been carried out in neural and musculature systems of Drosophila and in neural systems of vertebrates. So far, no mical family homologs have been reported in zebrafish, an ideal vertebrate model for the study of developmental processes. Here we report eight homologs of mical family genes in zebrafish and their expression profiles during embryonic development. Consistent with the findings in Drosophila and mammals, most zebrafish mical family genes display expression in neural and musculature systems. In addition, five mical homologs are detected in heart, and one, micall2a, in blood vessels. Our data established an important basis for further functional studies of mical family genes in zebrafish, and suggest a possible role for mical genes in cardiovascular development. Keywords: zebrafish; mical; micall2a; expression pattern; blood vessel; heart
Introduction MICAL (molecule interacting with CasL) was first isolated in 2002 through far-Western screening with the SH3 domain of CasL (CRK-associated Substrate-related Protein) from a human thymus cDNA library (Suzuki et al., 2002). Since then additional members of Mical-like proteins have been identified, which represent a family of large multidomain cytosolic proteins. They can be divided into two classes (sub-families), Mical and Micall (Mical-like). Mical has a flavoprotein monooxygenase (MO) domain in its * Corresponding author. Tel & Fax: +86-10-6275 9072. E-mail address: [email protected] DOI: 10.1016/S1673-8527(09)60086-2
N-terminus, a calponin-like actin-binding (CH) domain and a LIM-type (LIM) domain in the middle, and coiled-coils motifs in its C-terminus, while Micall contains similar structures with Mical except for the MO domain (Supplemental Fig. 1). In Drosophila, Mical directly links Semaphorins and their Plexin receptors, and controls F-actin dynamics during axon guidance via its redox activity (Hung et al., 2010). Drosophila Mical was also reported to regulate myofilament organization (Beuchle et al., 2007), synaptogenesis (Beuchle et al., 2007) and dendrite pruning (Kirilly et al., 2009). Human MICAL1 was reported to form protein scaffold for Golgi apparatus and intermediate filament cytoskeleton with RAB1 (Weide et al., 2003). Knocking down MICAL2-PV (MICAL2 prostate
686
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
cancer variants) by siRNA significantly reduces the viability of prostate cancer cells (Ashida et al., 2006). Human MICAL-L1 (MICAL-Like 1) was shown to link both EHD1 (EH-domain containing 1) and RAB8a to tubular membranes (Sharma et al., 2009). Mical-like was also found in parasites excretory-secretory products during host-parasite immune interactions between snail and trematode (Guillou et al., 2007). In mice, MICALL2 could mediate the endocytic recycling of Occludin in tight junctions of MTD-1A cells (a cell line derived from mouse epithelial cells) (Terai et al., 2006; Nakatsuji et al., 2008; Nishimura and Sasaki, 2008a, 2008b, 2009) and transfer Actinin-4 from the cell body to the tips of neurites (Sakane et al., 2010) through binding to Rab13. So far, functional studies of Mical family have mainly been conducted in invertebrate embryos and adult tissues, as well as in vitro vertebrate culture cells. Their biological significance for vertebrate development remains largely elusive. Systematic in vivo study of Micals’ function is highly desirable, and zebrafish (Danio rerio) could be an ideal model organism for this purpose due to its advantage in combining embryological analysis and genetic approaches, especially for the study of vasculature development. However, no mical homologs in zebrafish have been reported to date. Mammals and flies have five and two distinct Mical family members, respectively, including Mical1, Mical2, Mical3, Micall1, Micall2 for mammals and Mical, MICALlike in Drosophila. The expression patterns of Mical family genes in mammals have been mainly described in adult tissues as well as in in vitro culture cells. They were detected in nervous system (Weide et al., 2003; Fischer et al., 2005; Ashida et al., 2006; Pasterkamp et al., 2006; Terai et al., 2006), and a variety of other adult tissues, including lung (Suzuki et al., 2002; Fischer et al., 2005; Ashida et al., 2006; Terai et al., 2006), kidney (Suzuki et al., 2002; Fischer et al., 2005; Ashida et al., 2006; Terai et al., 2006), liver (Fischer et al., 2005; Ashida et al., 2006; Terai et al., 2006), heart (Fischer et al., 2005; Ashida et al., 2006), muscle (Fischer et al., 2005; Ashida et al., 2006), testis (Suzuki et al., 2002), thymus (Suzuki et al., 2002), bone marrow (Ashida et al., 2006), as well as cancer cells (Ashida et al., 2006). In contrast, embryonic expression of Mical family genes has only been studied for Mical sub-family genes, which was reported to be in nervous system in rats (Terman et al., 2002; Fischer et al., 2005; Pasterkamp et al., 2006) and in nervous system and musculature in flies (Terman et al.,
2002; Beuchle et al., 2007; Kirilly et al., 2009). The expression of Mical-like sub-family genes during embryonic development has not been described. Furthermore, there is no publication concerning a complete structure and expression analysis of the entire Mical family genes in a single organism so far. Here, we report the identification of eight homologs of mical family genes in zebrafish as well as their expression patterns during embryogenesis. Our results show that, in addition to expression in nervous system and musculature, several members of mical family are expressed specifically in cardiovascular structures. Our work provides important information for mical family genes and implies new directions for their functional study.
Materials and methods Zebrafish husbandry Zebrafish was maintained at 28.5°C following standard protocol (Westerfield, 2007). Wild type Tübingen strain was used for our study.
Identification of mical family genes Reciprocal TBLASTN searches were performed on Ensembl zebrafish genome annotation database (Zv8, e57) using the longest amino acid sequences available from mammalian Mical family members (GenBank accession numbers for the BLAST listed in Supplemental Table 1 and schematic view in Supplemental Fig. 1) and candidate genes were selected according to e-value and domain analyses. The corresponding cDNA were amplified by reverse transcription PCR using Phusion high-fidelity DNA polymerase (NEB, USA). Total RNA was isolated from 24 hpf (hours post fertilization) zebrafish embryos using TRIzol (Invitrogen, USA). Two microgram of RNA was used as a template with oligo dT-primed in vitro cDNA synthesis using M-MLV reverse transcriptase (Promega, USA). The touch down PCR conditions were as follows: 1 min/98°C; 6 s/98°C, 30 s/68−54°C (Δ = –1°C), 2.5 min/72°C (15 cycles), 1 min/98°C; 6 s/98°C, 30 s/59°C, 2.5 min/72°C (25 cycles), 6 min/72°C. The primers used for amplification and the GenBank accession numbers for the corresponding cDNA sequences are listed in Table 1.
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
687
Table 1 Information of the corresponding sequences and primers used for cDNA cloning and for making probes for ISH GenBank accession No.a
Length (bp)
CCCCCACGTCGTGCCTCCGC
HM151004
2,542
AAGGGCCGGGCTGGAGGGCA
TGAGTTCCCTCCCCTCGCTGGA
HM151005
1,327
CGGTGGTGGCCCCTGTGGCT
TGCAGCAGCGCAGCCTCATCT
HM151006
3,642
Gene
Forward primer (5′→ 3′)
mical1
GGGCGCGGGTCCCTGTGGTC
mical2a mical2b
Reverse primer (5′→ 3′)
mical3a
TCAAGCCCAATGAATACC
CAGACACGCTGACACCTC
−
1,501
mcial3b
GACCCTCCGAGCCTTTCA
ACCTCTGCCCGCCAACCAAC
HM151007
0,528
micall1
TTACTGCCAGGCTCTTAC
CTTCATTCTTGGTGCTCA
HM151008
1,984
micall2a
GGGGTACCATGGCGGCTATTAAAG
GACTAGTAGCTGAGCTTCACTCTCCCATC
HM151009c
2,400
micall2b
GTCGTCCGTGGTTGAATCG
GAAGGTGGGCAAGAAAGTT
HM151010
1,794
a
b
b
The GenBank accession numbers for zebrafish mical genes submitted by us based on this work; The sequence of mical3a cloned was part of NCBI known zebrafish mical3a sequence (XM_001921641.2), thus we didn’t submit our sequence; c This is a full length coding sequence. Only micall2a and micall2b have experimental evidences for full length coding region from Mammalian Gene Collection (MGC) Project of National Institutes of Health, USA, and we confirmed the transcription intiation start site of micall2a via 5′ RACE (data not shown).
Whole mount ISH was performed as described previously (Jowett and Lettice, 1994). The sequences in Table 1 were used as templates in in vitro transcription for ISH. Embryos were fixed by 4% paraformaldehyde solution for more than 24 h at 4°C and stored at –20°C in alcohol. The stages were chosen as follows: 1-cell stage, 1k-cell stage, 50% epiboly stage, tail bud stage, 6-somite stage, 18-somite stage, 24 hpf, 1.5 dpf (days post fertilization), 2 dpf and 3 dpf. Embryos older than 24 hpf were treated with 0.003% phenylthiourea (PTU) to prevent the development of pigments. RNA antisense probes were generated by in vitro transcription via T3 or T7 RNA polymerase (Promega) with DIG RNA labeling mixture (Roche, Germany) and then purified by RNeasy mini kit (Qiagen, USA). All probes were developed by anti-digoxingenin-AP antibody (Roche) and BCIP/NBT color development substrate (Promega). Photographs were taken by AxioCam MRc5 CCD sensor and AxioVision AC software (Zeiss, Germany).
and the sequence is from NCBI, LOC566850 (XP_695229.3) which is an annotated sequence from zebrafish genome.). The alignment was performed by ClustalX software (version 1.83). The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The bootstrap consensus tree inferred from 1,000 replicates (Felsenstein, 1985) was taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) were shown next to the branches (Felsenstein, 1985). The evolutionary distances were computed using the JTT matrix-based method (Jones et al., 1992) and were in the units of the number of amino acid substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 95 positions in the final dataset. Phylogenetic analyses were conducted in MEGA4 (Tamura et al., 2007).
Sequence alignment and construction of phylogenetic tree
Results
In situ hybridization (ISH)
CH domains were acquired by Pfam (Finn et al. 2010) analysis. The accession numbers for human Mical family members are listed in Supplemental Table 1. The sequences of zebrafish mical family members used for these analyses are mostly based on our sequences obtained from cDNA cloning in Table 1 (Mical3b is the only exception
Identification of zebrafish mical family genes We have obtained a blood vessel-specific GFP (Green Fluorescent Protein) expression transgenic line, ET(zgc55358:EGFP) (Supplemental Fig. 2), from a large-scale enhancer trap screen mediated by Tol2 trans-
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
688
poson in zebrafish. The Tol2 insertion site was mapped to the 1st intron of zgc:55358 that was renamed as micall2 in Ensembl Zv7 assembly. Whole mount ISH result showed that micall2 is specifically and strongly expressed in blood vessels in zebrafish embryos, which faithfully recapitulate the GFP expression pattern in the transgenic line (Supplemental Fig. 2 and see below). To our knowledge, this is the first observation of mical family members being expressed in blood vessels, which may imply a novel function of mical family genes in vascular development. Before probing into the functional aspects of micals in vasculature development, we wonder whether any other zebrafish mical family members share similar expression patterns with that of zgc:55358/micall2. However, there is neither any previous report on mical family homologs in zebrafish, nor publications concerning the structure and expression of the entire mical family genes in a single organism. Not surprisingly, the records for zebrafish micals in both NCBI and Ensembl databases are incomplete and the whole family is poorly annotated (Table 2, columns 2 and 3, marked by “#”). By reciprocal TBLASTN search, five mical homologous regions being located on Chr. (chromosome) 4, 7, 18, 23, 25, and four mical-like homologous regions on Chr. 1, 3, 6, 16 (Table 2, column 5), were obtained, respectively. We found that the candidate homologous re-
gion on Chr. 16 has 100% identity with the one on Chr. 3, but unlike Chr. 3, no syntenic relations could be detected on this region compared with mammalian orthologs. Therefore, we believe that the genomic fragment corresponding to the micall2a candidate on Chr. 16 was mis-annotated, and there is only one micall2a in the current genome assembly. For the rest of the candidate homologs, we noticed that there are two candidate homologous genes annotated in each of the chromosomes 6, 18 and 23, and three candidate homologous genes annotated in chromosome 25 (Table 2), while BLAST results show that these separate genes within the same chromosome could actually be different regions of one single gene (Supplemental Fig. 3 showed one example). To verify the BLAST results, we cloned partial cDNA fragments of the corresponding candidate genes as well as the seemingly intergenic regions via RT-PCR. The results clearly confirmed the BLAST results and indicate that the separate candidate genes in the same chromosome should indeed be integrated/combined into one single mical family homologous gene (Tables 1 and 2). Through the above analyses, we conclude that we have collected and clarified all the zebrafish mical family genes currently available, which contain five mical homologs and three micall homologs, respectively (Table 2, column 1).
Table 2 A summary on mical family genes in zebrafish Nomenclature
NCBI gene symbol
Ensembl gene name
Ensembl transcript ID
Genomic location
mical1
zgc:171928
zgc:171928
ENSDART00000031616
Chr. 23
$
ENSDART00000037315
Chr. 23
mical2a
LOC569607
(unnamed)
LOC569607
ENSDART00000082679
Chr. 7
mical2b
sb:cb94
sb:cb94
ENSDART00000091531
Chr. 25
–
(unnamed) $
ENSDART00000112712
Chr. 25
LOC569564
A2CEA1_DANRE
ENSDART00000026069
Chr. 25
mical3a
mical3
mical3
ENSDART00000028938
Ch.r 18
ENSDART00000101026
Chr. 18
mical3b
LOC566850 #
si:dkey-153k10.11 #
ENSDART00000014496
Chr. 4
micall1
LOC100149741 #
MICALL1 #
ENSDART00000113911
Chr. 6
micall2a
micall2b $
$
–
(unnamed)
ENSDART00000114696
Chr. 6
micall2 #
micall2 #
ENSDART00000074591
Chr. 3
LOC100002833 #
MICALL2 (2 of 3) #
ENSDART00000020557
Chr. 16 @
zgc:55983 #
zgc:55983
ENSDART00000008682
Chr. 1
These sequences do not have a gene name in Ensembl database. – These sequences do not have NCBI gene symbols, but only have GenBank accession numbers. # Results by searching “mical” as keyword in corresponding database. @ This sequence was mislocated and should be removed from the zebrafish genome according to our analyses.
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
CH domain has been reported to function in signal transduction or related cytoskeleton regulation and bind to actin directly (Gimona et al., 2002). The CH domains in Mical proteins belong to type 2 CH domain (Sun et al., 2006), which cannot bind to cytoskeleton alone and functions in assisting type 1 CH domain containing proteins to bind to F-actin (Gimona et al., 2002). Type 2 CH domain also contains a PIP2 (phosphatidylinositol 4, 5-bisphosphate) binding site (Fig. 1) and this type of interaction is involved in the regulation of F-actin activity (Fukami et al., 1992). Since the CH domain is present and highly conserved in all Mical family members, we employed it for phylogenetic analysis and performed amino acid sequence alignment of Micals between zebrafish and human. The zebrafish sequences of this domain are essentially obtained from our cDNA cloning and sequencing results except for that of mical3b. The result of alignments showed that the CH do-
689
main is largely conserved from zebrafish to human (Fig. 1). We then sorted zebrafish Mical family members into existing human phylogenetic clades, with the two CH domains of Actinin-4, the first being type 1 CH and the second being type 2 CH, as external references for better distinction (Fig. 2, only the second CH domain was shown as the root). The clade revealed the presence of two distinct paralogs for each of mical2, mical3 and micall2 genes in zebrafish (Fig. 2). This could be explained by an additional genome duplication event occurred in teleost ancestors compared with tetrapod lineage (Postlethwait et al., 2000). Based on all these information, we renamed the zebrafish mical family genes as mical1, mical2a, mical2b, mical3a, mical3b, micall1, micall2a and micall2b, respectively (Table 2 and Fig. 2). The amino acid identities in CH domains of Mical family members between human and zebrafish are shown in Supplemental Table 2.
Fig. 1. The CH domains from zebrafish Mical family proteins show high similarities with their human homologs. Colors indicate the conserved amino acid residues. PIP2 binding site is indicated by a black bar. The GenBank accession numbers for the five human Micals used for the alignment analysis are as follows: NP_073602.3 (MICAL1 iso b), NP_055447.1 (MICAL2), NP_056056.2 (MICAL3 iso c), NP_203744.1 (MICALL1), NP_891554.1 (MICALL2).
690
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
Fig. 2. Classification of zebrafish Micals by phylogenetic analysis with their human homologs. The GenBank accession numbers for the five human MICALS used for the phylogenetic analysis are as follows: NP_073602.3 (MICAL1 iso b), NP_055447.1 (MICAL2), NP_056056.2 (MICAL3 iso c), NP_203744.1 (MICALL1), NP_891554.1 (MICALL2).
Expression pattern analysis of zebrafish mical genes To analyze the expression patterns of these mical family genes in zebrafish, we performed ISH using antisense ribo-probes made from the cDNA sequences we have cloned by RT-PCR (Table 1). We focused our expression analysis on the first 3 days of embryonic development, during which the formation of most organs has been initiated and established (Kimmel et al., 1995). The results show that only micall2a distributed specifically in embryonic blood vessels from 4-somite stage to at least 3 dpf (Fig. 3, M and N). In addition, we also found heart expression of mical2a, mical2b, mical3a, micall2a and micall2b (Fig. 3, C–F, H, M, N and P). In detail, mical1 is expressed ubiquitously except for notochord (Fig. 3, A and B). mical2a is expressed strongly in heart from 24 hpf to 3 dpf and can be detected slightly in pharyngeal area and fin edge (Fig. 3, C and D). mical2b expression could be detected in olfactory epithelium, somite, heart, pronephric duct, anus and fin edge at 24 hpf (Fig. 3E). At 3 dpf, mical2b is expressed in olfactory epithelium, lateral line, pectoral fin bud and heart (Fig. 3F). mical3a shows specific expression pattern from bud stage in notochord (data not shown). Later on at 24
hpf, it is expressed strongly in the entire brain, somite and anus (Fig. 3G). At 2 dpf, it can be detected in the entire brain as well as eye cup, pectoral fin bud, heart and part of common cardinal vein. At 3 dpf, the expression of mical3a is similar to but not as strong as that at 2 dpf (Fig. 3H). mical3b is expressed in two small nerve nuclei around ear at 24 hpf (Fig. 3I) and in nerve nuclei of ventral diencephalon and hindbrain from 1.5 dpf to 3 dpf (data not shown and Fig. 3J). Unlike all the other micals, mical3b also show specific expression in spinal cord neurons as well as the floor plate from 2 dpf (data not shown and Fig. 3J). For mical-like genes, the expression of micall1 begins from shield stage at shield region (data not shown). However, it becomes ubiquitously expressed in yolk syncytial layer at bud stage (data not shown). At 24 hpf, it is mainly detected in brain and skin (Fig. 3K). At 2 dpf, its expression becomes focused on the entire brain, pectoral fin bud and pharyngeal arch (data not shown). Slight staining could also be detected in pronephric duct and yolk syncytial layer (data not shown). Interestingly, at 3 dpf, a strong signal at the position corresponding to thyroid gland could be detected in addition to the expression patterns found in 2 dpf embryos (Fig. 3L). The expression of mi-
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
call2a is only seen in vasculature at 24 hpf (Fig. 3M). At 3 dpf, it shows additional expression in lateral line besides the whole blood vessel system (Fig. 3N). The expression of micall2b is mainly in central nervous system in 24 hpf
691
embryos (Fig. 3O) and becomes restricted to brain since 1.5 dpf (data not shown). At 3 dpf, its expression could be detected in brain, heart, pectoral fin and the opening of anus (Fig. 3P).
Fig. 3. The expression patterns of zebrafish mical genes. The embryos are shown anterior to the left and dorsal to the top, unless otherwise stated. A and B, C and D, E and F, G and H, I and J, K and L, M and N and O and P correspond to mical1, mical2a, mical2b, mical3a, mical3b, micall1, micall2a and micall2b expression patterns at 24 hpf and 3 dpf, respectively. The arrow in H shows common cardinal vein. The arrow in L shows the position of thyroid gland. All arrowheads point to heart. The insets in C and E show anterior view, in J and I show dorsal view, and the insets in D, F and H show ventral view. The inset in C shows dorsal to the top and in E shows dorsal to the right. For better view, the embryo was tilted a little bit towards its side.
692
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
Discussion We have identified eight mical family genes in zebrafish, including each of the two paralogs for mical2, mical3 and micall2, based on current database analysis and molecular cloning. Since human has only five MICAL family genes, the excess in the number of mical homologs in zebrafish could possibly be explained by the additional genome duplication event occurred in teleost ancestors relative to tetrapod lineage (Postlethwait et al., 2000). In the view of evolution, duplication could result in new loci with novel functions and is considered as one way to achieve evolution progress. Thus, the two paralogs of some of these genes might indicate their novel functions in zebrafish. In fruitfly, Mical gene was reported to be mainly expressed in nervous system and musculature, functioning in axon guidance, myofilament organization and synaptogenesis (Terman et al., 2002; Fischer et al., 2005; Terai et al., 2006; Beuchle et al., 2007; Kolk and Pasterkamp, 2007). For the expression of Mical family genes in mammals, only rodent Mical sub-family genes have been studied during embryogenesis and they were reported to be expressed in nervous system (Terman et al., 2002; Pasterkamp et al., 2006). Through Northern blot and Western blot, some Mical family genes were also detected in mammalian adult tissues including brain, spinal cord, lung, liver, kidney, muscle, heart, thymus, spleen, testis, as well as in hematopoietic cells and certain cancer cells (Suzuki et al., 2002; Ashida et al., 2006; Terai et al., 2006). However, no blood vessel expression has been reported so far, and the information on their expression during embryogenesis is also limited. Here we report for the first time that micall2a is expressed specifically in zebrafish blood vessels. Our work implies a potential role for micall2 in blood vessel development and/or physiological process. In addition, since Drosophila Mical (Hung et al., 2010), human MICALL1 (Sharma et al., 2009) and mouse Micall2 (Terai et al., 2006; Sakane et al., 2010) were all reported to be associated with actin cytoskeleton and could initiate cell morphology changes, the expression of mical2a, mical2b, mical3a, micall2a and micall2b in heart also indicates possible functions for Micals in heart contraction. Other members of zebrafish mical family genes exhibit neuronal and musculature expressions which is similar to their mammalian and Drosophila homologs, indicating their potential roles in myofilament organization and synaptogenesis (Beuchle et al., 2007). The function of
micall1 in thyroid gland region needs to be elucidated in the future. Zebrafish, as one of the ideal vertebrate model organisms for the research of developmental biology, its ex vivo fertilization, transparency embryos, the ease of morpholino-mediated gene knockdown and transposon-mediated transgenic tools all facilitate genetic studies of developmental processes in live embryos. More detailed functions and mechanisms of mical family genes and their counterparts can be expected to be revealed by further in-depth studies in zebrafish.
Acknowledgements This work was supported by National Natural Science Foundation of China (Nos. 30721064 and 30730056, 30620120101) as well as National Basic Research Program of China (973 Program) (Nos. 2005CB522504, 2006CB943801 and 2007CB914502). We thank Xi Ren and Fei Qi for helpful discussion. We also thank Chuanyun Li for help in bioinformatic analysis, Yuying Gao, Ying Zhang, Jiao Zhang for technical support and Yingdi Jia, Jingliang Chen, Houhua Cui for zebrafish husbandry.
Supplemental data Supplemental Figs. 1–3 and Tables 1–2 associated with this article can be found in the online version at www.jgenetgenomics.org.
References Ashida, S., Furihata, M., Katagiri, T., Tamura, K., Anazawa, Y., Yoshioka, H., Miki, T., Fujioka, T., Shuin, T., Nakamura, Y., and Nakagawa H. (2006). Expression of novel molecules, MICAL2-PV (MICAL2 prostate cancer variants), increases with high Gleason score and prostate cancer progression. Clin. Cancer Res. 12: 2767−2773. Beuchle, D., Schwarz, H., Langegger, M., Koch, I., and Aberle, H. (2007). Drosophila MICAL regulates myofilament organization and synaptic structure. Mech. Dev. 124: 390−406. Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783−791. Finn, R.D., Mistry, J., Tate, J., Coggill, P., Heger, A., Pollington, J.E., Gavin, O.L., Gunasekaran, P., Ceric, G., Forslund, K., Holm, L., Sonnhammer, E.L., Eddy, S.R., and Bateman, A. (2010). The Pfam protein families database. Nucleic Acids Res. 38: D211−D222.
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
Fischer, J., Weide, T., and Barnekow, A. (2005). The MICAL proteins and rab1: a possible link to the cytoskeleton? Biochem. Biophys. Res. Commun. 328: 415−423. Fukami, K., Furuhashi, K., Inagaki, M., Endo, T., Hatano, S., and Takenawa, T. (1992). Requirement of phosphatidylinositol 4,5-bisphosphate for alpha-actinin function. Nature 359: 150−152. Gimona, M., Djinovic-Carugo, K., Kranewitter, W.J., and Winder, S.J. (2002). Functional plasticity of CH domains. FEBS Lett. 513: 98−106. Guillou, F., Roger, E., Mone, Y., Rognon, A., Grunau, C., Theron, A., Mitta, G., Coustau, C., and Gourbal, B.E. (2007). Excretory-secretory proteome of larval Schistosoma mansoni and Echinostoma caproni, two parasites of Biomphalaria glabrata. Mol. Biochem. Parasitol. 155: 45−56. Hung, R.J., Yazdani, U., Yoon, J., Wu, H., Yang, T., Gupta, N., Huang, Z., van Berkel, W.J., and Terman, J.R. (2010). Mical links semaphorins to F-actin disassembly. Nature 463: 823−827. Jones, D.T., Taylor, W.R., and Thornton, J.M. (1992). The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8: 275−282. Jowett, T., and Lettice, L. (1994). Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein-labelled probes. Trends Genet. 10: 73−74. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., and Schilling, T.F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203: 253−310. Kirilly, D., Gu, Y., Huang, Y., Wu, Z., Bashirullah, A., Low, B.C., Kolodkin, A.L., Wang, H., and Yu, F. (2009). A genetic pathway composed of Sox14 and Mical governs severing of dendrites during pruning. Nat. Neurosci. 12: 1497−1506 Kolk, S.M., and Pasterkamp, R.J. (2007). MICAL flavoprotein monooxygenases: structure, function and role in semaphorin signaling. Adv. Exp. Med. Biol. 600: 38−51. Nakatsuji, H., Nishimura, N., Yamamura, R., Kanayama, H.O., and Sasaki, T. (2008). Involvement of actinin-4 in the recruitment of JRAB/MICAL-L2 to cell-cell junctions and the formation of functional tight junctions. Mol. Cell. Biol. 28: 3324−3335. Nishimura, N., and Sasaki, T. (2008a). Cell-surface biotinylation to study endocytosis and recycling of occludin. Methods Mol. Biol. 440: 89−96. Nishimura, N., and Sasaki, T. (2008b). Identification and characterization of JRAB/MICAL-L2, a junctional Rab13-binding protein. Methods Enzymol. 438: 141−153. Nishimura, N., and Sasaki, T. (2009). Rab family small G proteins in
693
regulation of epithelial apical junctions. Front. Biosci. 14: 2115−2129. Pasterkamp, R.J., Dai, H.N., Terman, J.R., Wahlin, K.J., Kim, B., Bregman, B.S., Popovich, P.G., and Kolodkin, A.L. (2006). MICAL flavoprotein monooxygenases: expression during neural development and following spinal cord injuries in the rat. Mol. Cell. Neurosci. 31: 52−69. Postlethwait, J.H., Woods, I.G., Ngo-Hazelett, P., Yan, Y.L., Kelly, P.D., Chu, F., Huang, H., Hill-Force, A., and Talbot, W.S. (2000). Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res. 10: 1890−1902. Saitou, N., and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406−425. Sakane, A., Honda, K., and Sasaki, T. (2010). Rab13 regulates neurite outgrowth in PC12 cells through its effector protein, JRAB/MICAL-L2. Mol. Cell. Biol. 30: 1077−1087. Sharma, M., Panapakkam Giridharan, S.S., Rahajeng, J., Naslavsky, N., and Caplan, S. (2009). MICAL-L1 links EHD1 to tubular recycling endosomes and regulates receptor recycling. Mol. Bio. Cell. 24: 5181−5194. Sun, H., Dai, H., Zhang, J., Jin, X., Xiong, S., Xu, J., Wu, J., and Shi, Y. (2006). Solution structure of calponin homology domain of human MICAL-1. J. Biomol. NMR 36: 295−300. Suzuki, T., Nakamoto, T., Ogawa, S., Seo, S., Matsumura, T., Tachibana, K., Morimoto, C., and Hirai, H. (2002). MICAL, a novel CasL interacting molecule, associates with vimentin. J. Biol. Chem. 277: 14933−14941. Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596−1599. Terai, T., Nishimura, N., Kanda, I., Yasui, N., and Sasaki, T. (2006). JRAB/MICAL-L2 is a junctional Rab13-binding protein mediating the endocytic recycling of occludin. Mol. Biol. Cell. 17: 2465−2475. Terman, J.R., Mao, T., Pasterkamp, R.J., Yu, H.H., and Kolodkin, A.L. (2002). MICALs, a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cell 109: 887−900. Weide, T., Teuber, J., Bayer, M., and Barnekow, A. (2003). MICAL-1 isoforms, novel rab1 interacting proteins. Biochem. Biophys. Res. Commun. 306: 79−86. Westerfield, M. (2007). The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio), 5th ed. (Eugene, OR: Univ. of Oregon Press).
GENETICS AND GENOMICS J. Genet. Genomics 37 (2010) 685−693
www.jgenetgenomics.org
Identification and expression analysis of mical family genes in zebrafish Yulin Xue a, Chikin Kuok a, An Xiao a, Zuoyan Zhu a, Shuo Lin a, b, Bo Zhang a, * a
Key Laboratory of Cell Proliferation and Differentiation, Center of Developmental Biology and Genetics, College of Life Sciences, Peking University, Ministry of Education, Beijing 100871, China b Department of Molecular, Cell, and Developmental Biology, University of California, Los Angeles, Los Angeles, CA 90095-1606, USA Received for publication 27 May 2010; revised 1 July 2010; accepted 6 July 2010
Abstract Mical (molecule interacting with CasL) represent a conserved family of cytosolic multidomain proteins that has been shown to be associated with a variety of cellular processes, including axon guidance, cell movement, cell-cell junction formation, vesicle trafficking and cancer cell metastasis. However, the expression and function of these genes during embryonic development have not been comprehensively characterized, especially in vertebrate species, although some limited in vivo studies have been carried out in neural and musculature systems of Drosophila and in neural systems of vertebrates. So far, no mical family homologs have been reported in zebrafish, an ideal vertebrate model for the study of developmental processes. Here we report eight homologs of mical family genes in zebrafish and their expression profiles during embryonic development. Consistent with the findings in Drosophila and mammals, most zebrafish mical family genes display expression in neural and musculature systems. In addition, five mical homologs are detected in heart, and one, micall2a, in blood vessels. Our data established an important basis for further functional studies of mical family genes in zebrafish, and suggest a possible role for mical genes in cardiovascular development. Keywords: zebrafish; mical; micall2a; expression pattern; blood vessel; heart
Introduction MICAL (molecule interacting with CasL) was first isolated in 2002 through far-Western screening with the SH3 domain of CasL (CRK-associated Substrate-related Protein) from a human thymus cDNA library (Suzuki et al., 2002). Since then additional members of Mical-like proteins have been identified, which represent a family of large multidomain cytosolic proteins. They can be divided into two classes (sub-families), Mical and Micall (Mical-like). Mical has a flavoprotein monooxygenase (MO) domain in its * Corresponding author. Tel & Fax: +86-10-6275 9072. E-mail address: [email protected] DOI: 10.1016/S1673-8527(09)60086-2
N-terminus, a calponin-like actin-binding (CH) domain and a LIM-type (LIM) domain in the middle, and coiled-coils motifs in its C-terminus, while Micall contains similar structures with Mical except for the MO domain (Supplemental Fig. 1). In Drosophila, Mical directly links Semaphorins and their Plexin receptors, and controls F-actin dynamics during axon guidance via its redox activity (Hung et al., 2010). Drosophila Mical was also reported to regulate myofilament organization (Beuchle et al., 2007), synaptogenesis (Beuchle et al., 2007) and dendrite pruning (Kirilly et al., 2009). Human MICAL1 was reported to form protein scaffold for Golgi apparatus and intermediate filament cytoskeleton with RAB1 (Weide et al., 2003). Knocking down MICAL2-PV (MICAL2 prostate
686
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
cancer variants) by siRNA significantly reduces the viability of prostate cancer cells (Ashida et al., 2006). Human MICAL-L1 (MICAL-Like 1) was shown to link both EHD1 (EH-domain containing 1) and RAB8a to tubular membranes (Sharma et al., 2009). Mical-like was also found in parasites excretory-secretory products during host-parasite immune interactions between snail and trematode (Guillou et al., 2007). In mice, MICALL2 could mediate the endocytic recycling of Occludin in tight junctions of MTD-1A cells (a cell line derived from mouse epithelial cells) (Terai et al., 2006; Nakatsuji et al., 2008; Nishimura and Sasaki, 2008a, 2008b, 2009) and transfer Actinin-4 from the cell body to the tips of neurites (Sakane et al., 2010) through binding to Rab13. So far, functional studies of Mical family have mainly been conducted in invertebrate embryos and adult tissues, as well as in vitro vertebrate culture cells. Their biological significance for vertebrate development remains largely elusive. Systematic in vivo study of Micals’ function is highly desirable, and zebrafish (Danio rerio) could be an ideal model organism for this purpose due to its advantage in combining embryological analysis and genetic approaches, especially for the study of vasculature development. However, no mical homologs in zebrafish have been reported to date. Mammals and flies have five and two distinct Mical family members, respectively, including Mical1, Mical2, Mical3, Micall1, Micall2 for mammals and Mical, MICALlike in Drosophila. The expression patterns of Mical family genes in mammals have been mainly described in adult tissues as well as in in vitro culture cells. They were detected in nervous system (Weide et al., 2003; Fischer et al., 2005; Ashida et al., 2006; Pasterkamp et al., 2006; Terai et al., 2006), and a variety of other adult tissues, including lung (Suzuki et al., 2002; Fischer et al., 2005; Ashida et al., 2006; Terai et al., 2006), kidney (Suzuki et al., 2002; Fischer et al., 2005; Ashida et al., 2006; Terai et al., 2006), liver (Fischer et al., 2005; Ashida et al., 2006; Terai et al., 2006), heart (Fischer et al., 2005; Ashida et al., 2006), muscle (Fischer et al., 2005; Ashida et al., 2006), testis (Suzuki et al., 2002), thymus (Suzuki et al., 2002), bone marrow (Ashida et al., 2006), as well as cancer cells (Ashida et al., 2006). In contrast, embryonic expression of Mical family genes has only been studied for Mical sub-family genes, which was reported to be in nervous system in rats (Terman et al., 2002; Fischer et al., 2005; Pasterkamp et al., 2006) and in nervous system and musculature in flies (Terman et al.,
2002; Beuchle et al., 2007; Kirilly et al., 2009). The expression of Mical-like sub-family genes during embryonic development has not been described. Furthermore, there is no publication concerning a complete structure and expression analysis of the entire Mical family genes in a single organism so far. Here, we report the identification of eight homologs of mical family genes in zebrafish as well as their expression patterns during embryogenesis. Our results show that, in addition to expression in nervous system and musculature, several members of mical family are expressed specifically in cardiovascular structures. Our work provides important information for mical family genes and implies new directions for their functional study.
Materials and methods Zebrafish husbandry Zebrafish was maintained at 28.5°C following standard protocol (Westerfield, 2007). Wild type Tübingen strain was used for our study.
Identification of mical family genes Reciprocal TBLASTN searches were performed on Ensembl zebrafish genome annotation database (Zv8, e57) using the longest amino acid sequences available from mammalian Mical family members (GenBank accession numbers for the BLAST listed in Supplemental Table 1 and schematic view in Supplemental Fig. 1) and candidate genes were selected according to e-value and domain analyses. The corresponding cDNA were amplified by reverse transcription PCR using Phusion high-fidelity DNA polymerase (NEB, USA). Total RNA was isolated from 24 hpf (hours post fertilization) zebrafish embryos using TRIzol (Invitrogen, USA). Two microgram of RNA was used as a template with oligo dT-primed in vitro cDNA synthesis using M-MLV reverse transcriptase (Promega, USA). The touch down PCR conditions were as follows: 1 min/98°C; 6 s/98°C, 30 s/68−54°C (Δ = –1°C), 2.5 min/72°C (15 cycles), 1 min/98°C; 6 s/98°C, 30 s/59°C, 2.5 min/72°C (25 cycles), 6 min/72°C. The primers used for amplification and the GenBank accession numbers for the corresponding cDNA sequences are listed in Table 1.
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
687
Table 1 Information of the corresponding sequences and primers used for cDNA cloning and for making probes for ISH GenBank accession No.a
Length (bp)
CCCCCACGTCGTGCCTCCGC
HM151004
2,542
AAGGGCCGGGCTGGAGGGCA
TGAGTTCCCTCCCCTCGCTGGA
HM151005
1,327
CGGTGGTGGCCCCTGTGGCT
TGCAGCAGCGCAGCCTCATCT
HM151006
3,642
Gene
Forward primer (5′→ 3′)
mical1
GGGCGCGGGTCCCTGTGGTC
mical2a mical2b
Reverse primer (5′→ 3′)
mical3a
TCAAGCCCAATGAATACC
CAGACACGCTGACACCTC
−
1,501
mcial3b
GACCCTCCGAGCCTTTCA
ACCTCTGCCCGCCAACCAAC
HM151007
0,528
micall1
TTACTGCCAGGCTCTTAC
CTTCATTCTTGGTGCTCA
HM151008
1,984
micall2a
GGGGTACCATGGCGGCTATTAAAG
GACTAGTAGCTGAGCTTCACTCTCCCATC
HM151009c
2,400
micall2b
GTCGTCCGTGGTTGAATCG
GAAGGTGGGCAAGAAAGTT
HM151010
1,794
a
b
b
The GenBank accession numbers for zebrafish mical genes submitted by us based on this work; The sequence of mical3a cloned was part of NCBI known zebrafish mical3a sequence (XM_001921641.2), thus we didn’t submit our sequence; c This is a full length coding sequence. Only micall2a and micall2b have experimental evidences for full length coding region from Mammalian Gene Collection (MGC) Project of National Institutes of Health, USA, and we confirmed the transcription intiation start site of micall2a via 5′ RACE (data not shown).
Whole mount ISH was performed as described previously (Jowett and Lettice, 1994). The sequences in Table 1 were used as templates in in vitro transcription for ISH. Embryos were fixed by 4% paraformaldehyde solution for more than 24 h at 4°C and stored at –20°C in alcohol. The stages were chosen as follows: 1-cell stage, 1k-cell stage, 50% epiboly stage, tail bud stage, 6-somite stage, 18-somite stage, 24 hpf, 1.5 dpf (days post fertilization), 2 dpf and 3 dpf. Embryos older than 24 hpf were treated with 0.003% phenylthiourea (PTU) to prevent the development of pigments. RNA antisense probes were generated by in vitro transcription via T3 or T7 RNA polymerase (Promega) with DIG RNA labeling mixture (Roche, Germany) and then purified by RNeasy mini kit (Qiagen, USA). All probes were developed by anti-digoxingenin-AP antibody (Roche) and BCIP/NBT color development substrate (Promega). Photographs were taken by AxioCam MRc5 CCD sensor and AxioVision AC software (Zeiss, Germany).
and the sequence is from NCBI, LOC566850 (XP_695229.3) which is an annotated sequence from zebrafish genome.). The alignment was performed by ClustalX software (version 1.83). The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The bootstrap consensus tree inferred from 1,000 replicates (Felsenstein, 1985) was taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) were shown next to the branches (Felsenstein, 1985). The evolutionary distances were computed using the JTT matrix-based method (Jones et al., 1992) and were in the units of the number of amino acid substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 95 positions in the final dataset. Phylogenetic analyses were conducted in MEGA4 (Tamura et al., 2007).
Sequence alignment and construction of phylogenetic tree
Results
In situ hybridization (ISH)
CH domains were acquired by Pfam (Finn et al. 2010) analysis. The accession numbers for human Mical family members are listed in Supplemental Table 1. The sequences of zebrafish mical family members used for these analyses are mostly based on our sequences obtained from cDNA cloning in Table 1 (Mical3b is the only exception
Identification of zebrafish mical family genes We have obtained a blood vessel-specific GFP (Green Fluorescent Protein) expression transgenic line, ET(zgc55358:EGFP) (Supplemental Fig. 2), from a large-scale enhancer trap screen mediated by Tol2 trans-
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
688
poson in zebrafish. The Tol2 insertion site was mapped to the 1st intron of zgc:55358 that was renamed as micall2 in Ensembl Zv7 assembly. Whole mount ISH result showed that micall2 is specifically and strongly expressed in blood vessels in zebrafish embryos, which faithfully recapitulate the GFP expression pattern in the transgenic line (Supplemental Fig. 2 and see below). To our knowledge, this is the first observation of mical family members being expressed in blood vessels, which may imply a novel function of mical family genes in vascular development. Before probing into the functional aspects of micals in vasculature development, we wonder whether any other zebrafish mical family members share similar expression patterns with that of zgc:55358/micall2. However, there is neither any previous report on mical family homologs in zebrafish, nor publications concerning the structure and expression of the entire mical family genes in a single organism. Not surprisingly, the records for zebrafish micals in both NCBI and Ensembl databases are incomplete and the whole family is poorly annotated (Table 2, columns 2 and 3, marked by “#”). By reciprocal TBLASTN search, five mical homologous regions being located on Chr. (chromosome) 4, 7, 18, 23, 25, and four mical-like homologous regions on Chr. 1, 3, 6, 16 (Table 2, column 5), were obtained, respectively. We found that the candidate homologous re-
gion on Chr. 16 has 100% identity with the one on Chr. 3, but unlike Chr. 3, no syntenic relations could be detected on this region compared with mammalian orthologs. Therefore, we believe that the genomic fragment corresponding to the micall2a candidate on Chr. 16 was mis-annotated, and there is only one micall2a in the current genome assembly. For the rest of the candidate homologs, we noticed that there are two candidate homologous genes annotated in each of the chromosomes 6, 18 and 23, and three candidate homologous genes annotated in chromosome 25 (Table 2), while BLAST results show that these separate genes within the same chromosome could actually be different regions of one single gene (Supplemental Fig. 3 showed one example). To verify the BLAST results, we cloned partial cDNA fragments of the corresponding candidate genes as well as the seemingly intergenic regions via RT-PCR. The results clearly confirmed the BLAST results and indicate that the separate candidate genes in the same chromosome should indeed be integrated/combined into one single mical family homologous gene (Tables 1 and 2). Through the above analyses, we conclude that we have collected and clarified all the zebrafish mical family genes currently available, which contain five mical homologs and three micall homologs, respectively (Table 2, column 1).
Table 2 A summary on mical family genes in zebrafish Nomenclature
NCBI gene symbol
Ensembl gene name
Ensembl transcript ID
Genomic location
mical1
zgc:171928
zgc:171928
ENSDART00000031616
Chr. 23
$
ENSDART00000037315
Chr. 23
mical2a
LOC569607
(unnamed)
LOC569607
ENSDART00000082679
Chr. 7
mical2b
sb:cb94
sb:cb94
ENSDART00000091531
Chr. 25
–
(unnamed) $
ENSDART00000112712
Chr. 25
LOC569564
A2CEA1_DANRE
ENSDART00000026069
Chr. 25
mical3a
mical3
mical3
ENSDART00000028938
Ch.r 18
ENSDART00000101026
Chr. 18
mical3b
LOC566850 #
si:dkey-153k10.11 #
ENSDART00000014496
Chr. 4
micall1
LOC100149741 #
MICALL1 #
ENSDART00000113911
Chr. 6
micall2a
micall2b $
$
–
(unnamed)
ENSDART00000114696
Chr. 6
micall2 #
micall2 #
ENSDART00000074591
Chr. 3
LOC100002833 #
MICALL2 (2 of 3) #
ENSDART00000020557
Chr. 16 @
zgc:55983 #
zgc:55983
ENSDART00000008682
Chr. 1
These sequences do not have a gene name in Ensembl database. – These sequences do not have NCBI gene symbols, but only have GenBank accession numbers. # Results by searching “mical” as keyword in corresponding database. @ This sequence was mislocated and should be removed from the zebrafish genome according to our analyses.
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
CH domain has been reported to function in signal transduction or related cytoskeleton regulation and bind to actin directly (Gimona et al., 2002). The CH domains in Mical proteins belong to type 2 CH domain (Sun et al., 2006), which cannot bind to cytoskeleton alone and functions in assisting type 1 CH domain containing proteins to bind to F-actin (Gimona et al., 2002). Type 2 CH domain also contains a PIP2 (phosphatidylinositol 4, 5-bisphosphate) binding site (Fig. 1) and this type of interaction is involved in the regulation of F-actin activity (Fukami et al., 1992). Since the CH domain is present and highly conserved in all Mical family members, we employed it for phylogenetic analysis and performed amino acid sequence alignment of Micals between zebrafish and human. The zebrafish sequences of this domain are essentially obtained from our cDNA cloning and sequencing results except for that of mical3b. The result of alignments showed that the CH do-
689
main is largely conserved from zebrafish to human (Fig. 1). We then sorted zebrafish Mical family members into existing human phylogenetic clades, with the two CH domains of Actinin-4, the first being type 1 CH and the second being type 2 CH, as external references for better distinction (Fig. 2, only the second CH domain was shown as the root). The clade revealed the presence of two distinct paralogs for each of mical2, mical3 and micall2 genes in zebrafish (Fig. 2). This could be explained by an additional genome duplication event occurred in teleost ancestors compared with tetrapod lineage (Postlethwait et al., 2000). Based on all these information, we renamed the zebrafish mical family genes as mical1, mical2a, mical2b, mical3a, mical3b, micall1, micall2a and micall2b, respectively (Table 2 and Fig. 2). The amino acid identities in CH domains of Mical family members between human and zebrafish are shown in Supplemental Table 2.
Fig. 1. The CH domains from zebrafish Mical family proteins show high similarities with their human homologs. Colors indicate the conserved amino acid residues. PIP2 binding site is indicated by a black bar. The GenBank accession numbers for the five human Micals used for the alignment analysis are as follows: NP_073602.3 (MICAL1 iso b), NP_055447.1 (MICAL2), NP_056056.2 (MICAL3 iso c), NP_203744.1 (MICALL1), NP_891554.1 (MICALL2).
690
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
Fig. 2. Classification of zebrafish Micals by phylogenetic analysis with their human homologs. The GenBank accession numbers for the five human MICALS used for the phylogenetic analysis are as follows: NP_073602.3 (MICAL1 iso b), NP_055447.1 (MICAL2), NP_056056.2 (MICAL3 iso c), NP_203744.1 (MICALL1), NP_891554.1 (MICALL2).
Expression pattern analysis of zebrafish mical genes To analyze the expression patterns of these mical family genes in zebrafish, we performed ISH using antisense ribo-probes made from the cDNA sequences we have cloned by RT-PCR (Table 1). We focused our expression analysis on the first 3 days of embryonic development, during which the formation of most organs has been initiated and established (Kimmel et al., 1995). The results show that only micall2a distributed specifically in embryonic blood vessels from 4-somite stage to at least 3 dpf (Fig. 3, M and N). In addition, we also found heart expression of mical2a, mical2b, mical3a, micall2a and micall2b (Fig. 3, C–F, H, M, N and P). In detail, mical1 is expressed ubiquitously except for notochord (Fig. 3, A and B). mical2a is expressed strongly in heart from 24 hpf to 3 dpf and can be detected slightly in pharyngeal area and fin edge (Fig. 3, C and D). mical2b expression could be detected in olfactory epithelium, somite, heart, pronephric duct, anus and fin edge at 24 hpf (Fig. 3E). At 3 dpf, mical2b is expressed in olfactory epithelium, lateral line, pectoral fin bud and heart (Fig. 3F). mical3a shows specific expression pattern from bud stage in notochord (data not shown). Later on at 24
hpf, it is expressed strongly in the entire brain, somite and anus (Fig. 3G). At 2 dpf, it can be detected in the entire brain as well as eye cup, pectoral fin bud, heart and part of common cardinal vein. At 3 dpf, the expression of mical3a is similar to but not as strong as that at 2 dpf (Fig. 3H). mical3b is expressed in two small nerve nuclei around ear at 24 hpf (Fig. 3I) and in nerve nuclei of ventral diencephalon and hindbrain from 1.5 dpf to 3 dpf (data not shown and Fig. 3J). Unlike all the other micals, mical3b also show specific expression in spinal cord neurons as well as the floor plate from 2 dpf (data not shown and Fig. 3J). For mical-like genes, the expression of micall1 begins from shield stage at shield region (data not shown). However, it becomes ubiquitously expressed in yolk syncytial layer at bud stage (data not shown). At 24 hpf, it is mainly detected in brain and skin (Fig. 3K). At 2 dpf, its expression becomes focused on the entire brain, pectoral fin bud and pharyngeal arch (data not shown). Slight staining could also be detected in pronephric duct and yolk syncytial layer (data not shown). Interestingly, at 3 dpf, a strong signal at the position corresponding to thyroid gland could be detected in addition to the expression patterns found in 2 dpf embryos (Fig. 3L). The expression of mi-
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
call2a is only seen in vasculature at 24 hpf (Fig. 3M). At 3 dpf, it shows additional expression in lateral line besides the whole blood vessel system (Fig. 3N). The expression of micall2b is mainly in central nervous system in 24 hpf
691
embryos (Fig. 3O) and becomes restricted to brain since 1.5 dpf (data not shown). At 3 dpf, its expression could be detected in brain, heart, pectoral fin and the opening of anus (Fig. 3P).
Fig. 3. The expression patterns of zebrafish mical genes. The embryos are shown anterior to the left and dorsal to the top, unless otherwise stated. A and B, C and D, E and F, G and H, I and J, K and L, M and N and O and P correspond to mical1, mical2a, mical2b, mical3a, mical3b, micall1, micall2a and micall2b expression patterns at 24 hpf and 3 dpf, respectively. The arrow in H shows common cardinal vein. The arrow in L shows the position of thyroid gland. All arrowheads point to heart. The insets in C and E show anterior view, in J and I show dorsal view, and the insets in D, F and H show ventral view. The inset in C shows dorsal to the top and in E shows dorsal to the right. For better view, the embryo was tilted a little bit towards its side.
692
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
Discussion We have identified eight mical family genes in zebrafish, including each of the two paralogs for mical2, mical3 and micall2, based on current database analysis and molecular cloning. Since human has only five MICAL family genes, the excess in the number of mical homologs in zebrafish could possibly be explained by the additional genome duplication event occurred in teleost ancestors relative to tetrapod lineage (Postlethwait et al., 2000). In the view of evolution, duplication could result in new loci with novel functions and is considered as one way to achieve evolution progress. Thus, the two paralogs of some of these genes might indicate their novel functions in zebrafish. In fruitfly, Mical gene was reported to be mainly expressed in nervous system and musculature, functioning in axon guidance, myofilament organization and synaptogenesis (Terman et al., 2002; Fischer et al., 2005; Terai et al., 2006; Beuchle et al., 2007; Kolk and Pasterkamp, 2007). For the expression of Mical family genes in mammals, only rodent Mical sub-family genes have been studied during embryogenesis and they were reported to be expressed in nervous system (Terman et al., 2002; Pasterkamp et al., 2006). Through Northern blot and Western blot, some Mical family genes were also detected in mammalian adult tissues including brain, spinal cord, lung, liver, kidney, muscle, heart, thymus, spleen, testis, as well as in hematopoietic cells and certain cancer cells (Suzuki et al., 2002; Ashida et al., 2006; Terai et al., 2006). However, no blood vessel expression has been reported so far, and the information on their expression during embryogenesis is also limited. Here we report for the first time that micall2a is expressed specifically in zebrafish blood vessels. Our work implies a potential role for micall2 in blood vessel development and/or physiological process. In addition, since Drosophila Mical (Hung et al., 2010), human MICALL1 (Sharma et al., 2009) and mouse Micall2 (Terai et al., 2006; Sakane et al., 2010) were all reported to be associated with actin cytoskeleton and could initiate cell morphology changes, the expression of mical2a, mical2b, mical3a, micall2a and micall2b in heart also indicates possible functions for Micals in heart contraction. Other members of zebrafish mical family genes exhibit neuronal and musculature expressions which is similar to their mammalian and Drosophila homologs, indicating their potential roles in myofilament organization and synaptogenesis (Beuchle et al., 2007). The function of
micall1 in thyroid gland region needs to be elucidated in the future. Zebrafish, as one of the ideal vertebrate model organisms for the research of developmental biology, its ex vivo fertilization, transparency embryos, the ease of morpholino-mediated gene knockdown and transposon-mediated transgenic tools all facilitate genetic studies of developmental processes in live embryos. More detailed functions and mechanisms of mical family genes and their counterparts can be expected to be revealed by further in-depth studies in zebrafish.
Acknowledgements This work was supported by National Natural Science Foundation of China (Nos. 30721064 and 30730056, 30620120101) as well as National Basic Research Program of China (973 Program) (Nos. 2005CB522504, 2006CB943801 and 2007CB914502). We thank Xi Ren and Fei Qi for helpful discussion. We also thank Chuanyun Li for help in bioinformatic analysis, Yuying Gao, Ying Zhang, Jiao Zhang for technical support and Yingdi Jia, Jingliang Chen, Houhua Cui for zebrafish husbandry.
Supplemental data Supplemental Figs. 1–3 and Tables 1–2 associated with this article can be found in the online version at www.jgenetgenomics.org.
References Ashida, S., Furihata, M., Katagiri, T., Tamura, K., Anazawa, Y., Yoshioka, H., Miki, T., Fujioka, T., Shuin, T., Nakamura, Y., and Nakagawa H. (2006). Expression of novel molecules, MICAL2-PV (MICAL2 prostate cancer variants), increases with high Gleason score and prostate cancer progression. Clin. Cancer Res. 12: 2767−2773. Beuchle, D., Schwarz, H., Langegger, M., Koch, I., and Aberle, H. (2007). Drosophila MICAL regulates myofilament organization and synaptic structure. Mech. Dev. 124: 390−406. Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783−791. Finn, R.D., Mistry, J., Tate, J., Coggill, P., Heger, A., Pollington, J.E., Gavin, O.L., Gunasekaran, P., Ceric, G., Forslund, K., Holm, L., Sonnhammer, E.L., Eddy, S.R., and Bateman, A. (2010). The Pfam protein families database. Nucleic Acids Res. 38: D211−D222.
Yulin Xue et al. / Journal of Genetics and Genomics 37 (2010) 685−693
Fischer, J., Weide, T., and Barnekow, A. (2005). The MICAL proteins and rab1: a possible link to the cytoskeleton? Biochem. Biophys. Res. Commun. 328: 415−423. Fukami, K., Furuhashi, K., Inagaki, M., Endo, T., Hatano, S., and Takenawa, T. (1992). Requirement of phosphatidylinositol 4,5-bisphosphate for alpha-actinin function. Nature 359: 150−152. Gimona, M., Djinovic-Carugo, K., Kranewitter, W.J., and Winder, S.J. (2002). Functional plasticity of CH domains. FEBS Lett. 513: 98−106. Guillou, F., Roger, E., Mone, Y., Rognon, A., Grunau, C., Theron, A., Mitta, G., Coustau, C., and Gourbal, B.E. (2007). Excretory-secretory proteome of larval Schistosoma mansoni and Echinostoma caproni, two parasites of Biomphalaria glabrata. Mol. Biochem. Parasitol. 155: 45−56. Hung, R.J., Yazdani, U., Yoon, J., Wu, H., Yang, T., Gupta, N., Huang, Z., van Berkel, W.J., and Terman, J.R. (2010). Mical links semaphorins to F-actin disassembly. Nature 463: 823−827. Jones, D.T., Taylor, W.R., and Thornton, J.M. (1992). The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8: 275−282. Jowett, T., and Lettice, L. (1994). Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein-labelled probes. Trends Genet. 10: 73−74. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., and Schilling, T.F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203: 253−310. Kirilly, D., Gu, Y., Huang, Y., Wu, Z., Bashirullah, A., Low, B.C., Kolodkin, A.L., Wang, H., and Yu, F. (2009). A genetic pathway composed of Sox14 and Mical governs severing of dendrites during pruning. Nat. Neurosci. 12: 1497−1506 Kolk, S.M., and Pasterkamp, R.J. (2007). MICAL flavoprotein monooxygenases: structure, function and role in semaphorin signaling. Adv. Exp. Med. Biol. 600: 38−51. Nakatsuji, H., Nishimura, N., Yamamura, R., Kanayama, H.O., and Sasaki, T. (2008). Involvement of actinin-4 in the recruitment of JRAB/MICAL-L2 to cell-cell junctions and the formation of functional tight junctions. Mol. Cell. Biol. 28: 3324−3335. Nishimura, N., and Sasaki, T. (2008a). Cell-surface biotinylation to study endocytosis and recycling of occludin. Methods Mol. Biol. 440: 89−96. Nishimura, N., and Sasaki, T. (2008b). Identification and characterization of JRAB/MICAL-L2, a junctional Rab13-binding protein. Methods Enzymol. 438: 141−153. Nishimura, N., and Sasaki, T. (2009). Rab family small G proteins in
693
regulation of epithelial apical junctions. Front. Biosci. 14: 2115−2129. Pasterkamp, R.J., Dai, H.N., Terman, J.R., Wahlin, K.J., Kim, B., Bregman, B.S., Popovich, P.G., and Kolodkin, A.L. (2006). MICAL flavoprotein monooxygenases: expression during neural development and following spinal cord injuries in the rat. Mol. Cell. Neurosci. 31: 52−69. Postlethwait, J.H., Woods, I.G., Ngo-Hazelett, P., Yan, Y.L., Kelly, P.D., Chu, F., Huang, H., Hill-Force, A., and Talbot, W.S. (2000). Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res. 10: 1890−1902. Saitou, N., and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406−425. Sakane, A., Honda, K., and Sasaki, T. (2010). Rab13 regulates neurite outgrowth in PC12 cells through its effector protein, JRAB/MICAL-L2. Mol. Cell. Biol. 30: 1077−1087. Sharma, M., Panapakkam Giridharan, S.S., Rahajeng, J., Naslavsky, N., and Caplan, S. (2009). MICAL-L1 links EHD1 to tubular recycling endosomes and regulates receptor recycling. Mol. Bio. Cell. 24: 5181−5194. Sun, H., Dai, H., Zhang, J., Jin, X., Xiong, S., Xu, J., Wu, J., and Shi, Y. (2006). Solution structure of calponin homology domain of human MICAL-1. J. Biomol. NMR 36: 295−300. Suzuki, T., Nakamoto, T., Ogawa, S., Seo, S., Matsumura, T., Tachibana, K., Morimoto, C., and Hirai, H. (2002). MICAL, a novel CasL interacting molecule, associates with vimentin. J. Biol. Chem. 277: 14933−14941. Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596−1599. Terai, T., Nishimura, N., Kanda, I., Yasui, N., and Sasaki, T. (2006). JRAB/MICAL-L2 is a junctional Rab13-binding protein mediating the endocytic recycling of occludin. Mol. Biol. Cell. 17: 2465−2475. Terman, J.R., Mao, T., Pasterkamp, R.J., Yu, H.H., and Kolodkin, A.L. (2002). MICALs, a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cell 109: 887−900. Weide, T., Teuber, J., Bayer, M., and Barnekow, A. (2003). MICAL-1 isoforms, novel rab1 interacting proteins. Biochem. Biophys. Res. Commun. 306: 79−86. Westerfield, M. (2007). The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio), 5th ed. (Eugene, OR: Univ. of Oregon Press).