Ovine amniotic epithelial cells: In vitro characterization and transplantation into equine superficial digital flexor tendon spontaneous defects

Research in Veterinary Science 94 (2013) 158–169

Contents lists available at SciVerse ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

Ovine amniotic epithelial cells: In vitro characterization and transplantation into equine superficial digital flexor tendon spontaneous defects A. Muttini a,d,⇑, L. Valbonetti a,d, M. Abate b,d, A. Colosimo a,d, V. Curini a,d, A. Mauro a, P. Berardinelli a, V. Russo a,d, D. Cocciolone a, M. Marchisio c,d, M. Mattioli a, U. Tosi a,d, M. Podaliri Vulpiani e, B. Barboni a,d a

Department of Comparative Biomedical Sciences, University of Teramo, Italy Department of Clinical Sciences of the Bio Imaging, G.D’Annunzio Foundation – ITAB, Italy Department of Biomorphology, University of Chieti, Italy d Stem TeCh Group, Chieti, Italy e Institute G. Caporale, Teramo, Italy b c

a r t i c l e

i n f o

Article history: Received 14 March 2012 Accepted 28 July 2012

Keywords: Ovine amniotic epithelial cells (oAECs) Equine Transplantation Superficial digital flexor tendon (SDFT) Tendon repair

a b s t r a c t In vitro expanded and frosted ovine amniotic epithelial cells (oAECs) were evaluated for their phenotype, stemness and attitude to differentiate into tenocytes. Fifteen horses with acute tendon lesions were treated with one intralesional injection of oAECs. Tendon recovery under controlled training was monitored. In vitro expanded oAECs showed a constant proliferative ability, a conserved phenotype and stable expression profile of stemness markers. Differentiation into tenocytes was also regularly documented. US controls showed the infilling of the defect and early good alignment of the fibers and 12 horses resumed their previous activity. Histological and immunohistochemical examinations in an explanted tendon demonstrated the low immunogenicity of oAECs that were able to survive in the healing site. In addition, oAECs supported the regenerative process producing ovine collagen type I amongst the equine collagen fibers. Considering our results, oAECs can be proposed as a new approach for the treatment of spontaneous equine tendon injuries. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction Spontaneous tendon lesions are a significant cause of morbidity in both human and animal species (Taylor et al., 2009). Tendon or ligament injuries account for up to 46% of all musculoskeletal injuries in horses (Ely et al., 2004). Superficial digital flexor tendon (SDFT) is more commonly involved, with a prevalence of 75–93% (Ely et al., 2004; Kasashima et al., 2004), compromising athletic performances and ultimately culminating in the end of the animals career (van Schie et al., 2009). Spontaneous tendon healing results in the formation of scar tissue, that has inferior mechanical properties than healthy tissue (Woo et al., 1999), and affected horses are predisposed to high re-injury rates (Dyson, 2004; Guest et al., 2010). In recent years, cell based therapy has been shown to improve the structure and function of injured tendons using stem cells. A most frequently investigated source of stem cells are bone marrow stem cells (BMSCs), that injected into SDFT defects showed good clinical results (Smith, 2008). However, some practical and biological limitations appear to be related to BMSCs autotransplantation; in ⇑ Corresponding author at: Department of Comparative Biomedical Sciences, University of Teramo, Italy. E-mail address: [email protected] (A. Muttini). 0034-5288/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.rvsc.2012.07.028

particular, the morbidity for the donor site, the delay between the bone marrow collection and the grafting procedure and the difficulties in cells standardization (Guest et al., 2010; Paris and Stout, 2010) are limiting factors. Moreover, other technical limitations to the use of BMSCs for the repair of cartilage and tendon have been described (Paris and Stout, 2010), including scarcity in bone marrow aspirates and limited potential for in vitro proliferation and targeted differentiation, possible formation of bone tissue following BMSCs grafting into injured tendons and reduced plasticity (Harris et al., 2004) as a factor of both increasing donor age and number of in vitro passages (Majors et al., 1997; Guillot et al., 2007). Guest et al. (2010) reported the potential clinical relevance of equine embryonic stem-like cells in the treatment of tendon injuries. However, the absence of tumorigenic deviations of these cells remains to be demonstrated in longer follow-up (Guest et al., 2010; Watts et al., 2011). More recently Watts et al. (2011) demonstrated relevant architectural improvements of SDFT experimental collagenase defects after intralesional injection of fetal derived embryoniclike stem cells, although the experimental lesion induced with collagenase does not resemble spontaneous overstrain tendinopathies. There is a consensus agreement that amnion derived cells may be a possible reserve of cells useful for clinical application. The opportunity to collect amniotic cells from pregnant sheep at

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

the abattoir offers a simple and economic method, avoiding the risks of sample contamination associated to the birth canal and the delivery environment that represents a non-sterile condition (Cremonesi et al., 2011). In a previous experimental study we demonstrated that ovine epithelial amniotic cells (oAECs) allotransplanted in sheep calcaneal tendon experimental lesions, significantly improved tissue regeneration (Muttini et al., 2010; Barboni et al., 2012b). These cells display a high level of plasticity, are able to in vitro differentiate into all three germ layers (Miki et al., 2005) and are characterized by a high immunomodulatory activity (Parolini et al., 2009). Several clinical studies clearly illustrate that allogeneic and xenogeneic transplantation of the amniotic membrane and epithelial amniotic derived cells can be performed in the absence of an immunosuppressive treatment without any risk of acute immune rejection (Sankar and Muthusami, 2003; Bailo et al., 2004; Yuge et al., 2004; Gomes et al., 2005; Plummer, 2009). Starting from these premises, the present study was performed with two main objectives: (a) to test in vitro oAECs phenotypic stability and tenogenic plasticity and (b) to evaluate the oAECs regenerative properties; to this aim a clinical trial was adopted by selecting SDFT defects, most commonly diagnosed in clinical practice (Ely et al., 2004; Kasashima et al., 2004), where spontaneous healing requires a very long time and leads to the synthesis of scar tissue (Smith, 2003). The SDFT lesions were grafted with oAECs in order to verify if this treatment could accelerate and/or ameliorate the healing process of the tendon tissue.

159

factors and FCS before their use either in preclinical (Muttini et al., 2010) or clinical settings. 2.3. Flow cytometer analysis oAECs derived from each fetus (3rd passage) were screened by flow cytometry in order to evaluate the negativity for hemopoietic markers (CD14, CD31, CD45), the conserved expression of adhesion (CD49f, CD29 and CD166) and stemness (OCT4, SOX2, Nanog, TERT and CD117) molecules, that have been recorded in sheep mesenchymal stem cells and human amniotic epithelial cells (Miki et al., 2007; McCarty et al., 2009). The primary antibodies used for the analysis are commercially available. To optimize the antibody concentration by flow cytometry we stained sheep PBMCs (positive control) by hematopoietic markers (data not shown). Finally, cells were analyzed on a FACSCalibur flow cytometer (BD), using CellQuest™ software (BD). Flow Cytometry Measurement was carried out by using as quality control Rainbow Calibration Particles (6 peaks) and CaliBRITE beads (both from BD Biosciences). Debris was excluded from the analysis by gating on morphological parameters (lymphocyte gate); 20.000 non-debris events in the morphological gate were recorded for each sample. All antibodies were titrated under assay conditions and optimal photomultiplier (PMT) gains were established for each channel (Perfetto et al., 2006). Data were analyzed using FlowJo™ software (TreeStar, Ashland, OR). Mean Fluorescence Intensity Ratio (MFI Ratio) was calculated dividing the MFI of positive events by the MFI of negative events (Miscia et al., 2009).

2. Materials and methods 2.4. In vitro tenogenic differentiation 2.1. Chemical agents All chemical reagents and media used were purchased from Sigma Chemical Co (St. Louis, MO, USA), unless otherwise specified.

2.2. oAECs culture, characterization and storage Amniotic epithelial cells (AEC) were collected from the amnions of slaughtered sheep at approximately 3 months of pregnancy of six different fetuses of 25–30 cm of length (Barone, 2001). The cells were obtained from the epithelial layer of 3–5 cm diameter pieces of the amniotic membrane after enzymatic digestion (EDTA-trypsin) at 37.5 °C for 20 min. Cell suspension was then filtered through a 40 lm cell filter and collected into a 50 ml Falcon tubes containing fetal calf serum (FCS: Chemical Co., St. Louis, MO) at a final concentration of 10% to inactivate trypsin. The Falcon tubes were centrifuged and the pelleted cells were seeded in flasks containing growth medium (aMEM supplemented with 20% FCS, 1% Ultraglutamine, 1% Penicillin/Streptomycin plus 10 ng/ml EGF) at a concentration of 3  103 cells/cm2. At 70–80% confluence dead cells and debris were removed with medium and the cells were dissociated by 0.05% trypsin–EDTA and plated again at 3  103/cm2 for 3 consecutive expansion passages. The oAECs characterization was performed immediately after isolation, at the end of in vitro expansion and after thawing of cryopreserved cells in order to compare: (a) the proliferative index expressed as mean doubling time; (b) the expression of hemopoietic, adhesion and stemness molecular markers by using flow cytometer analysis and (c) the in vitro ability to differentiate into tenocyte- like cell lineage. All the oAECs with a stable proliferation index, a conserved expression pattern and the ability to undergo in vitro tenogenic cell lineage differentiation, were then stained with the Red Fluorescent Cell Linker dye, PKH26, before storing the cells in vials of 2.5  106 by cryopreservation in liquid nitrogen. Cryopreserved, labeled cells were then thawed, washed and suspended in aMEM without any growth

The plasticity of oAECs was assessed by performing tenogenic differentiation adopting, with small differences, the co-culture system developed by Luo et al. (2009). Tenocytes were isolated after in vitro incubation of SDFT tendon explants collected from slaughtered adult horses. Finally, tenogenic differentiation was monitored after 28 days of co-culture by analyzing the ability of oAECs cultured alone (CTR) or exposed to primary tenocytes (co-culture) to down regulate cytokeratin 8 (epithelial marker), to generate three dimensional tendon-like structures, to express collagen type I (COL1), and tendon-ligament related genes as summarized in Table 1. 2.5. Clinical trial The clinical study was approved by the local Ethical Committee and was conducted in compliance with the Italian Animal Welfare guidelines. Fifteen horses with acute SDFT injuries demonstrated by ultrasonographic (US) evaluation were selected for inclusion in the study. Signalment of the horses is summarized in Table 2. All horses exhibited classical signs of exercise induced tendinopathy, including lameness, heat and pain on palpation. Injuries were monolateral and confined to the mid metacarpal region where the tendon is not surrounded by the sheath. Affected limbs were examined ultrasonographically with a 7.5 MHz linear transducer using transverse and longitudinal scans and a standoff pad. The defects could be classified as ‘‘core lesions’’, i.e. localized and well circumscribed hypoechoic areas located in the central or lateral portions of the tendon. Assessment was based on subjective semiquantitative scores previously described (Rantanen et al., 2003) (Table 2). The echogenicity score, the cross-sectional area, and fiber alignment score at the maximal injury zone of the SDFT according to Rantanen et al. (2003), were recorded (Table 2). Contra-lateral forelimb was also US examined. Informed consent was obtained by the owner of each horse. The procedure was performed with the horses standing and sedated using detomidine 10 lg/kg

160

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169 Table 1 Primer sequences used for RT-PCR. Gene

Accession no.

Primer sequence

Product size (bp)

PCR cycles

OCT4A

NM_174580.1 Bovine X96997.1 Ovine FJ970651.1 Ovine EU139125.1 Ovine AF129287.1 Ovine AY091605.1 Ovine XM_866422.2 Bovine M_001499586.2 Equine AF030943.1 Ovine/Equine

F: TATGACTTGTGTGGAGGGATG R: AAACAGAACCCCCAGGGTGA F: ACCAGAAGAACAGCCCGGAC R: CATGAGCGTCTTGGTTTTCCG F: GGATCTGCTTATTCAGGACAG R: TGCTGGAGGCTGAGGTATTTC F: TTGTCCCCGCAGGTGTCTTG R: TGACCGTGTTGGGCAGGTAG F: CGTGATCTGCGACGAACTTAA R: GTCCAGGAAGTCCAGGTTGT F: AAGGGCAGGGAACAACTTGAT R: GTGGGCAAACTGCACAACATT F: AACAGCGTGAACACGGCTTTC R TTTCTCTGGTTGCTGAGGCAG F: AACGTGTTGTGCGATGACGTG R: AAAGTTTCCTCCGAGGCCAG F: CCTGCACCACCAACTGCTTG R: TTGAGCTCAGGGATGACCTTG

327

45

264

45

209

40

176

45

212

40

355

40

298

45

279

40

224

40

SOX2 NANOG TERT COL1A1 COL3 SCXB COL10A1 GAPDH

Table 2 Athletic performance’s signalment of the horses combined with the ultrasonographic evaluations of the tendons performed after 18 and 3 months from oAECs implant, respectively. Case number

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Aptitude

Dr RF SJ CC RF E SJ RF SJ CC Dr RF RF RF RF

Sex

Gelding Stallion Mare Gelding Mare Gelding Gelding Gelding Stallion Mare Gelding Mare Stallion Mare Gelding

Age

10 6 7 16 2 17 9 4 8 12 7 3 3 4 6

Zone

2B 2A 3A 1B 2B 2A 3A 2B 2B 3A 2B 2B 2A 1B 2B

MIZ CSA cm2

MIZ FAS

T0

T3

T0

T3

T0

T3

2 1 2 3 2 2 2 1 2 1 3 2 2 2 2

0 0 1 1 1 0 1 0 1 0 – 1 – 1 –

1.51 1.10 2.17 1.41 1.33 1.18 1.72 1.08 2.09 1.27 1.64 1.57 1.69 1.32 1.47

0.00 0.00 0.35 0.15 0.66 0.00 0.19 0.00 0.15 0.00 – 0.36 – 0.13 –

1 1 2 2 2 1 2 1 2 1 2 2 1 2 2

0 0 1 0 1 0 0 0 1 0 – 1 – 0 –

MIZ ES

Athletic performances

Excellent Excellent Good Good Not good Good Good Excellent Good Excellent Excluded Not good Died Good Excluded

Dr, dressage; SJ, show jumping; CC, cross country; RF, racing flat; E, eventing; ES, echogencity score; CSA, cross-sectional area; FAS, fiber alignment score; MIZ, maximal injury zone; T0, before oAECs injection; T3, three months after injection of oAECs.

(DomosedanÒ – Pfizer, Italy) and butorphanol 20 lg/kg (DolorexÒ – Intervet, Italy). Regional analgesia was obtained with perineural injection of 1.5 ml of Lidocaine 2% (Collalto, Italy) around the medial and lateral palmar nerves plus a small amount of anesthetic 2 cm proximal to the insertion point. Cell Injection was always performed with the limb bearing weight. After aseptic preparation a needle (20G  1.5 inch) was inserted from lateral to medial into the defect, under US guidance, and a total of 7  106 oAECs in 500 ll of aMEM was grafted into the lesion. Limbs were then bandaged and ice packs were daily applied for the first 15 days after the procedure. Horses were rested in box for 7 days before commencing a 4 week period of walking in hand on hard surface, for 15 min, twice a day. Horses were then hand walked 40 min daily for further 4 weeks. Walk under saddle or at the kart, was then started, progressively increasing the time (5 min every 15 days) for additional 8 weeks. Training at trot was then commenced and the subsequent training schedule was adjusted according to the clinical controls, US appearance and in agreement with the trainer. Horses were re-examined both clinically and US, every 30 days for the first 4 month and every 3 months thereafter. Follow-up information regarding the athletic performances were periodically obtained by the veterinaries through telephonic interview and

were scored as follows: good if the previous performance level was reached, excellent if the level was higher and poor if the level was lower. 2.6. Morphological and immunohistological analyses of oAECs xenotransplanted tendon The SDFTs of one horse subjected to euthanasia, for unrelated causes, were collected. The affected portion of the tendon and the corresponding sample of the contra-lateral healthy tendon were immediately cryopreserved, cryosectioned at 7 lm thick longitudinal sections, and then processed for histological haematoxylin-eosin (HE), Herovici staining and immunohistochemical (IHC) analyses using specific antibodies. The composition of the extracellular matrix was assessed by using a specific commercial antibody COL1 (diluted 1:500/PBS/BSA1%; Abcam, Cambridge, UK) which reacts with horse, as declared in the manufacturer’s datasheet. Furthermore, in order to evaluate COL1 secretion of oAECs, an antibody that has a species reactivity with sheep COL1 (diluted 1:200/PBS/BSA1%; Chemicon Int. Billrerica, MA), and that does not react with horse collagen type I proteins, as declared in the manufacturer’s datasheet, was used. As antibodies cross reactivity controls, healthy horse or sheep tendon tissue samples col-

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

161

Fig. 1. COL1 antibody species-specificity panel. The images show immunohistochemistry performed with a COL1 antibody which cross reacts with sheep but not with the horse COL1 protein, and a COL1 antibody which cross reacts with horse, as declared by the manufacturer, on healthy horse or sheep tendon tissue samples. (A) The image shows the positivity (in green) for the antibody anti-COL1 species-specific for sheep in a sheep tendon, while in (B) the image demonstrates that a horse tendon is negative to the antibody that cross reacts with sheep. (C) The image shows a negative sheep tendon for the antibody anti-COL1 species-specific for horse, while in (D) the image demonstrates the positivity (in green) for the antibody anti-COL1 which cross reacts with horse in a horse tendon. Nuclei were counterstained with DAPI. Scale bar 50 lm.

lected at the local slaughterhouse were used for horse or sheep COL1 antigen retrieval on tendon cryosections (Fig. 1). Additionally, the expression of collagen type III was evaluated (COL3, diluted 1:500/PBS/BSA1%; Chemicon Int., Billrerica, MA). Finally, cell proliferation (anti-mouse Ki-67, diluted 1:50/PBS/BSA1%; Dako Cytomation, Denmark), vascular organization (anti-rabbit von Willebrand factor – vWF – diluted 1:400/PBS/BSA 1%; Dako Cytomation, Denmark), and leukocytes (anti-mouse CD45, diluted 1:100/PBS/BSA 1%; AbD Serotec, Oxford, UK) were IHC analyzed. All IHC were revealed with secondary anti-mouse or anti-rabbit Alexa Fluor488 (diluted 1:400 PBS/1% BSA; Molecular Probes) antibodies, while cell nuclei were identified with DAPI. Specific primary antibodies were replaced with non-immune sera as negative controls. Finally, all treated sections were analyzed with the Axioscop2 plus fluorescence microscope (Zeiss, Oberkochen, Germany). 2.7. RNA isolation andreverse transcription polymerase chain reaction (RT-PCR) Total RNA was extracted by using TRI Reagent (Sigma) following manufacturer’s instructions. The RNA was treated with DNaseI digestion (Sigma) for 15 min at RT. One microgram of total RNA of each sample was used for reverse transcription reaction with

Oligo dT primer and BioScript™ Kit (Bioline UK). 2 ReadyMix™ Taq PCR mix (Sigma) was used for PCR reaction using 3 ll of cDNA and 0.5 lM of each primer, in a final volume of 25 ll. The PCR Primer sequences, Genebank number of reference mRNA sequence, product length and cycles are shown in Table 1. The reaction mixtures were incubated for 5 min at 95 °C, followed by 95 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s and 72 °C for 7 min. For each gene, a reaction mixture with water instead of cDNA template was run at the same time as a PCR negative control. The PCR products were separated on 2% agarose gel stained with ethidium bromide, visualized on a Gel Doc 2000 (Biorad, USA) and analyzed with Quantity One 1-D Analysis software (Biorad, USA). RT-PCR was normalized by the transcriptional levels of GAPDH. Each PCR reaction was carried out in triplicate. 2.8. Laser capture microdissection (LCM) and RT-PCR analysis of healthy and xenotransplanted tendons RT-PCR analyses were performed exclusively at the defect site using the laser capture microdissection (LCM) technique. LCM dissection was performed using a MMI Cellcut apparatus. The frozen sections (n = 30, 4  6 mm/section) were briefly air dried on the glass slides and then kept on dry ice until they were subjected to LCM. Just before the procedure, the sections were exposed to 70%

162

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

Table 3 Summary of stored AEC after in vitro expansion and characterization. M (male); F (female); n.d. (not determined). Fetus name

Sex (fetus size)

Collected oAEC (106 cells)

Stored oAEC after three in vitro passages (109 cells)

Alive cells after thawing (%)

Z R W K XX AA

M (28 cm) F (31 cm) M (30 cm) M (32 cm) M (28 cm) F (26 cm)

10.5 6 2.5 3.5 4.6 3.5

2.5 1.5 0.5 1 1.2 0.01

85 90 92 86 93 n. d.

Equine and the intraspecific housekeeping primers for GAPDH (Table 1). 2.9. Statistical analysis The normalcy distribution of US parameters was assessed by D’Agostino and Pearson test before comparing them by Mann– Whitney U test. The correlation amongst the different data sets has been, then, assessed by Spearman Rank Correlation test. 3. Results 3.1. oAECs in vitro expansion

ethanol for 10 s and stained with HE. The settings of the laser were: spot diameter 20 lm, pulse duration 50 ms and power 50 mW. The area to micro dissect was identified under a light microscope at 40 of magnification. The microdissected area including the implantation site was dropped onto a separate cap before going onto RNA extraction as previously described. The total RNA was obtained from the tendon sections of the implanted SDFT or, as control, of the contra-lateral healthy SDFT, and calcaneal ovine tendon. RNA extraction and RT-PCR were performed as described above using species-specific PCR primers for COL1 Ovine and

The number of oAECs isolated from single amniotic membrane ranged between 2 to 10  106 cells. The mean average doubling time recorded during the first three passages of in vitro expansion was 15–20 h in all fetuses analyzed, a part in one fetus (doubling time > 60 h) that was, for this reason, discarded from the following procedures (Table 3). oAECs maintained their expression profiles during the in vitro expansion as indicated by cytofluorimetric analysis. In detail, oAECs did not display any hemopoietic molecular marker (CD14, 31 and 45), while expressed several surface adhesion molecules (CD29, CD49f and CD166) and intracellular

Fig. 2. Molecular characterization of oAECs. (A) Flow cytometry analyses in in vitro cultured oAECs at passages 1 (P1), 3 (P3) and post thawing (P3 post Tw) for the surface and intracellular stemness markers. The results were expressed as Mean Fluorescence Intensity (MFI) ratio (values are mean ± SD of 3 different biological samples). (B) RT-PCR image (left) of OCT4, NANOG, SOX2 and TERT genes expression in oAECs cryopreserved (P3 post Tw) and semi quantitative analysis of the gene expression normalized for GAPDH. The values are mean ± SD of 3 independent experiments.

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

stemness markers (TERT, SOX2 and Nanog). OCT4, revealed a lower level of expression compared to the other stemness markers, while CD117 resulted always unexpressed (Fig. 2A). The stability in the expression of stemness markers TERT, SOX2, Nanog and OCT4 was also confirmed by RT-PCR as showed in Fig. 2B.

163

3.2. oAECs tenogenic in vitro differentiation The co-culture with equine tenocytes produced in 14–21 days a progressive morphological transformation of oAECs, that became fusiform, in all the samples analyzed (after collection, expansion and following freezing/thawing cells). Then, co-cultured oAECs started to aggregate forming bundles with aligned and parallel

Fig. 3. Cytokeratin8 expression in in vitro differentiated oAECs. (A) oAECs at the beginning of co-cultures with adult equine tendon show their typical poliedric morphology and immunopositivity to Cytokeratin8 (red), while (B) at the end of co-cultures with adult equine tendon for 28 days, the cells appear fusiform assume a three dimensional bundle structure and lose their reactivity to Cytokeratin8. Nuclei were counterstained with DAPI. Scale bar 75 lm.

Fig. 4. COL1 expression and tenogenic gene expression in in vitro differentiated oAECs: (A) oAECs photographed under a stereomicroscope to show the co-culture with adult equine tendon appearance after 28 days. (B) oAECs at the end of co-cultures with adult equine tendon for 28 days microphotographed in phase contrast to show the fusiform cells arranged in a three dimensional bundle structure. (C) oAECs at the end of co-cultures with adult equine tendon for 28 days immunopositive to COL1 (green), nuclei were counterstained with DAPI. Scale bar 100 lm. (D) Analyses by RT-PCR of COL1, COL3 and SCX ovine tenogenic genes expression in oAECs at the beginning (oAECs) or at the end of co-cultures with adult equine tendon for 28 days (co-cultured oAECs). Adult ovine tendon (o tendon) profile genes were used as a control tissue of differentiation. The images were representative of five independent experiments.

164

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

fusiform cells (Figs. 3 and 4). At the end of the co-cultural period (28 days) some bundle structures became three dimensional, while CTR oAECs reached a confluent monolayer. Immunohistochemistry analysis showed that all fusiform cells lost their positivity for the epithelial marker Cytokeratin 8 (Fig. 3), while strongly increased their content in COL1 protein (Fig. 4), differently from CTR oAECs (data not shown). The co-culture significantly changed oAECs gene profiles increasing COL1 and SCX and decreasing COL3 mRNA content (Fig. 4). The intracellular mRNA levels of all the three tendon related genes became similar to those recorded in ovine tendons analyzed as control tissues (Fig. 4).

3.3. oAECs storage and thawing Before using oAECs for preclinical (Muttini et al., 2010) or clinical trials, each pool of stored AEC/fetus has been previously characterized by analyzing at least three different vials. In detail, after thawing, oAECs showed a mean viability higher than 80% (Table 3), while the mean doubling time was only slightly in-

creased (30 h) (p < 0.05), for the two passages. Cryopreservation only slightly decreased the expression of stemness markers, as indicated by flow cytometry and RT-PCR (Fig 1A and B), while did not affect the profile of the other surface molecules and the ability of oAECs to in vitro differentiate into tenocyte-like cells (data shown). 3.4. Clinical outcomes post oAECs xenotransplantation The injection procedure was always well tolerated and did not cause any worsening of the clinical signs. None of the horses exhibited discomfort. Pain on palpation related to tendinopathy progressively decreased in two months following treatment. One horse (case n. 13) was euthanized on owner’s request for unrelated causes (colic syndrome) 60 days after oAECs implant; 12 horses resumed full training and competition in the specific discipline by 12 months after injury; while two horses (cases n. 11 and 15) were excluded from the follow-up because the training program was not observed. Follow-up information regarding the athletic performances (average time 18 months) are summarized in Table 2. US examination documented an improvement of the echogenicity score (ES), of the cross section area (CSA) and of the fiber alignment score (FAS; Fig. 5) already visible after three months (T3) from oAECs implant (Table 2). The statistical comparison of these parameters showed a highly significantly difference when US parameters were analyzed between T0 and T3 (p < 0.001). In addition, positive correlation existed between the US clinical outcomes and the athletic performance as summarized in Table 4. 3.5. Post mortem analysis of oAECs implanted in SDFT tendon healing process The histological analyses of the treated tendon, revealed an advanced process of healing that involved the whole affected area. In fact, the regenerated tendon area displayed a microarchitecture similar to that observed in the healthy tissue with fusiform aligned cells surrounded by an abundant extracellular matrix characterized by aligned fibers (Fig. 6A and B). The extracellular matrix protein COL3 was weakly expressed within the repairing area of the transplanted tendon. On the contrary, the COL1 proteins were more abundant and organized in fibers oriented along the longitudinal axis of the tendon even if with a lower density in comparison with the healthy tissue (Fig. 6C and D). Moreover, spindle-shaped cells localized in the repairing area were highly proliferating (Ki-67 positive) compared to the tenocytes localized in the healthy tendon (Fig. 6E). The blood vessels found in oAECs transplanted tendon were arranged amongst the neo-deposited extracellular

Table 4 Statistical analysis performed on US clinical parameters and athletic performances of horses transplanted with oAEC.

qs Athletic performance vs. MIZ Athletic performance vs. MIZ Athletic performance vs. MIZ Athletic performance vs. MIZ Athletic performance vs. MIZ Athletic performance vs. MIZ * MIZ ES T0 vs. MIZ ES T3 * MIZ CSA T0 vs. MIZ CSA T3 * MIZ FAS T0 vs. MIZ FAS T3

Fig. 5. Ultrasonographic images at three months of case n. 10: (A) longitudinal scan, (B) transverse scan.

ES T0 ES T3 CSA T0 CSA T3 FAS T0 FAS T3

0.647 0.802 0.389 0.713 0.802 0.670 0.677 0.505 0.597

The normalcy distribution of US parameters was assessed by D’Agostino and Pearson test before comparing them by Mann– Whitney U test. The correlation amongst the different data sets has been then assessed by Spearman Rank Correlation test. * p < 0.001 (T0 vs. T3).

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

165

Fig. 6. Representative microphotographs showing HE and Herovici histological and immunohistochemistry staining of longitudinal sections of a xenotransplanted SDFT with oAECs: on the left, behind the dotted line, it is visible the healthy tissue, on the right of the picture the healing tendon. (A) HE evidences aligned fusiform shaped tenocyte-like cells and nuclei. (B) Herovici staining shows the collagen fibers aligned along the longitudinal axis of the tendon with a similar staining density to that recorded in the healthy tissue. (C) COL3 immunoreaction reveals a weak staining in the repairing site, while it is absent in the healthy tendon. Nuclei were counterstained with DAPI. (D) In the extracellular matrix of the healing tendon abundant and parallel to the longitudinal axis of the tendon COL1 fibers were recorded with a similar staining density of the healthy tissue. Nuclei were counterstained with DAPI. (E) Proliferation marker Ki-67 positive spindle-shaped cells (green fluorescence, arrows) are evident in the healing tendon, one proliferating cell (green fluorescence, arrow) is also visible in the healthy tissue. Nuclei were counterstained with DAPI. A–E = Scale bar 100 lm. (F) Immunohistochemistry for the endothelial marker vWF (green fluorescence). Blood vessels were disposed parallel to the longitudinal axis of the tendon also in the healing area. Nuclei were counterstained with DAPI. Scale bar 100 lm.

matrix and oriented along the longitudinal axis of the tendon with a density similar to that recorded in the healthy tissue (Fig. 6F). Furthermore, PKH26 positive oAECs were retrieved at the periphery of the regenerating tendon. Most of the oAECs appeared as flattened cells, entrapped within newly deposited extracellular matrix. Some of them were in active mitosis since co-localized

with Ki-67 (Fig. 7A). More interestingly, transplanted oAeCs synthesized high levels of COL1 as indicated by the presence of the ovine protein within the cytoplasm of PKH26 positive cells and by the composition of some new deposited fibers recorded in the extracellular matrix (Fig. 7B). In fact, immunohistochemistry revealed that COL1 equine and ovine fibers co-existed within the

166

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

Fig. 7. Representative microphotographs of immunohistochemical staining showing retrieved and viable oAECs PKH26 labeled cells (positive red cells) in the xenotransplanted SDFT, and: (A) the proliferation marker Ki-67 (green fluorescence), nuclei were counterstained with DAPI. Flattened oAECs disposed parallel to the longitudinal axis of the tendon fibers can be seen; some PKH26- positive oAECs showed positive Ki-67 nuclei (cells indicated with arrows), it was also possible to observe neighboring proliferating cells. (B) A COL1 sheep specific antibody (green fluorescence), nuclei were counterstained with DAPI. Xenotransplanted oAECs PKH26 positive colocalized within their cytoplasm with sheep COL1 (cells indicated with arrows). Moreover, some new deposited sheep fibers were recorded in the extracellular matrix. (C) A COL1 horse specific antibody (green fluorescence), nuclei were counterstained with DAPI. Immunohistochemitry analysis revealed that equine COL1 fibers co-existed with PKH26-positive oAECs within the extracellular matrix in the repairing area. (D) the endothelial cell marker, vWF (green fluorescence), nuclei were counterstained with DAPI. Some PKH26 positive oAECs co-localized with the vWF (cells indicated with arrows) and were interspersed within and amongst the blood vessels present within the repairing area. A–D = Scale bar 25 lm. (E) The leukocyte marker CD45 (green fluorescence), nuclei were counterstained with DAPI. Few PKH26-positive cells co-localized with the CD45 leukocyte marker (cells indicated with arrows) indicative of an occurred phagocytosis. Scale bar 25 lm.

extracellular matrix deposited in the repairing area (Fig. 7C). This was confirmed by analyzing ovine and horse COL1 primers in order to confirm the contribution of the transplanted oAECs in the process of tendon regeneration. As shown in Fig. 8 the equine and ovine sequence of the gene was amplified in samples derived from equine healthy tendon (TE ctr), tendon grafted with oAECs

(TE + oAEC) and ovine adult tendon (TO ctr). Interestingly, using the primers designed on the COL1 ovine sequence, the presence of mRNA was clearly observed in the grafted tendon as indicated by a small band corresponding to the ovine gene amplified product of about 212 bp. Obviously no ovine amplified products were observed in the equine healthy tendon. In addition, some PKH26

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

Fig. 8. COL1 expression in xenotrasplanted tendon with oAECs. Analyses by RT-PCR of COL1 gene expression in equine xenotransplanted tendon with oAECs after 60 days from transplantation and in adult ovine, equine tendons or oAECs cells as controls. Species-specific primers (ovine or equine) for the gene were used. The images were representative of five independent experiments.

positive oAECs co-localized with the endothelial cell marker, vWF (Fig. 7D). oAECs transplantation did not promote any adverse immunological reaction in the patient since they were able to survive for 60 days from the injection and only few of them co-localized the with CD45 leukocyte marker, indicative of phagocytosis (Fig. 7E). 4. Discussion It is well known that tendons show a slower rate of recovery after injury/surgery compared to muscle (Silbernagel et al., 2006). The sub-acute reparative phase peaks after about 3 weeks (Fackelman, 1973) and leads to a scar tissue characterized by haphazardly arranged collagen, predominantly of type III (Smith, 2003). Thus, the maturation and remodeling phases of tendon healing can occur up to 12 months after tendon rupture (Enwemeka, 1989). It has been stated that clinically relevant outcome in horses can be influenced by rehabilitation program (Smith, 2008). Controlled exercise is considered important in the management of tendonitis (Gillis, 1997), even if specific training schedule like eccentric training described for Achilles mid portion tendinopathy in human (Maffulli and Longo, 2008), has not been designed for horses. oAECs transplantation associated with a careful rehabilitation program allowed a very good clinical outcome as confirmed by statistical analysis of US parameters, with the absence of any adverse reaction to oAECs xenotransplantation. However, controlled comparative trials are in progress, in order to evaluate the relative incidence of rehabilitation program in the healing process. As in several clinical trials, our approach lacks the validation of a CTR group; however, a rigorous literature (Smith, 2003) highlights that tendon lesions require long time for healing that occurs frequently through the synthesis of scar tissue. Hence, a CTR group should be very interesting but standardization of many parameters such as breed, age and discipline appears rather impossible in a clinical situation and for this reason metanalysis are more relevant. Alternatively, a preclinical study could have been approached but

167

the experimental defects present several differences from spontaneous lesions and the experimental animals are not subjected to sports disciplines. Even if the value of ultrasonography has been questioned for monitoring tendons (Smith et al., 2000; van Schie et al., 2009), the US evaluation of the tendon healing enables a critical assessment of the treatment (Reef, 2001) and it appeared well correlates with histopathological findings (Paavola et al., 1998). The comparison of the modifications of US features at baseline (T0) and 3 months after oAECs transplantation (T3) showed a significant improvement in FAS, ES and CSA parameters that were also confirmed by the histological analysis performed on the explanted tendon. The tissue explanted, in fact, showed a microarchitecture within the repairing site similar to healthy tissue even if the density of extracellular matrix remained lower at 60 days after cell implant. These findings can be considered expression of a precocious healing process and active regeneration/maturation of the tissue. The long term clinical and US follow-up, carried out in this study confirms that xenotransplanted oAECs are not teratogenous as it has been previously reported in other species (Parolini et al., 2009). Other relevant properties of fetal and amniotic cells are the low immunogenicity and the anti-inflammatory activity as shown by in vitro studies (Toda et al., 2007; Magatti et al., 2008; Insausti et al., 2010) and ex vivo experiments (Avila et al., 2001; Kubo et al., 2001). The low immunogenicity and the immunomodulatory properties of oAECs have been recently demonstrated by our group with in vitro and in vivo allografting studies respectively (Barboni et al., 2012a,b). The results of the present investigation, indirectly, confirms these assumptions. In fact transplanted oAECs survived for 60 days in the tendon defect clearly illustrating a medium term survival following xenogeneic transplantation. In addition, the presence of oAECs into an equine tendon did not stimulate a significant inflammatory reaction since only few cells resulted phagocytised at 60 days. Very interestingly grafted oAECs also showed to express vWF and ovine COL1. The expression of vWF shows the contribution of transplanted cells to the formation of endothelial cells, while the expression of COL1 clearly demonstrates that oAECs participate in the deposition of new collagen fibers in the repairing area. This result is in agreement with the in vitro ability of the oAECs to differentiate into tenocytes here demonstrated, for the first time, after a xeno co-culture with tenocytes (Barboni et al., 2010, 2012a). Furthermore, the presence of organized ovine COL1 fibers within the extracellular matrix of the grafted tendon shows that oAECs directly contributed to the process of tissue remodeling. However, this does not imply that oAECs cannot exert also a paracrine effect since both mechanisms can be hypothesized. In particular, the paracrine effect can be hypothesized by considering the high level of proliferation recorded in the repairing area involving either PKH26 positive or negative cells. The present study demonstrates also that oAECs can be stored by freezing without any impairment of their function. Thus, the banking of these cells would offer the opportunity to graft them in an early phase, that is considered important in producing a functional improvement (Hu et al., 2007). To our knowledge this is one of the first clinical studies focused on the transplantation of amniotic cells in spontaneous tendinopathies of large animals. Many questions still need to be addressed. An important one, in our opinion, is the precise definition of the nature of the tendinopathy, i.e. inflammatory vs. degenerative. Nonetheless the clinical benefit that can be obtained or hypothesized with multipotent cells from different sources starts to be clarified (Nixon et al., 2008; Smith, 2008; Crovace et al., 2010), and the most indicated phase of the disease to obtain the maximum effect is perhaps the main clinical question to answer. Finally, since equine SDFT tendinopathy has many similarities with Achilles tendinopathy in man (Dowling et al., 2000; Smith, 2008; Abate et al., 2009), the results obtained with the amniotic epithelial cells grafting in the equine model have

168

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169

a great translational value for human regenerative medicine. The results of this study show that oAECs isolated from pregnant sheep maintain a stable expression profile during culture and are able to differentiate toward the tenogenic lineage. When grafted into horses SDFT spontaneous defects, oAECs did not cause any adverse reaction and induced a rapid clinical and US improvement. The long term follow-up suggests a good functional correlation between the recovery of athletic performances and the regenerative process detected after three months from oAECs implantation. The results of the immunohistological and RT-PCR analyses performed on a tendon of a dead horse clearly demonstrate that transplanted cells can survive in the defect and directly contribute to COL1 synthesis. Taken together these data suggest that oAECs may be an useful source of cells for tendon regeneration strategies. Conflict of interest None of the authors have any conflicts of interest associated with this study. Acknowledgments This work was supported by a Tercas Foundation grant. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The Authors gratefully acknowledge the help of Oriana Di Giacinto and Delia Nardinocchi in providing a precious technical support. References Abate, M., Silbernagel, K., Siljeholm, C., Di Iorio, A., De Amicis, D., Salini, V., Werner, S., Paganelli, R., 2009. Pathogenesis of tendinopathies: Inflammation or degeneration? Arthritis Research & Therapy 11, 235. Avila, M., España, M., Moreno, C., Peña, C., 2001. Reconstruction of ocular surface with heterologous limbal epithelium and amniotic membrane in a rabbit model. Cornea 20, 414–420. Bailo, M., Soncini, M., Vertua, E., Signoroni, P.B., Sanzone, S., Lombardi, G., Arienti, D., Calamani, F., Zatti, D., Paul, P., Albertini, A., Zorzi, F., Cavagnini, A., Candotti, F., Wengler, G.S., Parolini, O., 2004. Engraftment potential of human amnion and chorion cells derived from term placenta. Transplantation 78, 1439–1448. Barboni, B., Curini, V., Russo, V., Mauro, A., Di Giacinto, O., Mattioli, M., 2012a. Tendon explants and tenocytes can program amnion derived stem cells towards stepwise tenogenic differentiation. PLoS One 7 (2), e30974. Barboni, B., Russo, V., Curini, V., Di Giacinto, O., Nardinocchi, D., Mauro, A., Berardinelli,P., Mattioli, M., 2010. Tendon explants can program amnion derived stem cells towards tenogenic differentiation. In: Proceedings of the Fifth Annual Transplantation Stem Cell Research Conference, New York, p. 43. Barboni, B., Russo, V., Curini, V., Mauro, A., Martelli, A., Muttini, A., Bernabò, N., Valbonetti, L., Marchisio, M., Di Giacinto, O., Berardinelli, P., Mattioli, M., 2012b. Achilles tendon regeneration can be improved by amniotic epithelial cells allotransplantation. Cell Transplantation, Apr 10. [Epub ahead of print]. Barone, R. (Ed.), 2001. Anatomie comparée des mammiferès domestique. Splancnologie. Vigot Frères, Paris, p. 91. Cremonesi, F., Corradetti, B., Lange Consiglio, A., 2011. Fetal adnexa derived stem cells from domestic animal: Progress and perspectives. Theriogenology 75, 1400–1415. Crovace, A., Lacitignola, L., Rossi, G., Francioso, E., 2010. Histological and immunohistochemical evaluation of autologous cultured bone marrow mesenchymal stem cells and bone marrow mononucleated cells in collagenase-induced tendinitis of equine superficial digital flexor tendon. Veterinary Medicine International. http://dx.doi.org/10.4061/2010/250978. Dowling, B.A., Dart, A.J., Hodgson, D.R., Smith, R.K., 2000. Superficial digital flexor tendonitis in the horse. Equine Veterinary Journal 32, 369–378. Dyson, S.J., 2004. Medical management of superficial digital flexor tendonitis: A comparative study in 219 horses. Equine Veterinary Journal 36, 415–419. Ely, E.R., Verheyen, K.L., Wood, J.L., 2004. Fractures and tendon injuries in National Hunt horses in training in UK: A pilot study. Equine Veterinary Journal 36, 365– 367. Enwemeka, C.S., 1989. Inflammation, cellularity, and fibrillogenesis in regenerating tendon: Implications for tendon rehabilitation. Physical Therapy 69, 816–825. Fackelman, G.E., 1973. The nature of tendon damage and its repair. Equine Veterinary Journal 5, 141–149. Gillis, C., 1997. Rehabilitation of tendon and ligament injuries. Proceedings of the Annual Convention of the American Association of Equine Practitioners 43, 306–309. Gomes, J.A., Romano, A., Santos, M.S., Dua, H.S., 2005. Amniotic membrane use in ophthalmology. Current Opinion in Ophthalmology 16, 233–240.

Guest, D.J., Smith, M.R.W., Allen, W.R., 2010. Equine embryonic stem-like cells and mesenchymal stromal cells have different survival rates and migration patterns following their injection into damaged superficial digital flexor tendon. Equine Veterinary Journal 42, 636–642. Guillot, P.V., Gotherstrom, C., Chan, J., Kurata, H., Fisk, N.M., 2007. Human firsttrimester fetal MSC express pluripotency markers and grow faster and have longer telomeres than adult MSC. Stem Cells 25, 646–654. Harris, M.T., Butler, D.L., Boivin, G.P., Florer, J.B., Schantz, E.J., Wenstrup, R.J., 2004. Mesenchymal stem cells used for rabbit tendon repair can form ectopic bone and express alkaline phosphatase activity in constructs. Journal of Orthopaedic Research 22, 998–1003. Hu, X., Wang, J., Chen, J., Luo, R., He, A., Xie, X., Li, J., 2007. Optimal temporal delivery of bone marrow mesenchymal stem cells in rats with myocardial infarction. European Association for Cardio-Thoracic Surgery 31, 438–443. Insausti, C.L., Blanquer, M., Bleda, P., Iniesta, P., Majado, M.J., Castellanos, G., Moraleda, J.M., 2010. The amniotic membrane as a source of stem cells. Histology and Histopathology 25, 91–98. Kasashima, Y., Takahashi, T., Smith, R.K., Goodship, A.E., Kuwano, A., Ueno, T., Hirano, S., 2004. Prevalence of superficial digital flexor tendonitis and suspensory desmitis in Japanese thoroughbred flat racehorses in 1999. Equine Veterinary Journal 36, 346–350. Kubo, M., Sonoda, Y., Muramatsu, R., Usui, M., 2001. Immunogenicity of human amniotic membrane in experimental xenotransplantation. Investigative Ophthalmology & Visual Science 42, 1539–1546. Luo, Q., Song, G., Song, Y., Xu, B., Qin, J., Shi, Y., 2009. Indirect co-culture with tenocytes promotes proliferation and mRNA expression of tendon/ligament related genes in rat bone marrow mesenchymal stem cells. Cytotechnology 61, 1–10. Maffulli, N., Longo, U.G., 2008. How do excentric exercises work in tendinopathy? Rheumatology 47 (10), 1444–1445. Magatti, M., De Munari, S., Vertua, E., Gibelli, L., Wengler, G.S., Parolini, O., 2008. Human amnion mesenchyme harbors cells with allogeneic T-cell suppression and stimulation capabilities. Stem Cells 26, 182–192. Majors, A.K., Boehm, C.A., Nitto, H., Midura, R.J., Muschler, G.F., 1997. Characterization of human bone marrow stromal cells with respect to osteoblastic differentiation. Journal of Orthopaedic Research 15, 546–557. McCarty, R.C., Gronthos, S., Zannettino, A.C., Foster, B.K., Xian, C.J., 2009. Characterisation and developmental potential of ovine bone marrow derived mesenchymal stem cells. Journal of Cellular Physiology 219, 324–333. Miki, T., Lehmann, T., Cai, H., Stolz, D.B., Strom, S.C., 2005. Stem cell characteristics of amniotic epithelial cells. Stem Cells 23, 1549–1559. Miki, T., Marongiu, F., Ellis, E.C., Strom, S., 2007. Isolation of amniotic epithelial stem cells. Current Protocols in Stem Cell Biology, Unit 1E.3 (Chapter 1). Miscia, S., Ciccocioppo, F., Lanuti, P., Velluto, L., Bascelli, A., Pierdomenico, L., Genovesi, D., Di Siena, A., Santavenere, E., Gambi, F., Ausili-Cèfaro, G., Grimley, P.M., Marchisio, M., Gambi, D., 2009. A beta (1–42) stimulated T cells express PPKC-delta and P-PKC-zeta in Alzheimer disease. Neurobiology of aging 30, 394– 406. Muttini, A., Mattioli, M., Petrizzi, L., Varasano, V., Sciarrini, C., Russo, V., Mauro, A., Cocciolone, D., Turriani, M., Barboni, B., 2010. Experimental study on allograft of amniotic epithelial cells in calcaneal tendon lesions of sheep. Veterinary Research Communications 34, S117–S120. Nixon, A.J., Dahlgren, L.A., Haupt, J.L., Yeager, A.E., Ward, D.L., 2008. Effect of adipose derived nucleated cell fractions on tendon repair in horses with collagenaseinduced tendinitis. American Journal of Veterinary Research 69, 928–937. Paavola, M., Paakkala, T., Kannus, P., Järvinen, M., 1998. Ultrasonography in the differential diagnosis of Achilles tendon injuries and related disorders. A comparison between pre-operative ultrasonography and surgical findings. Acta Radiologica 39, 612–619. Paris, D.B., Stout, T.A., 2010. Equine embryos and embryonic stem cells: Defining reliable markers of pluripotency. Theriogenology 74, 516–524. Parolini, O., Soncini, M., Evangelista, M., Schmidt, D., 2009. Amniotic membrane and amniotic fluid-derived cells: Potential tools for regenerative medicine? Regenerative Medicine 4, 275–291. Perfetto, S.P., Chattopadhyay, P.K., Lamoreaux, L., Nguyen, R., Ambrozak, D., Koup, R.A., Roederer, M., 2006. Amine reactive dyes: An effective tool to discriminate live and dead cells in polychromatic flow cytometry. Journal of Immunological Methods 313, 199–208. Plummer, C.E., 2009. The use of amniotic membrane transplantation for ocular surface reconstruction: A review and series of 58 equine clinical cases (2002– 2008). Veterinary Ophthalmology 12, 17–24. Rantanen, N.W., Jorgensen, J.S., Genovese, R.L., 2003. Ultrasonographic evaluation of the equine limb: Technique. In: Ross, M.W., Dyson, S.J. (Eds.), Diagnosis and Management of Lameness in the Horse. W.B. Saunders Co., Philadelphia, pp. 166–168. Reef, V.B., 2001. Superficial digital flexor tendon healing: Ultrasonographic evaluation of therapies. The Veterinary Clinics of North America Equine Practice 17, 159–178. Sankar, V., Muthusami, R., 2003. Role of human amniotic epithelial cells transplantation in spinal cord injury repair research. Neuroscience 118, 11–17. Silbernagel, K.G., Gustavsson, A., Thomeé, R., Karlsson, J., 2006. Evaluation of lower leg function in patients with Achilles tendinopathy. Knee Surgery, Sports Traumatology, Arthroscopy: Official journal of the ESSKA 14, 1207–1217. Smith, R.K., 2008. Mesenchymal stem cells therapy for equine tendinopathy. Disability and Rehabilitation 30, 1752–1758.

A. Muttini et al. / Research in Veterinary Science 94 (2013) 158–169 Smith, R.K.W., 2003. Pathophysiology of tendon injury. In: Ross, M.W., Dyson, S.J. (Eds.), Diagnosis and Management of Lameness in the Horse. Saunders & Co., Philadelphia, pp. 616–628. Smith, R.K.W., Birch, H.L., Patterson-Kane, J., Goodman, S., Cauvin, E.R., Goodship, A.E., 2000. A review of the aetiopathogenesis, and current proposed strategies for prevention of superficial digital flexor tendinitis in the horse. Proceedings of the Annual Convention of the American Association of Equine Practitioners 46, 54–58. Taylor, S.E., Vaughan-Thomas, A., Clements, D.N., Pinchbeck, G., Macrory, L.C., Smith, R.K., Clegg, P.D., 2009. Gene expression markers of tendon fibroblast in normal and diseased tissue compared to monolayer and three dimensional culture systems. BMC Musculoskeletal Disorders 10, 27. Toda, A., Okabe, M., Yoshida, T., Nikaido, T., 2007. The potential of amniotic membrane/amnion-derived cells for regeneration of various tissues. Journal of Pharmacological Sciences 105, 215–228.

169

van Schie, H.T.M., Bakker, E.M., Cherdchutham, W., Jonker, A.M., van de Lest, C.H., van Weeren, P.R., 2009. Monitoring of the repair process of surgically created lesions in equine superficial digital flexor tendons by use of computerized ultrasonography. American Journal of Veterinary Research 70, 37–48. Watts, A.E., Yeager, A.E., Kopyov, O.V., Nixon, A.J., 2011. Fetal derived embryoniclike stem cells improve healing in a large animal flexor tendonitis model. Stem Cell Research & Therapy 2, 4. Woo, S.L., Hilebrand, K., Watanabe, N., Fenwick, J.A., Papageorgiou, C.D., Wang, J.H., 1999. Tissue engineering of ligament and tendon healing. Clinical Orthopaedics and Related Research 367, S312–S323. Yuge, I., Takumi, Y., Koyabu, K., Hashimoto, S., Takashima, S., Fukuyama, T., Nikaido, T., Usami, S., 2004. Transplanted human amniotic epithelial cells express connexin 26 and Na–K-adenosine triphosphatase in the inner ear. Transplantation 77, 1452–1454.