Mitochondrial topoisomerases and alternative splicing of the human TOP1mt gene

Biochimie 89 (2007) 474e481 www.elsevier.com/locate/biochi

Mitochondrial topoisomerases and alternative splicing of the human TOP1mt gene Hongliang Zhang, Ling-Hua Meng, Yves Pommier* Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bldg 37, Room 5068, Bethesda, MD 20892-4255, USA Received 26 September 2006; accepted 7 November 2006 Available online 27 November 2006

Abstract Mitochondria are the only organelles containing metabolically active DNA besides nuclei. By analogy with the nuclear topoisomerases, mitochondrial topoisomerase activities are probably critical for maintaining the topology of mitochondrial DNA during replication, transcription, and repair. Mitochondrial diseases include a wide range of defects including neurodegeneracies, myopathies, metabolic abnormalities and premature aging. Vertebrates only have one known specific mitochondrial topoisomerase gene (TOP1mt), coding for a type IB topoisomerase. Like the mitochondrial DNA and RNA polymerase, the TOP1mt gene is encoded in the nuclear genome. The TOP1mt gene possesses the 13 exon Top1B signature motif and codes for a mitochondrial targeting signals at the N-terminus of the Top1mt polypeptide. This review summarizes our current knowledge of mitochondrial topoisomerases (type IA, IB and type II) in eukaryotes including budding and fission yeasts (Saccharomyces cerevisiae and Schizosaccharomyces pombe) and protozoan parasites (kinetoplastidiae and plasmodium). It also includes new data showing alternative splice variants of human TOP1mt. Ó 2006 Elsevier Masson SAS. All rights reserved. Keywords: Mitochondrial DNA (mtDNA); Mitochondrial topoisomerase; Top1; Top2; Top3a; Alternative splicing; Dual localization

1. Introduction DNA topoisomerases are ubiquitous enzymes that control the topology of DNA by cutting and resealing one or two strands of DNA double helices, thereby allowing DNA stands or double helices to pass though or rotate around each other [1,2]. DNA topoisomerases monitor, modify, and maintain the proper topology of DNA during replication, transcription, recombination, and repair. They have also been implicated in apoptotic DNA degradation [3,4], and a variety of topoisomerase inhibitors are commonly used as anti-infectious [5] and anti-cancer agents [6e8].

Abbreviations: MTS, mitochondrial targeting signal; NLS, nuclear localization signal. * Corresponding author. Tel.: þ1 301 496 5944; fax: þ1 301 402 0752. E-mail address: [email protected] (Y. Pommier). 0300-9084/$ - see front matter Ó 2006 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.biochi.2006.11.002

Human cells contain six topoisomerases: two type IA, two type IB, and two type IIA; each enzyme being coded by a different gene. Type I topoisomerases cleave and religate one strand of DNA at a time, whereas type II enzymes catalyze the cleavage-religation of two strands of the DNA duplex in concert. Type II enzymes function as homodimers and require ATP for catalysis. Higher eukaryotes contain two type IIA enzymes: Top2a and Top2b [1,2]. Type IIB enzymes are the sole type II topoisomerases present in most archaea, but they are never found in bacteria or in eukaryotes other than higher plants [9]. The subclassification of type I enzymes in type IA and IB is based on the polarity of the cleavage reaction and the relaxation mechanism [1,2]. Type IB enzymes cleave the DNA by transesterification and covalent binding of their catalytic tyrosines to the 30 -end of the DNA breaks. They relax DNA by controlled rotation [1,2,6]. By contrast, type IA enzymes have an opposite polarity with covalent linkage to the 50 -end of the broken DNA and DNA relaxation by strand passage

H. Zhang et al. / Biochimie 89 (2007) 474e481

475

like the type II enzymes. The human type IA enzymes are Top3a and Top3b and the type IB enzymes are Top1 and mtTop1. A major focus of topoisomerase research has been on nuclear DNA topoisomerases [1,2]. However, mitochondria also contain their own DNA. Mitochondria are essential organelles that produce most of the cellular energy, and mitochondrial defects lead to a variety of human diseases including myopathies, neurodegeneracies, diabetes, progeria (early aging), and cancers [10,11]. The current article reviews the known mitochondrial topoisomerases and presents novel data showing alternative splicing of the human mitochondrial topoisomerase I gene (TOP1mt). 2. Mitochondrial DNA (mtDNA) Mitochondrial DNA (mtDNA) fibers were first seen by electron microscopy in chick embryo [12]. Different organisms harbor mtDNA molecules with different shapes (circular or linear) and sizes (ranging from 16,569 base pairs [bp] in humans to 366,924 bp in Arabidopsis thaliana), and use different genetic codes and gene organization such as compact intron-less genomes, or genes with introns, intronic open reading frames (ORFs), pseudogenes, and fragments of foreign DNA. Animals, especially vertebrates, tend to have the simplest organization. Vertebrate mtDNA molecules represent approximately 5% of the total cellular DNA content. They are typically around 16 kbp in size and consist of intron-less genes, compactly arranged and coded on both DNA strands. Each mtDNA circle codes for 13 proteins, 22 tRNAs, and 2 rRNAs [13]. The 13 proteins are: the subunits 1, 2, and 3 of cytochrome oxidase, the subunits 6 and 8 of Fo ATP synthase, the apocytochrome b subunit of CoQH2-cytochrome c reductase, and the seven NADH-CoQ reductase subunits (www. mitomap.org). Each human cells contain approximately 1000e5000 mtDNA molecules [14]. Mitochondrial DNA is packaged in protein-DNA complexes named nucleoids [15] in association with mtTFA, an histone-like protein [16]. In the budding yeast Saccharomyces cerevisiae, each mitochondrial genome is approximately 85,000 bp long [17], and each mitochondria contains 50e100 mtDNA genome copies that are maintained as an heterogeneous mixture of linear concatemers, branched and circular molecules [18]. The circular molecules can be resolved as relaxed and supercoiled on two-dimensional gels. Abf2p, the ortholog of mtTFA, is the yeast histone-like protein [19]. 2.1. Transcription of mtDNA Based on differential centrifugation mobility in isopycnic alkaline cesium chloride gradients, the two strands of mtDNA have been designated as Heavy (H) and Light (L) (Fig. 1), because of a bias for purines in the H strand (53.2%) [20]. Unlike the nuclear genome, which is transcribed by the cooperative activity of three multi-subunit RNA polymerase enzymes, transcription of human mtDNA is accomplished by a single

Fig. 1. Human mitochondrial DNA (mtDNA) in D-loop form. OH, H-strand origin; OL, L-strand origin; HSP, major H-strand promoter; LSP, L-strand promoter. The numbers in the map correspond to the nucleotide positions (www.mitomap.org).

RNA polymerase encoded in the nuclear genome [21]. Mammalian mtDNA transcription initiates from two transcription start sites (LSP and HSP) for transcription of the light and heavy strands, respectively. Both start sites are located in close proximity to the control region of mammalian mtDNA (Fig. 1). In human mtDNA, h-mtTFA demarcates mitochondrial promoter locations. The h-mtTFB protein bridge the C-terminal tail of h-mtTFA and mtRNA polymerase to direct the specific initiation of transcription [22]. Transcripts from both strands are single, long, polycistronic mRNAs corresponding to the entire mtDNA circle. Short transcripts from the LSP serve as primers for DNA replication. 2.2. Replication of mtDNA Two models for mtDNA replication have been proposed. Initially, replication was proposed to proceed asynchronously for each strand of the mtDNA genome by strand-displacement. In this model [23], mammalian mtDNA replicates assymetrically using a single polymerase, DNA polymerase g, encoded by the nuclear genome. Replication of the leading strand initiates at the origin of the heavy (H)-strand synthesis (OH) (Fig. 1) using the processed short RNA from LSP as primer and proceeds unidirectionally, displacing the parental H-strand as single-stranded DNA. After this displacement proceeds for a distance of about two-thirds around the genome, the origin of light (L)-strand synthesis (OL) is then exposed (Fig. 1). Primase makes an RNA primer for the L-strand synthesis, and polymerase g finishes the replication in the opposite direction. This asynchronous model has been challenged recently [24,25] by a bidirectional, strand-coupled or synchronous model of replication. Strand-coupled replication initiates bidirectionally within a broad area beyond the simple D-loop. Although initially bidirectional, replication is effectively unidirectional for the most part, owing to the close proximity

476

H. Zhang et al. / Biochimie 89 (2007) 474e481

of the origin and the terminus. Early arrest of one replication fork occurs at a termination site near OH. 3. Vertebrate TOP1mt Both DNA replication and transcription create topological constraints as the two strands of mtDNA need to be separated when the DNA and RNA polymerases move along mtDNA circles. Moreover, catenanes are likely to arise from the replication of supercoiled mtDNA. The existence of such topological problems led to the search and identification of mitochondrial topoisomerase activities. 3.1. Human Top1mt Mammalian mitochondrial topoisomerase activities were first identified approximately 20 years ago. Top1 activity was found in human, rat, and bovine cells [26e29]. However, the small amount of mitochondrial Top1 proteins impaired the ability to purify and sequence the corresponding polypeptides. As we searched the National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov) database approximately 5 years ago, we found a novel human Top1 cDNA sequence, which we cloned and expressed as a recombinant polypeptide [30]. The corresponding polypeptide had the same catalytic domains (core, linker and C-terminal domain containing the catalytic tyrosine) (Fig. 2). The main difference with the previously identified Top1 [31] was in the N-terminal domain, which was much shorter in the novel Top1 protein (Fig. 2). Using green fluorescence (GFP)-tagged polypeptides, we showed that the new recombinant protein localizes to mitochondria [30]. We also demonstrated that its N-terminus contains a mitochondrial targeting sequence [30]. This discovery demonstrated that mtDNA uses a specific mitochondrial type I topoisomerase [30] whose gene is encoded in the nuclear genome, as are the mitochondrial DNA and RNA polymerase genes. As our discovery of the Top1mt gene preceded shortly the publication of the human genome [32], we had to use cytogenetic analyses to map the human TOP1mt gene to chromosome 8q24.3.

Discovery of the Top1mt implies that the previously discovered Top1 [1,31], which contains nuclear localization signals (Fig. 1), is restricted to the nuclear genome. However, the nomenclature was left unchanged, and it has to be understood that Top1 in vertebrates refers to the nuclear Top1. Expression of recombinant enzymes and comparison between the mitochondrial and nuclear Top1 enzymes showed biochemical differences. Top1mt requires alkaline pH (around 8) and divalent cations (Ca2þ or Mg2þ) for optimal catalytic activity, whereas nuclear Top1 is active in the absence of divalent cations, and most active at neutral pH [30], consistent with the known basic and neutral pH for the mitochondrial and nuclear compartments. Like nuclear Top1, Top1mt is a type IB enzyme [2], as it liberates a free 30 end-labeled DNA fragment following incubation with a double-stranded oligonucleotide substrate [30]. Like nuclear top1, recombinant Top1mt is also sensitive to camptothecin, a potent anticancer drug [6]. 3.2. Conservation of the 13 exon signature motif among vertebrate TOP1mt genes Using Hs-TOP1mt gene as bait, we have identified mitochondrial TOP1 genes in the mouse, rat, chicken, and zebra fish genomes (Fig. 3) [33]. All five vertebrate TOP1mt genes comprise 14 exons. The size of the exons for the five vertebrate TOP1mt genes varies for the first exon but is identical for the remaining 13 exons, with minor exceptions for exons 2 and 13 in rodents, which are 3 bp shorter (corresponding to a one-amino acid deletion and a likely a characteristic of the common rodent ancestor). Similarly, we had previously found that the rodent nuclear TOP1 gene encodes a polypeptide highly similar to the human gene except for 2 additional amino acids in the N-terminal domain [34,35]. The first exon of the TOP1mt genes all encode mitochondrial localization signals. However, they share little homology with each other [33]. By contrast, alignment of the last 13 exons of both nuclear and mitochondrial topoisomerases I genes reveals a high degree of conservation between the nuclear and mitochondrial TOP1 genes. We proposed to refer to the topoisomerase 13exons motif as the 13 exon Top1 signature [33]. Accordingly, the catalytic residues, including the critical basic amino acids (RKR)

Fig. 2. Schematic structure of Top1mt vs. Top1 (nuclear). Catalytic tyrosines in the C-terminal domain (CTD) are indicated as arrowheads. Other catalytic residues are indicated with open triangles. The identities and similarities are indicated for each domain. MTS, mitochondrial targeting sequence; NLS, nuclear localization signals.

H. Zhang et al. / Biochimie 89 (2007) 474e481

477

encoded by vertebrates, it is plausible that the non-vertebrate TOP1 genes encodes enzymes that have a dual localization for the nuclear and the mitochondrial genomes [36]. The TOP1 gene from the chordate sea squirt, Ciona intestinalis is the closest relative to vertebrate TOP1 genes, suggesting that the two vertebrate TOP1 genes (nuclear and mitochondrial) derived from a common ancestor for the vertebrates and chordates (Fig. 3) [33]. Also, the similarities of the 13 exons among all the vertebrate TOP1 genes and the divergence of their exons [33] suggest that the two vertebrate TOP1 genes (mitochondrial and nuclear) have derived from evolutionary duplication of a single ancestral gene that may have been closely related to the chordate TOP1 gene. 3.3. Alternative splicing of the human TOP1mt gene

Fig. 3. Phylogenic tree of mitochondrial and nuclear type IB topoisomerases. The comparison is based on the core, linker, and C-terminal region (cf. Fig. 2). Hs, Homo sapiens; Rn, Rattus norvegicus; Mm, Mus musculus; Gg, Gallus gallus; Dr, Danio rerio; Ci, Ciona intestinalis; Dm, Drosophila melanogaster; Ce, Caenorhabditis elegans; Sp, Schizosaccharomyces pombe; Sc, Saccharomyces cerevisiae; At, Arabidopsis thaliana; Os, Oryza sativa. Bar indicates the scale for 10% dissimilarity between amino acid sequences.

and tyrosine residue (Y), are all conserved across mitochondrial and nuclear Top1 enzymes (Fig. 2) [33]. Phylogenic analysis of the mitochondrial and nuclear TOP1 genes based on the 13-exon signature shows three main clusters, corresponding to the five vertebrate TOP1mt, the corresponding five vertebrate nuclear TOP1, and the non-vertebrate type IB topoisomerases (Fig. 3). Since non-vertebrates contain only one type IB topoisomerase gene instead of the two TOP1 genes

Alternative splicing is a versatile form of genetic control whereby a common pre-mRNA is processed into different mRNA isoforms differing in their precise combination of exon sequences. Alternatively spliced mRNAs usually generate diversified proteins. In our experiments (presented for the first time in Fig. 4), two main alternatively spliced forms of Top1mt mRNA, named 1A and 1B, were found in addition to the main form (N in Fig. 4). Both alternatively spliced transcripts have a stop codon near their 50 -terminal end, indicating that their translation should produce truncated peptides without functional topoisomerase activity. A minor form of alternative splicing 1B (198 bp PCR fragment in Fig. 4) may produce a 57-amino-acid insert into the regular Top1mt between amino acids 41 and 42, corresponding to a potential 658-amino-acid Top1mt variant. By reverse transcriptionepolymerase chain reaction (RTe PCR), we investigated the Top1mt transcripts in normal and

Fig. 4. Alternative splicing of human Top1mt. (A) Diagram showing the first two exons (exon 1: 141 bp, and exon 2: 116 bp) and the optional exons 1a (178 bp) and 1b (171 bp for the long form and 115 bp for the short form). The numbers above the diagram indicate the corresponding amino acids. The numbers at the bottom give the corresponding nucleotide position in the TOP1mt gene. Position 1 corresponds to the first nucleotide in mRNA. The curved lines show the four splicing patterns. The short arrows beneath exons represent the PCR primers used in the experiments. Their sequences are: 1 Forward (1F): CAGGACGCA GAAGGGCAGTGGAGC; 1a Reverse (1aR): CAGTGAGGCTGTCAACTCTCCAGC; 1b Reverse (1bR): CTGCCAGAGCCAGGAGACCTGCAC; 2 Reverse (2R): CTTCATAGAAGAAACGCACTCCGTC. (B) PCR products observed with the three primer combinations shown in panel A. N (normal) is the most common splicing from exon 1 to exon 2 (GenBank: NM_052963) [30]. The PCR product is a 143 bp long DNA fragment from primer 1F and 2R. Splicing 1A is the result of splicing exon 1 to the optional exon 1a and then to exon 2. The PCR product is a 205 bp long DNA fragment from primer 1F and 1aR (see panel A). Splicing 1B is the result of splicing exon 1 to the optional exon 1b, and then exon 2. Depending on the splicing of the optional exon 1b, two PCR products are observed: 142 bp and 198 bp DNA fragments from primer 1F and 1bR. (C) Splicing pattern of renal cell carcinoma and normal adjacent tissue. G, GADPH control. (D) Splicing pattern of MCF-7 breast carcinoma cells and its camptothecin-resistant cell line MCF-7/C4 [67]. (E) Suppression of TOP1mt alternative splicing in human leukemia HL-60 cells as they differentiate into granulocyte (upon treatment with DMSO for 72 h).

478

H. Zhang et al. / Biochimie 89 (2007) 474e481

cancer tissues and different tumor cell lines (Fig. 4CeE). The alternative splicing patterns of Top1mt mRNA was found in all normal tissues examined, with an average ratio for splice variants 1A to 1B of 2.2  0.7. Alternative splice variants appeared more frequent in a renal cell carcinoma compared to normal adjacent tissue (Fig. 4C). We also compared the splicing patterns in camptothecin-resistant cells with reduced activity of the nuclear Top 1 compared to the parental cells. The expression of Top1mt was not affected and the alternative splicing patterns did not change dramatically (Fig. 4D and data not shown). During DMSO-induced differentiation of human promyelocytic leukemia HL-60 cells, alternative splicing tends to decrease (Fig. 4E). This effect is probably related to differentiation rather than to DMSO itself as such changes are not observed in DMSO-treated DU-145 human prostate cells that do not differentiate in response to DMSO. These observations demonstrate that alternative splicing of Top1mt is unrelated to the status of nuclear Top1 but might be correlated with tumor progression and differentiation. Further studies are warranted to establish whether alternative splicing of Top1mt is a regulatory mechanism. 3.4. Top1mt functions To investigate the function of Top1mt, we have generated an antibody against human Top1mt and molecular constructs to suppress Top1mt activity. The Top1mt-specific antibody (Zhang and Pommier, unpublished) allows us to show that camptothecin traps mtDNA-Top1mt cleavage complexes both in purified mitochondria and in whole cells (Zhang and Pommier, unpublished data). These results indicate that Top1mt is actively associated with mtDNA and exhibits nicking-closing activity. To map the Top1mt sites in mtDNA, we have developed PL-PCR (phosphate linker ligation mediated PCR) method. Recent results (to be published separately) indicate functional differences between the Top1mt sites in the mtDNA of intact mitochondria and in purified mtDNA. These results suggest the importance of mitochondrial cofactors to direct the sites of Top1mt activity. We have successfully generated TOP1mt knockout mice. The knockout mice are viable and studies are ongoing to determine their phenotype. 4. Mitochondrial Top1 activity in yeast From amino acid sequence analyses and computer algorithm, fission yeast (Schizosaccharomyces pombe) Top1 has been predicted to localize to both the nucleus and mitochondria [36]. Thus, in fission yeast the TOP1 gene probably codes for both mitochondrial and nuclear activities (Table 1). In budding yeast (Saccharomyces cerevisiae), the regular Top1 polypeptide does not appear to contain a mitochondrial targeting sequence [36]. However, biochemical mitochondrial Top1 activity is suppressed when the TOP1 gene is inactivated [37], which suggests that the single TOP1 gene regulates both mitochondrial and nuclear Top1 activities. One study [38] reported the presence of 72 and 79 kDa polypeptides reactive to Top1 antibodies in isolated mitochondria, which may suggest

Table 1 Mitochondrial topoisomerase genes Top1A

Top1B

Top2

Vertebrates Protozoan parasites

Top3aL [36] ?

Top1mt [30,33] Top1B [60,62,63]

Drosophila Schizosaccharomyces pombe Saccharomyces cerevisiae

Top3a * [41] Top3* [36]

? Top1* [36]

Top2b [44] Top2mt [45,47,48,51] ? ?

Top3* [36]

?

?

The genes that code topoisomerases specific to mitochondria are bold italic. *Predicted, yet to be demonstrated; ? Unknown.

that Top1 activity in budding yeast is derived from the posttranslational processing of Top1. 5. Mitochondrial Top3a Human topoisomerase IIIa (Top3a) belongs to the family of type IA Topoisomerarses (see Introduction) [1,2]. The TOP3a gene has two potential in-frame AUG start codons separated by 24 codons (Fig. 5, bottom). Initiation at first AUG codon produces a 1001-amino-acid peptide and initiation at the second AUG codon produces a 976-amino-acid peptide [36]. Because the second AUG start codon appeared more favorable for translation, it was initially thought that the major form of Top3a was the shorter 976 amino acid polypeptide [39]. More recent studies revealed the presence of a mitochondrial localization signal in the first 25 amino acids of the 1001amino-acid form of Top3a [36] (Fig. 5). Although the majority of hTop3a displays a nuclear pattern, the fraction of Top3a present in mitochondria is in proportion with the fraction of DNA present in mitochondria [36]. Hence, it is now accepted that the human TOP3a gene produces both polypeptides. The 976-amino-acid form is exclusively nuclear whereas the 1001amino-acid form is both nuclear and mitochondrial (Fig. 5) [36]. The high similarity among the N-terminal beginning sequences of human, mouse, and chicken Top3a suggests that Top3a is directed to both the mitochondrial and nuclear compartments in vertebrates (Table 1). Top3a knockout is embryonic lethal, shortly after implantation in mice [40]. Like the human and mouse orthologs, Drosophila melanogaster Top3a contains a putative mitochondrial localization sequence, although not conserved, at the N-terminus [41]. Using computer algorithms, an 88% probability of mitochondrial import has been proposed, with a signal cleavage site following the import sequence. D. melanogaster Top3a knockout is recessive lethal, with most of the homozygous D. melanogaster surviving to pupation but never emerging to adulthood [41]. Our own analysis of the C. elegans Top3 suggests the presence of a putative mitochondrial localization signal (http:// psort.hgc.jp). Similarly, both S. cerevisiae and S. pombe Top3 enzymes are probably imported into mitochondria based on computer algorithm prediction of the polypeptide

H. Zhang et al. / Biochimie 89 (2007) 474e481

479

Fig. 5. Top3a alternative translation. The Top3a long form is shown at the top with its MTS (mitochondrial targeting sequence at the N-terminus). The shorter Top3a (976 amino acid residues) is shown below. It contains only the NLS (nuclear localization sequence) at the C-terminus and cannot penetrate mitochondria. Numbers above proteins are amino acid positions and amino acid residues are indicated as single letter code.

sequences [36]. Thus, for all the Top3 analyzed so far, a single gene codes for both nuclear and mitochondrial activities (Table 1). 6. Mitochondrial topoisomerases II The presence of mitochondrial Top2 activity in mammalian and yeast mitochondria has been reported many years ago [42,43]. A truncated form of Top2b, with a molecular mass w150 kDa, was recently isolated from bovine mitochondria [44], based on the isolation of a mitochondrial polypeptide whose fragments matched fragments from Top2b following MALDI-TOF [44]. However, more information is needed to define the full sequence of this putative mitochondrial Top2b. 7. Protozoan parasite mitochondrial topoisomerases By contrast with other eukaryotic cells, the mitochondrial Top2s of protozoan parasites were discovered before their nuclear counterparts [45,46]. Mitochondrial Top2 activities have been purified from the kinetoplastae: Trypanosoma [47], Leishmania [48,49], and Crithidia [50]. These unicellular and pathogenic parasites are characterized by the existence of kinetoplasts DNA (kDNA) within a single mitochondrion. Immunolocalization shows the predominant mitochondrial pattern of the Top2mt [51e53]. Several mitochondrial TOP2 genes have been cloned [54e59] (Table 1). They share a high degree of identity (65%) at the amino acid level. RNA interference (RNAi) of TbTOP2mt (T. brucei mitochondrial TOP2) leads to progressive loss of kinetoplast DNA (kDNA) and death of the parasite [53]. It seems that one of the function of parasitic mitochondrial Top2 is to attach free minicircles to the network periphery following their replication [53]. Unlike the yeast, plant and vertebrate Top1 enzymes, the Top1 enzymes from kinetoplast parasites are heterodimers coded by two different genes [60e62]. The large subunit contains the core domain and the small subunit possesses the highly conserved SKxxY motif containing the catalytic tyrosine (Y). RNA interference shows that both subunits are essential and co-regulated [63]. For all protozoans, the same Top1 enzymes target both the mitochondrial and nuclear compartments (Table 1). Camptothecin traps Top1 both with nuclear

and mitochondrial DNA, consistent with the dual function of the bi-subunit protozoan Top1 enzymes both in the nucleus and mitochondria [64]. Camptothecin derivatives and noncamptothecin Top1 inhibitors are currently being investigated as novel therapeutic agents against protozoan parasites [65]. 8. Conclusions and perspectives So far, in humans, Top1mt is the only mitochondrial-specific topoisomerase. The presence of orthologs for TOP1mt in all vertebrates also suggests the importance of Top1 activity in vertebrate mitochondria. In short, just like nuclear DNA, mtDNA also needs topoisomerases. It is plausible that the three main types of topoisomerases are (and need to be) present in vertebrate mitochondria: Top1, Top3 and Top2, which correspond to types IB, IA and IIA enzymes, respectively. Several strategies exist for providing mitochondria with those three topoisomerase activities (see Table 1). Specific genes coding for mitochondrial enzymes exist for vertebrate mitochondrial Top1 and parasitic Top2. The existence of a specific gene for Top2mt in protozoan parasites is probably related to the complex structure and the large size of the mitochondrial genome in kinetoplasts, which is referred to as the kDNA [66]. Decatenation of the multiple circles (mini- and maxicircles) probably requires a specific Top2 activity. The more simple and smaller genome of eukaryotic mitochondria probably only requires a small fraction of the nuclear Top2, which may be provided by the Top2 genes that encode primarily the nuclear Top2s and probably mitochondrial Top2 as well. Mitochondrial Top1 activity may be critical in vertebrates, as it appears to require a specific gene, TOP1mt. In protozoan parasites, a single heterodimer Top1 polypeptide services both the nuclear and the kinetoplast DNAs [46]. This is also the case for fission yeast where a single TOP1 gene probably codes for a Top1 that acts both on the nuclear and mitochondrial genomes [36]. In the case of Top3, there is no example for a specific mitochondrial Top3 gene. Vertebrates, flies, and yeast use the same polypeptide for both the mitochondrial and nuclear compartments, as these polypeptides contain both mitochondrial and nuclear localization signals. In spite of recent breakthroughs on mitochondrial topoisomerases, several intriguing questions remain. First, what is the phenotype (if any) of the vertebrate TOP1mt knockout? Our

480

H. Zhang et al. / Biochimie 89 (2007) 474e481

ongoing studies show that the TOP1mt gene is not essential in mice. However, it is still too early to establish whether pathological consequences are associated with the loss of Top1mt. The viability of the TOP1mt knockout mice suggests that another Top1 complements for Top1mt. Is it Top3a or/and Top1? This question raises another question: how is Top1B activity provided to budding yeast and to drosophila (Table 1)? Part of the answer may be related to the difficulty of predicting mitochondrial-targeting sequences. For instance, no such targeting sequence has been found in kinetoplastid parasite Top1s in spite of the demonstrated presence of Top1 both in the kinetoplast and nucleus of protozoan parasites. A second question is how mitochondria acquire Top2 activities? Genomic analyses indicate the absence of specific Top2mt genes in vertebrates, flies and yeast in spite of the existence of mitochondrial Top2 activities. Partial information for the vertebrate Top2b suggests the existence of post-translational modifications (proteolytic cleavage) as a possible mechanism to deliver Top2 activity to mitochondria in vertebrates. Further studies are needed to elucidate how Top2b is delivered to mitochondria. Third, is there a Top1A activity in protozoan parasites? If the answer is no, is this difference with other eukaryotes related to the functional differentiation of kinetoplasts, and with the massive catenated and complex kDNA structure? Finally, since aging and common diseases like cancer, nervous diseases, myopathies and diabetes have been related to mitochondrial disorders, what is the contribution of mitochondrial topoisomerase defects to these diseases? Acknowledgement This research was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research. References [1] J.J. Champoux, DNA topoisomerases: structure, function, and mechanism, Annu. Rev. Biochem. 70 (2001) 369e413. [2] J.C. Wang, Cellular roles of DNA topoisomerases: a molecular perspective, Nat Rev Mol. Cell. Biol. 3 (2002) 430e440. [3] K. Samejima, W.C. Earnshaw, Trashing the genome: the role of nucleases during apoptosis, Nat. Rev. Mol. Cell. Biol. 6 (2005) 677e688. [4] O. Sordet, Q.A. Khan, I. Plo, P. Pourquier, Y. Urasaki, A. Yoshida, S. Antony, G. Kohlhagen, E. Solary, M. Saparbaev, J. Laval, Y. Pommier, Apoptotic topoisomerase I-DNA complexes induced by staurosporine-mediated oxygen radicals, J. Biol. Chem. 279 (2004) 50499e50504. [5] D.C. Hooper, Mechanisms of action and resistance of older and newer fluoroquinolones, Clin. Infect. Dis. 31 (Suppl. 2) (2000) S24eS28. [6] Y. Pommier, Topoisomerase I inhibitors, camptothecins and beyond, Nat. Rev. Cancer 6 (2006) 789e802. [7] J.L. Nitiss, DNA topoisomerases in cancer chemotherapy: using enzymes to generate selective DNA damage, Curr. Opin. Invest. Drugs 3 (2002) 1512e1516. [8] T.K. Li, L.F. Liu, Tumor cell death induced by topoisomerase-targeting drugs, Annu. Rev. Pharmacol. Toxicol. 41 (2001) 53e77. [9] K.D. Corbett, J.M. Berger, Structure, molecular mechanisms, and evolutionary relationships in DNA topoisomerases, Annu. Rev. Biophys. Biomol. Struct. 33 (2004) 95e118.

[10] A.H. Schapira, Mitochondrial disease, Lancet 368 (2006) 70e82. [11] L.C. Greaves, R.W. Taylor, Mitochondrial DNA mutations in human disease, IUBMB Life 58 (2006) 143e151. [12] M.M. Nass, S. Nass, Intramitochondrial fibers with DNA characteristics. I., Fixation and electron staining reactions, J. Cell Biol. 19 (1963) 593e611. [13] G.S. Shadel, D.A. Clayton, Mitochondrial DNA maintenance in vertebrates, Annu. Rev. Biochem. 66 (1997) 409e435. [14] C.T. Moraes, What regulates mitochondrial DNA copy number in animal cells? Trends Genet. 17 (2001) 199e205. [15] N. Garrido, L. Griparic, E. Jokitalo, J. Wartiovaara, A.M. van der Bliek, J.N. Spelbrink, Composition and dynamics of human mitochondrial nucleoids, Mol. Biol. Cell 14 (2003) 1583e1596. [16] T. Kanki, H. Nakayama, N. Sasaki, K. Takio, T.I. Alam, N. Hamasaki, D. Kang, Mitochondrial nucleoid and transcription factor A, Ann. N.Y. Acad. Sci. 1011 (2004) 61e68. [17] F. Foury, T. Roganti, N. Lecrenier, B. Purnelle, The complete sequence of the mitochondrial genome of Saccharomyces cerevisiae, FEBS Lett. 440 (1998) 325e331. [18] R. Maleszka, P.J. Skelly, G.D. Clark-Walker, Rolling circle replication of DNA in yeast mitochondria, EMBO J. 10 (1991) 3923e3929. [19] R.W. Friddle, J.E. Klare, S.S. Martin, M. Corzett, R. Balhorn, E.P. Baldwin, R.J. Baskin, A. Noy, Mechanism of DNA compaction by yeast mitochondrial protein Abf2p, Biophys. J. 86 (2004) 1632e1639. [20] T.A. Brown, D.A. Clayton, Genesis and wanderings: origins and migrations in asymmetrically replicating mitochondrial DNA, Cell Cycle 5 (2006) 917e921. [21] G.S. Shadel, Coupling the mitochondrial transcription machinery to human disease, Trends Genet. 20 (2004) 513e519. [22] V. McCulloch, G.S. Shadel, Human mitochondrial transcription factor B1 interacts with the C-terminal activation region of h-mtTFA and stimulates transcription independently of its RNA methyltransferase activity, Mol. Cell. Biol. 23 (2003) 5816e5824. [23] T.A. Brown, C. Cecconi, A.N. Tkachuk, C. Bustamante, D.A. Clayton, Replication of mitochondrial DNA occurs by strand displacement with alternative light-strand origins, not via a strand-coupled mechanism, Genes Dev. 19 (2005) 2466e2476. [24] M.Y. Yang, M. Bowmaker, A. Reyes, L. Vergani, P. Angeli, E. Gringeri, H.T. Jacobs, I.J. Holt, Biased incorporation of ribonucleotides on the mitochondrial L-strand accounts for apparent strand-asymmetric DNA replication, Cell 111 (2002) 495e505. [25] T. Yasukawa, M.Y. Yang, H.T. Jacobs, I.J. Holt, A bidirectional origin of replication maps to the major noncoding region of human mitochondrial DNA, Mol. Cell 18 (2005) 651e662. [26] F.J. Castora, G.M. Lazarus, Isolation of a mitochondrial DNA topoisomerase from human leukemia cells, Biochem. Biophys. Res. Commun. 121 (1984) 77e86. [27] M.J. Kosovsky, G. Soslau, Immunological identification of human platelet mitochondrial DNA topoisomerase I, Biochim. Biophys. Acta. 1164 (1993) 101e107. [28] F.R. Fairfield, W.R. Bauer, M.V. Simpson, Studies on mitochondrial type I topoisomerase and on its function, Biochim. Biophys. Acta. 824 (1985) 45e57. [29] J.H. Lin, F.J. Castora, Response of purified mitochondrial DNA topoisomerase I from bovine liver to camptothecin and m-AMSA, Arch. Biochem. Biophys. 324 (1995) 293e299. [30] H. Zhang, J.M. Barcelo, B. Lee, G. Kohlhagen, D.B. Zimonjic, N.C. Popescu, Y. Pommier, Human mitochondrial topoisomerase I, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 10608e10613. [31] P. D’Arpa, P.S. Machlin, H. Ratrie 3rd, N.F. Rothfield, D.W. Cleveland, W.C. Earnshaw, cDNA cloning of human DNA topoisomerase I: catalytic activity of a 67.7-kDa carboxyl-terminal fragment, Proc. Natl. Acad. Sci. U.S.A. 85 (1988) 2543e2547. [32] J.C. Venter, M.D. Adams, E.W. Myers, P.W. Li, R.J. Mural, G.G. Sutton, H.O. Smith, M. Yandell, C.A. Evans, R.A. Holt, J.D. Gocayne, P. Amanatides, R.M. Ballew, D.H. Huson, J.R. Wortman, Q. Zhang, C.D. Kodira, X.H. Zheng, L. Chen, M. Skupski, G. Subramanian, P.D. Thomas, J. Zhang, G.L. Gabor Miklos, C. Nelson, S. Broder,

H. Zhang et al. / Biochimie 89 (2007) 474e481

[33]

[34]

[35] [36]

[37]

[38] [39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

A.G. Clark, J. Nadeau, V.A. McKusick, N. Zinder, A.J. Levine, R.J. Roberts, M. Simon, C. Slayman, M. Hunkapiller, R. Bolanos, A. Delcher, I. Dew, D. Fasulo, M. Flanigan, L. Florea, A. Halpern, S. Hannenhalli, S. Kravitz, S. Levy, C. Mobarry, K. Reinert, K. Remington, J. Abu-Threideh, E. Beasley, K. Biddick, V. Bonazzi, R. Brandon, M. Cargill, I. Chandramouliswaran, R. Charlab, K. Chaturvedi, Z. Deng, V. Di Francesco, P. Dunn, K. Eilbeck, C. Evangelista, A.E. Gabrielian, W. Gan, W. Ge, F. Gong, Z. Gu, P. Guan, T.J. Heiman, M.E. Higgins, R.R. Ji, Z. Ke, K.A. Ketchum, Z. Lai, Y. Lei, Z. Li, J. Li, Y. Liang, X. Lin, F. Lu, G.V. Merkulov, N. Milshina, H.M. Moore, A.K. Naik, V.A. Narayan, B. Neelam, D. Nusskern, D.B. Rusch, S. Salzberg, W. Shao, B. Shue, J. Sun, Z. Wang, A. Wang, X. Wang, J. Wang, M. Wei, R. Wides, C. Xiao, C. Yan, et al., The sequence of the human genome, Science 291 (2001) 1304e1351. H. Zhang, L.H. Meng, D.B. Zimonjic, N.C. Popescu, Y. Pommier, Thirteen-exon-motif signature for vertebrate nuclear and mitochondrial type IB topoisomerases, Nucleic Acids Res. 32 (2004) 2087e2092. A. Tanizawa, R. Bertrand, G. Kohlhagen, A. Tabuchi, J. Jenkins, Y. Pommier, Cloning of Chinese Hamster DNA topoisomerase I cDNA and identification of a single point mutation responsible for camptothecin resistance, J. Biol. Chem. 268 (1993) 25463e25468. M. Gupta, A. Fujimori, Y. Pommier, Eukaryotic DNA topoisomerases I, Biochim. Biophys. Acta. 1262 (1995) 1e14. Y. Wang, Y.L. Lyu, J.C. Wang, Dual localization of human DNA topoisomerase IIIalpha to mitochondria and nucleus, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 12114e12119. J. Wang, K. Kearney, M. Derby, C.M. Wernette, On the relationship of the ATP-independent, mitochondrial associated DNA topoisomerase of Saccharomyces cerevisiae to the nuclear topoisomerase I, Biochem. Biophys. Res. Commun. 214 (1995) 723e729. A. Tua, J. Wang, V. Kulpa, C.M. Wernette, Mitochondrial DNA topoisomerase I of Saccharomyces cerevisiae, Biochimie 79 (1997) 341e350. R. Hanai, P.R. Caron, J.C. Wang, Human TOP3: a single copy gene encoding DNA topoisomerase III, Proc. Natl. Acad. Sci. U.S.A. 93 (1996) 3653e3657. W. Li, J.C. Wang, Mammalian DNA topoisomerase IIIalpha is essential in early embryogenesis, Proc. Natl. Acad. Sci. U.S.A. 95 (1998) 1010e1013. J.L. Plank, S.H. Chu, J.R. Pohlhaus, T. Wilson-Sali, T.S. Hsieh, Drosophila melanogaster topoisomerase IIIalpha preferentially relaxes a positively or negatively supercoiled bubble substrate and is essential during development, J. Biol. Chem. 280 (2005) 3564e3573. F.J. Castora, G.M. Lazarus, D. Kunes, The presence of two mitochondrial DNA topoisomerases in human acute leukemia cells, Biochem. Biophys. Res. Commun. 130 (1985) 854e866. J.H. Lin, F.J. Castora, DNA topoisomerase II from mammalian mitochondria is inhibited by the antitumor drugs, m-AMSA and VM-26, Biochem. Biophys. Res. Commun. 176 (1991) 690e697. R.L. Low, S. Orton, D.B. Friedman, A truncated form of DNA topoisomerase IIbeta associates with the mtDNA genome in mammalian mitochondria, Eur. J. Biochem. 270 (2003) 4173e4186. T. Kulikowicz, T.A. Shapiro, Distinct genes encode type II Topoisomerases for the nucleus and mitochondrion in the protozoan parasite Trypanosoma brucei, J. Biol. Chem. 281 (2006) 3048e3056. B.B. Das, T. Sengupta, A. Ganguly, H.K. Majumder, Topoisomerases of kinetoplastid parasites: why so fascinating? Mol. Microbiol. 62 (2006) 917e927. S. Douc-Rasy, J.F. Riou, J.C. Ahomadegbe, G. Riou, ATP-independent DNA topoisomerase II as potential drug target in trypanosomes, Biol. Cell 64 (1988) 145e156. A.K. Chakraborty, H.K. Majumder, Decatenation of kinetoplast DNA by an ATP-dependent DNA topoisomerase from the kinetoplast hemoflagellate Leishmania donovani, Mol. Biochem. Parasitol. 26 (1987) 215e224.

481

[49] A.K. Chakraborty, H.K. Majumder, An ATP-independent catenating enzyme from the kinetoplast hemoflagellate Leishmania donovani, Biochem. Biophys. Res. Commun. 180 (1991) 279e285. [50] T. Melendy, D.S. Ray, Novobiocin affinity purification of a mitochondrial type II topoisomerase from the trypanosomatid Crithidia fasciculata, J. Biol. Chem. 264 (1989) 1870e1876. [51] T. Melendy, C. Sheline, D.S. Ray, Localization of a type II DNA topoisomerase to two sites at the periphery of the kinetoplast DNA of Crithidia fasciculata, Cell 55 (1988) 1083e1088. [52] S.P. Fragoso, D. Mattei, J.C. Hines, D. Ray, S. Goldenberg, Expression and cellular localization of Trypanosoma cruzi type II DNA topoisomerase, Mol. Biochem. Parasitol. 94 (1998) 197e204. [53] Z. Wang, P.T. Englund, RNA interference of a trypanosome topoisomerase II causes progressive loss of mitochondrial DNA, EMBO J. 20 (2001) 4674e4683. [54] P.R. Strauss, J.C. Wang, The TOP2 gene of Trypanosoma brucei: a single-copy gene that shares extensive homology with other TOP2 genes encoding eukaryotic DNA topoisomerase II, Mol. Biochem. Parasitol. 38 (1990) 141e150. [55] A. Das, A. Dasgupta, S. Sharma, M. Ghosh, T. Sengupta, S. Bandopadhyay, H.K. Majumder, Characterisation of the gene encoding type II DNA topoisomerase from Leishmania donovani: a key molecular target in antileishmanial therapy, Nucleic Acids Res. 29 (2001) 1844e1851. [56] S.G. Pasion, J.C. Hines, R. Aebersold, D.S. Ray, Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata, Mol. Biochem. Parasitol. 50 (1992) 57e67. [57] S.P. Fragoso, S. Goldenberg, Cloning and characterization of the gene encoding Trypanosoma cruzi DNA topoisomerase II, Mol. Biochem. Parasitol. 55 (1992) 127e134. [58] T. Hanke, M.J. Ramiro, S. Trigueros, J. Roca, V. Larraga, Cloning, functional analysis and post-transcriptional regulation of a type II DNA topoisomerase from Leishmania infantum. A new potential target for anti-parasite drugs, Nucleic Acids Res. 31 (2003) 4917e4928. [59] J.M. De Sousa, S.M. Lareau, R.D. Pearson, E.M. Carvalho, B.J. Mann, S.M. Jeronimo, Characterization of Leishmania chagasi DNA topoisomerase II: a potential chemotherapeutic target, Scand. J. Infect. Dis. 35 (2003) 826e829. [60] A.L. Bodley, A.K. Chakraborty, S. Xie, C. Burri, T.A. Shapiro, An unusual type IB topoisomerase from African trypanosomes, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 7539e7544. [61] D.R. Davies, A. Mushtaq, H. Interthal, J.J. Champoux, W.G. Hol, The structure of the transition state of the heterodimeric topoisomerase I of Leishmania donovani as a vanadate complex with nicked DNA, J. Mol. Biol. 357 (2006) 1202e1210. [62] H. Villa, A.R. Otero Marcos, R.M. Reguera, R. Balana-Fouce, C. GarciaEstrada, Y. Perez-Pertejo, B.L. Tekwani, P.J. Myler, K.D. Stuart, M.A. Bjornsti, D. Ordonez, A novel active DNA topoisomerase I in Leishmania donovani, J. Biol. Chem. 278 (2003) 3521e3526. [63] R.P. Bakshi, T.A. Shapiro, RNA interference of Trypanosoma brucei topoisomerase IB: both subunits are essential, Mol. Biochem. Parasitol. 136 (2004) 249e255. [64] A.L. Bodley, T.A. Shapiro, Molecular and cytotoxic effects of camptothecin, a topoisomerase I inhibitor, on trypanosomes and Leishmania, Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 3726e3730. [65] R. Balana-Fouce, C.M. Redondo, Y. Perez-Pertejo, R. Diaz-Gonzalez, R.M. Reguera, Targeting atypical trypanosomatid DNA topoisomerase I, Drug Discov. Today 11 (2006) 733e740. [66] G. Riou, E. Delain, Electron microscopy of the circular kinetoplastic DNA from Trypanosoma cruzi: occurrence of catenated forms, Proc. Natl. Acad. Sci. U.S.A. 62 (1969) 210e217. [67] A. Fujimori, M. Gupta, Y. Hoki, Y. Pommier, Acquired camptothecin resistance of human breast cancer MCF-7/C4 cells with normal topoisomerase I and elevated DNA repair, Mol. Pharmacol. 50 (1996) 1472e1478.