Sunflower-seed oil, rapidly-degradable starch, and adiposity up-regulate leptin gene expression in lactating goats

Available online at www.sciencedirect.com

Domestic Animal Endocrinology 37 (2009) 93–103

Sunflower-seed oil, rapidly-degradable starch, and adiposity up-regulate leptin gene expression in lactating goats M. Bonnet, C. Delavaud, L. Bernard, J. Rouel, Y. Chilliard ∗ INRA, UR1213 Unité de Recherche sur les Herbivores, F-63122 St Genès Champanelle, France Received 21 January 2009; received in revised form 13 March 2009; accepted 17 March 2009

Abstract We conducted experiments to evaluate the effects of lipid supplementation and the nature of starchy concentrate on the regulation of leptin synthesis in lactating goats. Multiparous goats in mid- to late lactation received diets based on different forages and containing plant oil or seeds rich in either 18:1c9, 18:2n-6 or 18:3n-3 corresponding to 3%–7% dry matter (DM) as lipid supplements, or diets based on concentrate as either rapidly or slowly degradable starch. The isoenergetic replacement of a part of the concentrate by either oleic sunflower-seed oil, formaldehyde-treated linseeds, or linseed oil did not modify leptinemia and the leptin mRNA concentration in adipose tissues, suggesting a lack of effect of 18:1c9, 18:3n-3, or their biohydrogenation products. Conversely, leptinemia and the leptin mRNA abundance were increased (by 20% and 140%, respectively, P < 0.05) in goats fed sunflower-seed oil under a grassland hay-based diet but not a maize silage-based diet, at similar energy intakes and adiposity. Thus, 18:2n-6 per se may up-regulate leptin gene expression, but the effect could be blunted by other fatty acids formed during the ruminal digestion of sunflower-seed oil when combined with maize silage. Consumption of rapidly but not slowly degradable starch increased (by 17%, P < 0.05) leptinemia. Moreover, during lactation, plasma leptin was positively correlated (P < 0.05) to adiposity parameters and negatively correlated to fiber intake. The results suggest that leptinemia responds poorly to nutritional factors in lactating goats, thus highlighting the physiological need to sustain hypoleptinemia during lactation. © 2009 Elsevier Inc. All rights reserved. Keywords: Leptin; Goat; Lactation; Dietary fatty acids

1. Introduction Leptin is produced and secreted mainly by white adipose tissue in proportion to fat stores. Leptin was originally thought to act as the afferent signal in a feedback-loop-regulating adipose tissue mass by decreasing appetite and increasing energy expenditure. However, the ubiquitous distribution of leptin receptors in almost all tissues underlies the pleiotropism of leptin [1,2]. ∗ Corresponding author. Tel.: +33 4 73 62 41 14 fax: +33 4 73 62 45 19. E-mail address: [email protected] (Y. Chilliard).

0739-7240/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.domaniend.2009.03.002

In ewes and cows, as in monogastric species, circulating leptin concentrations are positively related to daily energy intake in the short term and degree of adiposity and plane of nutrition in the long term [3]. We recently reported that in goats, lactation per se strongly decreased plasma leptin whatever the lactation stage, energy balance, milk production level, and pregnancy status [4]. We hypothesized that this hypoleptinemia could serve to increase productive efficiency and energy conservation during all lactation stages, not only for mammary function but also to promote the replenishment of body reserves [3]. However, to ascertain that hypoleptinemia is a key determinant of energy metabolism during lactation, potentially usable in animal production, it is necessary to

94

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

determine whether leptinemia is regulated by extrinsic factors (nutrients, hormones) or intrinsic factors (adiposity) at either short or long term in lactating ruminants. To date, no relevant data have been published on goats, while the data available on lactating cows highlighted short-term regulations by extrinsic factors. Leptinemia during cow lactation was increased by jugular infusions of insulin [5,6], glucose [7], and propionate [8] and decreased by 3-day fasting or undernutrition [5]. Dietary lipids either increased [7], decreased [9], or had no effect [10–14] on cow plasma leptin depending on lipid type, energy balance, and lactation stage. Hence, to better understand the regulation of leptin gene expression during lactation in goats, the present study was designed with a 2-fold objective. First, we determined whether leptin gene expression in mid-lactating goats is modulated in the short-term by diets supplemented with starchy concentrate or diets containing plant oil or seeds rich in either 18:1c9, 18:2n-6, or 18:3n-3. Second, we examined the links between plasma leptin and body composition, blood, and milk parameters. These analyses allowed us to determine the major influencing factors involved in short- or long-term regulations of leptin gene expression during lactation in goats. 2. Materials and methods 2.1. Animals and diets Five different experiments were performed on multiparous Alpine goats: 4 mid-lactation trials and 1 late-lactation trial (Table 1). These trials were originally performed to evaluate the effect of nutrition, and particularly lipid supplementation, on milk fat composition (Table 1) and lipid metabolism in the mammary gland [15–18]. Briefly, goats from trial 1 were fed an alfalfa haybased diet with a 58:42 forage-to-concentrate ratio (dehydrated sugar beet pulp [47%], barley [29%], and soybean meal [24%]) (control diet), either with no additional lipid or supplemented with soybean seeds (rich in linoleic acid), representing an addition of 3.8% of dry matter (DM) as lipids for 3 weeks (Table 1, [15]). Goats from trials 2 to 5 were offered 3 experimental diets according to a 3 × 3 Latin square design with 21-d (trial 2) or 28-d (trials 3-5) experimental periods using 4 or 5 animals per group (Table 1). Each experimental period consisted of a 14-d (trial 2) or 21-d (trials 3-5) adaptation and a 7-d sampling period. Diets of trials 2 to 4 were composed of hay or maize silage (38%–58% of DM) offered ad libitum and a concentrate mixture (42%–62% of DM; dehydrated sugar beet pulp, barley, and soybean

meal; Table 1) with no additional lipids or supplemented with plant seeds or oils providing an addition of 3.33% to 6.38% of DM as lipids. Trial 2 contained oleic sunflowerseed oil or formaldehyde-treated linseed (rich in oleic and linolenic acid, respectively [16]), whereas trials 3 and 4 contained sunflower-seed oil or linseed oil (rich in linoleic and linolenic acid, respectively [18]). In trial 5, 3 diets supplemented with 130 g/d sunflower-seed oil (ie. 7.4% to 8.9% of diet DM, Table 1) differed in the amount and nature of the concentrate, in particular the ruminal degradability of starch (Table 1 and [17]). Concentrate types and levels were: 0.82 kg/d of DM as corn grain (30%), dehydrated sugar beet pulp (6%), soybean meal (35%), and flattened wheat (29%) for the control goats; 1.28 kg/d of DM as corn grain (79%), dehydrated sugar beet pulp (7%), and soybean meal (14%) for goats fed slowly degradable starch; 1.32 kg/d of DM as dehydrated sugar beet pulp (6%), soybean meal (14%), and flattened wheat (80%) for goats fed rapidly degradable starch. Natural grassland hay was offered ad libitum (see reference [18] for its description and composition). Diets were offered as 2 equal meals at 8:30 AM and 4:30 PM. The goats were housed in a metabolism unit in individual stalls with continuous access to water, and they were milked at 8:00 AM and 4:00 PM. Chemical composition of the milk and feed ingredients was determined using standard procedures outlined elsewhere [18]. Daily intakes and energy balances from each trial are reported in Table 1. All experimental procedures were approved by the Animal Care Committee of INRA in accordance with the Use of Vertebrates for Scientific Purposes Act 1985. At the end of the experiments, the goats were slaughtered. 2.2. Plasma measurements Blood samples were collected into EDTA tubes (Venoject, C.M.L, Nemours, France) from the jugular vein at 7:30 AM the day before slaughter to determine plasma insulin (mean intra- and interassay coefficients of variation were 8.6% and 10.2% respectively; INSIPR RIA kit, CIS bio International, Gif-sur-Yvette, France), leptin, and metabolites. Plasma leptin concentration was determined in duplicate according to the previously described disequilibrium double-antibody ovine-specific RIA validated for leptin determination in goat plasma [19]. The mean intra- and interassay coefficients of variation were 6.6% and 9.2%, respectively. Plasma concentrations of glucose, non-esterified fatty acids (NEFA), and beta-hydroxybutyrate (BHB) were determined enzymatically by the glucose dehydrogenase method (Glucose RTU kit; BioMérieux, Lyon, France),

Table 1 Diet composition, milking performance, and fatty acid composition of milk.

No. of goats Average DIM, d Forage Lipid Suppl. (+conc.) Forage % DM Concentrate % DM E.E. % DM Starch % DM Intake, kg DM/d 3.5% fat-corrected Milk, kg/d Energy balance, MJ/d Milk FA, % total FA C18:1 cis 9 C18:1 trans 10 C18:1 trans 11 Sum of C18:1 trans C18:2 n-6 C18:3 n-3

Trial 2

Trial 3

Trial 4

Trial 5

4 294 AH 58.58 41.42 b 1.94 b 7.4 1.82 2.01 1.05 a

4 294 AH S 51.51 48.49a 5.72a 5.1 1.53 2.15 -0.44 b

14 168 OH 55.59a 44.41a 2.00b 15.8 a 2.06 a 2.43 b 0.96

14 168 OH OSO 57.16a 42.84b 5.33a 11.7 b 1.99 b 2.56 a 0.92

14 168 OH FLS 54.23b 45.77a 5.48a 10.4 b 1.95 b 2.41 b 0.91

13 144 NH 44.23 55.77a 2.32a 12.4 a 2.28 3.21a 0.67

13 144 NH SO 48.17 51.71b 7.99b 6.9 b 2.25 3.52b 1.22

13 144 NH LO 48.25 51.55b 8.05b 6.9 b 2.23 3.45b 1.30

14 137 MS 38.27a 61.73a 2.00a 28.0 a 2.21a 3.15a 2.29

14 137 MS SO 45.07b 54.93b 8.23b 22.1 b 2.06b 3.31b 2.37

14 137 MS LO 44.83ab 55.17b 8.38b 22.0 b 2.03b 3.41b 1.87

14 153 NH SO 56.58a 43.62a 8.90a 16.4 b 1.94a 2.82a 1.52a

14 153 NH SO + SDS 37.25b 62.75b 8.38a 33.6 a 2.23b 3.12b 4.03b

14 153 NH SO + RDS 30.94c 69.06c 7.40b 31.8 a 2.06a 3.21b 2.47c

16.69b ns 0.71 – 1.98 0.72

23.63a ns 0.61 – 2.36 0.62

16.41c ns 1.08c – 1.99a 0.96b

25.24a ns 1.83b – 1.40c 0.69c

21.84b ns 2.09a – 1.92b 2.29a

16.85a 0.15 1.51c 2.34b 2.13 a 1.04 a

20.63b 0.08 9.02 a 11.49 a 2.24 b 0.57 b

17.99a 0.05 8.13b 10.76 a 1.38c 1.15a

13.71a 0.47a 1.11a 2.42c 2.41a 0.20

15.69b 3.23b 8.50b 14.15a 3.01b 0.15

15.25b 1.56a 5.36c 10.24b 1.92c 0.69

25.74a 0.88b 3.23a 6.01a 2.22b 0.32ab

22.75b 1.03b 1.98b 4.77b 2.19b 0.28b

19.84c 2.17a 0.96c 4.71b 2.60a 0.36a

Note: Values are means for samples taken in the last week of the experiment and were totally or partly published by Bernard et al. [15–18]. ns indicates trans 10 was not separated from trans 11 peak and was thus included in the trans 10 peak. Sum of C18:1 trans = C18:1 trans 4 to trans 14. Abbreviations: AH, alfalfa hay; Conc., concentrate; DIM, days into milking; DM, dry matter; E.E, ether extract; FA, fatty acid; FLS, formaldehyde-treated linseed; LO, linseed oil; MS, maize silage; NH, natural grassland hay; OH, orchardgrass hay; OSO, oleic sunflower-seed oil; RDS, rapidly degradable starch from flattened wheat; S, soybean seeds; SDS, slowly degradable starch from corn grain; SO, sunflower-seed oil, Suppl., supplementation. a,b,c Mean values within a row without common superscripts differ significantly (P < 0.05).

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

Trial 1

95

96

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

the acyl-CoA synthase method (Wako-Unipath NEFA-C kit; Oxoid, France), and the 3-hydroxybutyrate dehydrogenase method [20]. 2.3. Adipose tissue cellularity At slaughter, perirenal adipose tissue samples were immediately placed at 37 ◦ C, fixed by osmium tetraoxyde, and isolated by 8 M urea to determine adipocyte volume [21]. 2.4. Quantification of leptin mRNA abundance by real time quantitative RT-PCR At slaughter, samples of subcutaneous, perirenal, or omental adipose tissue were frozen in liquid nitrogen and stored at -80 ◦ C. Total RNA from adipose tissues was extracted as described previously [22]. Leptin mRNA abundance in adipose tissues was quantified by real-time quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) using the fluorescent TaqMan methodology and a LightCycler System according to a previously described procedure [23] using specific primers (Genosys Biotechnology, United Kingdom): 5 GTCAGCAATGGGTCAGTTGAG 3 (forward) and 5 TCCTCCTTTGTTCTGCTGCAC 3 (reverse) and a TaqMan probe: 5 CAGGACCAGCCCCCAGGAGCC 3 . Leptin transcript abudance was expressed as the ratio of leptin mRNA copy number to cyclophilin A mRNA copy number, a housekeeping gene, measured by realtime RT-PCR as described previously [22]. 2.5. Statistical analysis For trial 1, data reported for feed intake, milk production, metabolites, insulin, leptin and percent of fatty acids in the milk (Table 1) were subjected to analysis of variance (ANOVA) using the general linear models procedure (GLM) of the SAS software package, version 8.2 (SAS Institute, Cary, NC); the model included effect of the diet using pre-experimental period measurements as covariate. Means were compared using the least square means procedure of SAS software. Between-treatment differences in at-slaughter data on carcass adiposity, cellularity, and leptin mRNA abundance were tested using the nonparametric Wilcoxon U test, with differences considered significant at P < 0.05. For trials 2–5, data reported for feed intake, milk production, metabolites, insulin, leptin, and percent of fatty acids in the milk from the 3 experimental periods were subjected to ANOVA using the SAS software GLM procedure (SAS Institute, 2000) in a 3 × 3 Latin

square design. The model included the effects of diet, period, and goat. Means were compared using the least square means procedure (SAS, Institute, 2000), and level of significance was set at P < 0.05. Measurements of carcass adiposity, cellularity, and leptin mRNA abundance in adipose tissues collected at slaughter were tested using the nonparametric Wilcoxon U test, with differences considered significant at P < 0.05. Within-trial differences between adipose tissue sites for leptin mRNA abundance were tested using a paired t test, with differences considered significant at P < 0.05. Pooled data of the 5 trials obtained at slaughter were used to assess the relationship between plasma leptin concentrations and indices of body fatness or intake via linear regression using the GLM procedure (SAS Institute, 2000) once we had verified that the trial effect was not significant for these relationships. For these analyses, 3 goats showing the highest leptinemia values were excluded to avoid their influence on the relationships. Relationships were considered significant at P < 0.05. 3. Results 3.1. Effect of lipid supplements on plasma hormones and metabolites and on leptin mRNA abudance in adipose tissues The dietary consumption of soybean seeds (trial 1), oleic sunflower-seed oil (trial 2), sunflower-seed oil and linseed oil (trials 3 and 4), corresponding to an addition of 3%-7% lipids in DM intake, did not modify plasma insulin and glucose, but dietary consumption of formaldehyde-treated linseed slightly decreased (by 5%, P < 0.05) glucose concentration (trial 2, Table 2). The dietary consumption of sunflower-seed or linseed oils (trials 3 and 4, Table 2) decreased (P < 0.05) plasma acetate (by 7% to 25%) and ␤-hydroxybutyrate (by 14% to 22%) concentrations. Plasma NEFA was not modified by most of the lipid supplementations but was increased (by 50%, P < 0.05) by linseed oil in a maize silage-based diet (trial 4). The consumption of rapidly or slowly degradable starch increased (P < 0.05) plasma insulin (by 34% with slowly degradable starch) and glucose (by 7% with both types of starch) but did not modify ␤-hydroxybutyrate concentration (trial 5, Table 2). The consumption of slowly degradable starch led to higher (by 44%, P < 0.05) acetate and lower (by 52%, P < 0.05) NEFA (trial 5, Table 2) concentrations. Leptinemia and leptin mRNA abudance were not modified by the dietary consumption of soybean seeds (trial 1), oleic sunflower-seed oil, formaldehyde-treated

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

97

Fig. 1. Plasma leptin (ng/mL) and leptin mRNA (expressed as the ratio of leptin mRNA copy number to cyclophilin mRNA copy number, in arbitrary units [AU]) assayed in perirenal (PRAT), subcutaneous (SCAT), or omental (OMAT) adipose tissues of lactating goats fed different diets throughout 5 trials. Results for plasma leptin are means ± standard error of the mean (SEM) for samples taken on the last week of the experiment (n = 4 for trial 1 and n = 13 or 14 for trials 2 to 5). Results for leptin mRNA are means ± SEM for samples taken at slaughter (n = 4 or 5). A,B, or a,b,c : Mean values without common superscript letters differ significantly (P < 0.01 or P < 0.05, respectively).

linseed (trial 2), or linseed oil (trials 3 and 4) corresponding to an addition of 3%-7% lipids in DM intake (Fig. 1). Sunflower-seed oil increased both leptinemia (by 22%, P < 0.05) and leptin mRNA abudance (by 140%, P < 0.05) in perirenal adipose tissue when added

to a natural grassland hay-based diet (trial 3) but not a maize silage-based diet (trial 4). Leptinemia increased (by 17%, P < 0.05) in response to the consumption of concentrate as rapidly degradable starch (from flattened wheat) but not slowly degradable starch (from corn grain;

14 153 NH SO + SDS 3.34 ab 18.95a 3.44a 0.36a 0.15b 0.23 14 153 NH SO 3.04 b 14.08b 3.23b 0.25b 0.31a 0.20 No. of goats Average DIM, d Forage Lipid Suppl. (+ conc.) Leptin, ng/mL Insulin, ␮IU/mL Glucose, mM Acetate, mM NEFA, mM BHB, mM

4 294 AH – 2.56 20.63 3.58 ND 0.35 0.30

4 294 AH S 2.86 22.77 3.26 ND 0.32 0.27

14 168 OH – 2.42 17.45ab 3.24a ND 0.11 0.29

14 168 OH OSO 2.32 19.05a 3.23a ND 0.14 0.27

14 168 OH FLS 2.36 14.01b 3.09b ND 0.16 0.27

13 144 NH – 2.55 b 14.59 3.33 0.58a 0.22 0.36a

13 144 NH SO 3.10 a 17.14 3.27 0.54b 0.24 0.32ab

13 144 NH LO 2.81 ab 15.59 3.31 0.49b 0.23 0.28b

14 137 MS – 4.44 24.84 3.55 0.35a 0.18b 0.44a

14 137 MS SO 4.50 26.86 3.65 0.26b 0.23ab 0.38b

14 137 MS LO 4.43 22.87 3.67 0.27b 0.27a 0.38b

Trial 5 Trial 4 Trial 3 Trial 2 Trial 1

Table 2 Plasma hormones and metabolites of goats in 5 trials.

Note: Values are means for samples taken in the last week of the experiment. Abbreviations: AH, alfalfa hay; BHB, beta-hydroxybutyrate; Conc., concentrate; DIM, days into milking; FLS, formaldehyde-treated linseed; LO, linseed oil; MS, maize silage; ND, not determined; NEFA, non-esterified fatty acids; NH, natural grassland hay; OH, orchard grass hay; OSO, oleic sunflower-seed oil; RDS, rapidly degradable starch from flattened wheat; S, soybean seeds; SDS, slowly degradable starch from corn grain; SO, sunflower seed oil; Suppl., supplementation. a,b,c Mean values within a row without common superscripts differ significantly (P < 0.05).

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103 14 153 NH SO + RDS 3.57 a 17.59ab 3.44a 0.27b 0.24ab 0.21

98

Fig. 2. Relationship between concentration of plasma leptin and weight of omental plus perirenal adipose tissues at slaughter. The linear relationship (y = 0.29 x + 2.14, r = 0.45, root MSE = 0.80, P < 0.01) was assessed via the general linear models procedure of the SAS software package, version 8.2 (SAS Institute, Cary, NC) based on data pooled from trials 1-5 (black symbols). The grey symbols are data from 3 goats that were excluded from the regression analysis because of their influence on the relationship, which seemed to become quadratic for N = 63.

trial 5). However, these effects were not observed on leptin mRNA concentration (Fig. 1). Whatever the nutritional treatment, leptin mRNA abudance was lower in perirenal adipose tissue than in subcutaneous (trial 1) or omental (trial 5) adipose tissues (Fig. 1). 3.2. Weight and cellularity of adipose tissues Within trials, body weight, perirenal and omental adipose tissue weights, and diameter and number of perirenal adipocytes were not significantly different among nutritional treatments (Table 3). Carcass weight was different across treatments only in trial 4, being greater (by 20%, P < 0.05%) for goats fed linseed oil compared to those fed sunflower-seed oil, and intermediate, but not significantly different from either in goats receiving no lipid supplement (Table 3). 3.3. Relation between plasma leptin and body fatness or intake indices At slaughter, plasma leptin in individual goats was positively and linearly related (y = 0.29 x + 2.14, n = 60, P < 0.01, r = 0.45, explaining 21% of leptin variation) to body fatness estimated as the sum of omental and perirenal adipose tissue weights, up to a threshold of 6.3 kg (Fig. 2). Above this weight, the relation was believed to change, but the small amount of data did not permit determination whether the relation was linear or quadratic (Fig. 2). In the range of our data, similar relationships (P < 0.01, n = 60) were observed between

Notes: Values are means for samples taken at slaughter. Carcass weight is body weight minus weight of the digestive tract. Abbreviations: AH, Alfalfa hay; AT, adipose tissue; Conc., concentrate; FLS, formaldehyde-treated linseed; LO, linseed oil; MS, maize silage; NH, natural grassland hay; OH, orchardgrass hay; OSO, oleic sunflower-seed oil; SO, sunflower-seed oil; RDS, rapidly degradable starch from flattened wheat; S, soybean seeds; SDS, slowly degradable starch from corn grain; Suppl. = supplementation. a,b,c Mean values within a row without common superscripts differ significantly (P < 0.05).

2.95 89 1.79 101 1.83 107 1.25 120 1.09 124 1.00 129

2.48 100

1.43 120

1.03 128

1.58 116

1.07 133

1.98 112

1.16 128

1.63 126

5 NH SO 55.28 20.46 0.76 1.18 4 MS LO 63.53 26.80 a 1.94 3.68 5 MS – 58.94 24.76ab 2.03 3.75 5 NH – 56.98 22.40 0.88 1.44 4 OH – 55.23 21.15 0.72 1.11 4 AH S 47.91 19.95 1.31 1.90 4 AH – 48.80 20.10 1.19 1.88

No. of goats Forage Lipid Suppl. (+ conc.) Body weight, kg Carcass weight, kg Perirenal AT W, kg Omental AT W, kg Perirenal adipocytes: number, × 106 per g AT diameter, ␮m

Trial 2 Trial 1

Table 3 Carcass characteristics, adipose tissue weights, and cellularity.

5 OH OSO 54.50 22.76 1.06 1.71

5 OH FLS 52.68 21.84 1.05 1.65

Trial 3

4 NH SO 59.95 23.30 1.22 2.68

4 NH LO 61.83 24.00 0.86 1.65

Trial 4

5 MS SO 53.30 22.28 b 1.14 2.09

Trial 5

4 NH SO + SDS 57.53 21.90 0.89 1.60

5 NH SO + RDS 51.40 21.10 0.84 1.59

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

99

plasma leptin and other indices of body fatness: weight of omental (r = 0.50) or perirenal (r = 0.33) adipose tissues, and diameter (r = 0.35) of perirenal adipocytes (Table 4). Plasma leptin was negatively and linearly related to the quantity of crude fiber ingested (r = −0.41, P < 0.01; Table 4). Elsewhere, there were no significant relationships between plasma leptin concentrations in individual goats and either indices of energy balance, plasma concentration of metabolites and hormones, or milk concentration of the fatty acids, as presented in Tables 1 and 2. 4. Discussion Attempts could be made to meet energy requirements for maintenance and milk secretion in periparturient female ruminants by increasing dietary energy density via the addition of concentrates or fats. However, the effectiveness of these dietary strategies is frequently inconsistent due to increased milk energy secretion and/or decreased dry matter intake, energy balance, and adipose tissue mass [24]. It is thus necessary to better understand the impact of specific energy nutrients on the metabolic adaptations triggered to support the increased energy expenditure of lactating ruminant females. Among the recently described metabolic adaptations induced by lactation, a decrease in plasma leptin concentration has been reported in goats [4] and other ruminant females [3]. Leptin might be involved in the drawback of dietary fats due to its effects on appetite, energy metabolism, and adipose tissue mass. However, to date, results of only a few studies are available on the impact of energy nutrients on leptin gene expression in lactating ruminants, especially goats. The main finding of the present work is that leptin gene expression can be slightly modulated by lipid supplement or by concentrate type. Moreover, despite of the underlying hypoleptinemia, this study showed that plasma leptin during lactation was correlated with certain parameters of adiposity and nutrient intake in goats. In our study, as expected, there were slight but significant increases in milk linoleic (trial 1), oleic, and linolenic acids (trials 1, 2, 3 and 4; Table 1), which accounted for incomplete ruminal biohydrogenation followed by the transfer into plasma of the major unsaturated fatty acids consumed in the diets. However, oleic- or linolenic acid-rich fats (trials 2, 3, and 4) did not modify leptin mRNA and leptinemia in goats, which is in line with the lack of effect of dietary canola (oleic acid-rich, [11]) or linseed (linolenic acid-rich, [13]) oils on leptinemia in cows from mid- to late lactation. Furthermore, we recorded a slight decrease in DM intake

100

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

Table 4 Means and ranges of the variables that were linearly correlated with plasma leptin at slaughter. Relationship Variables (N = 60)

Mean

Range

Omental AT W, kg Perirenal AT W, kg Perirenal adipocyte diameter, ␮m Crude fiber ingested, g

1.74 1.02 116 352

0.21–4.52 0.26–2.33 71–172 170–639

a

b

r

Root MSE

P value

0.51* 0.52* 0.0137* −0.0034*

2.05* 2.41* 1.35* 4.15*

0.50 0.33 0.35 −0.41

0.77 0.85 0.84 0.81

<0.01 <0.01 <0.01 <0.01

Notes: Mean and range of the variables pooled from trials 1 to 5 (N = 60, i.e. without 3 samples where leptin concentrations were greater than 10 ng/mL). Mean value of plasma leptin was 2.94 ng/mL (range 1.39–5.43). Regression analyses were assessed by the GLM procedure in the SAS software package. a and b are terms of the equation y = ax + b, and r is the correlation coefficient. P value of the model is given. Abbreviations: AT, adipose tissue; root MSE, root mean standard error. * P < 0.01.

(trials 1 and 4) without any variation of plasma leptin in dietary fat supplemented-goats, which excludes leptin as a mediator of the hypophagic effect of lipids, in agreement with data from late-lactating cows [11]. Elsewhere, linoleic acid-rich fat either did not modify (trials 1 and 4) or increased (trial 3) both leptinemia and adipose tissue leptin mRNA abundance without any change in body fatness. The rare studies available in lactating cows or heifers have reported contrasting results on the linoleic acid-rich fat-mediated regulation of leptinemia. Indeed, no variations of leptinemia were observed in heifers fed a high-concentrate diet supplemented with either sunflower-seed [25] or corn oils [26]. In cows, leptinemia was rapidly increased by a jugular infusion of an aqueous emulsion containing 50% linoleic acid in late but not early lactation [7]. This finding suggests that linoleic acid could stimulate leptin gene expression in lactating goats (present study) and cows [7], as observed in nutritional studies in rodents [27–29] and in the primary culture of bovine adipocytes under particular hormonal conditions [30]. Results reported in cows [7] and goats (present study) suggest that the stimulatory effect of linoleic acid on leptin gene expression depends both on the physiological status or energy balance of the lactating females and on the interaction between linoleic acid-rich fat and forage source. Indeed, the positive effect of linoleic acid-rich fats on leptin gene expression seems to be blunted in lactating females under negative energy balance. This is strongly suggested by the lack of leptinemia variation in soybean seed-supplemented goats in the present study (trial 1) and in early lactating cows infused with an aqueous emulsion containing 50% linoleic acid, whereas leptinemia increased in late-lactating cows [7]. Moreover, plasma leptin and adipose tissue leptin mRNA concentrations were increased without any change in

body fatness or energy balance in goats fed sunflowerseed oil when it was added to diets based on natural grassland hay (trial 3), but not on maize silage (trial 4). Given that the increased concentration of linoleic acid in milk in response to sunflower-seed oil was much greater in the maize silage- than the hay-based diet (trial 4 vs 3, Table 1), it could be hypothesized that other nutrients and hormones in addition to linoleic acid also modulated the sunflower-seed oil effect on leptin gene expression. Among these additional mediators, insulin, glucose, acetate, ␤-hydroxybutyrate, and NEFA can be excluded due to the lack of variation in plasma concentrations of these metabolites when leptin gene expression was increased in goats fed a hay-based diet supplemented with sunflower-seed oil (Table 1, trial 3). Similarly, the increase in leptinemia in linoleic acidinfused late-lactating cows was shown to be independent of plasma insulin or glucose [7]. Our results therefore suggest that intermediate fatty acids formed during the ruminal metabolism of sunflower-seed oil in interaction with the forage source may act as mediators of sunflowerseed oil’s effect on leptin gene expression. Indeed, in response to sunflower-seed oil, the milk concentrations of trans-10, cis-12 conjugated linoleic acid (CLA) and of total trans-C18:1 isomers increased far more dramatically in goats fed a maize silage-based compared to grassland hay-based diet (Table 1 and [18]). Although the abomasal infusion of trans-10 cis-12 CLA did not modify plasma leptin [10], the dietary consumption of trans-C18:1 mix (trans-6 to trans-12 isomers) sharply decreased [9] plasma leptin in lactating cows. Taken together, these results suggest that the linoleic acidmediated up-regulation of leptin gene expression could be blunted, at least in part, by the inhibitory effect of trans-C18:1 isomers produced during the ruminal biohydrogenation of linoleic acid added to maize silage-based or low-fiber diets.

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

In goats supplemented with sunflower-seed oil (around 8% of diet DM), plasma leptin was increased when part of the forage was replaced by concentrate in the form of rapidly degradable starch (flattened wheat), but not slowly degradable starch (corn grain; trial 5). This finding was observed without any variation in body fatness or dietary intake, but with an increase in energy balance. However, the highest energy balance was observed in goats fed with slowly degradable starch without an increase in leptinemia. Thus, the stimulatory effect of rapidly degradable starch on leptinemia likely results from a direct effect of the diet rather than from the increased energy balance. Among the hormones and metabolites assayed as candidate mediators of the effect of rapidly degradable starch, there were no between-diet differences in plasma insulin, glucose, and NEFA. Conversely, milk linoleic acid was maximized whereas the sum of milk trans-C18:1 isomers was low with the rapidly degradable starch-rich diet (Table 1). These results add further evidence for an up-regulation of leptinemia by linoleic acid when trans-C18:1 isomer concentrations remain low. Surprisingly, we found an inverse relationship between plasma leptin and quantity of crude fiber ingested (Table 4). This finding could be explained by increased ruminal synthesis [31] and net portal appearance [32] of propionate at the expense of acetate and butyrate when dietary fiber content decreases. A slight increase in plasma propionate could up-regulate plasma leptin in the short term in lactating goats, as observed in lactating cows following the intraruminal infusion of propionate [8]. Our data also bring new results on goat leptin gene expression, depending on the anatomical site of adipose tissue. The greater leptin mRNA concentration in goat subcutaneous or omental adipose tissue compared to perirenal adipose tissue, contrasts with data in cows reporting either a lack of difference in leptin gene expression between anatomical sites of adipose tissue [33] or a greater expression in perirenal than subcutaneous adipose tissue [34,35]. However, our results in goats are in agreement with the greater expression observed in subcutaneous versus perirenal adipose tissue in sheep [36,37] and in humans (see [38] for review). We also show that despite the hypoleptinemia during lactation [4], plasma leptin was positively and linearly correlated with indices of body fatness, including weight of perirenal and omental adipose tissues, as well as with the diameter of perirenal adipocytes. These are the first relationships described in lactating goats, and the results concur with the sole study in lactating cows reporting a positive and linear correlation between plasma lep-

101

tin and body condition score [39]. However, even if it remains to be confirmed on a larger set of animals, the trend recorded from our limited results obtained in the fattest goats suggests these relationships are likely to become curvilinear across a larger range of body fatness. Curvilinear relationships have been described in adult dry, nonpregnant ewes between plasma leptin and body lipids [40] and in dry, nonpregnant cows between plasma leptin and adipocyte volume [41]. The cause-effect relationship between body fatness and plasma leptin remains to be unraveled. Adipocyte diameter, which contributes to adipose tissue mass, could be a candidate factor for long-term regulation of plasma leptin in lactating goats, as previously suggested in dry cows [41]. In conclusion, this study allowed us to rank intrinsic and extrinsic factors modulating leptin gene expression during lactation in goats, in the short or long term. In the short term, despite hypoleptinemia during lactation, plasma leptin could be up-regulated by nutrients such as linoleic acid and/or propionate, which could mediate the stimulatory effect of sunflower oil added to a grassland hay-based diet or of rapidly degradable starch. The stimulatory effect of linoleic acid could, however, be blunted by trans-C18:1 isomers. In the long term, plasma leptin could be partly up-regulated by adipose tissue mass in lactating goats. This study emphasizes that plasma leptin is still regulated by nutrition and adiposity during lactation, and that these regulations occur despite the hypoleptinemia resulting from this physiological state. Acknowledgements The authors thank the staff of the INRA “Les Cèdres” experimental unit for their diligent care of experimental animals, and the staff of the INRA experimental slaughterhouse. We also thank K. Mouzat, C. Sosa, M. Tourret, and D. Bany for their technical assistance; A. Gertler for kindly donating ovine recombinant leptin; and F. Glasser for helpful discussions. References [1] Zieba DA, Amstalden M, Williams GL. Regulatory roles of leptin in reproduction and metabolism: A comparative review. Domest Anim Endocrinol 2005;29:166–85. [2] Fruhbeck G. Intracellular signalling pathways activated by leptin. Biochem J 2006;393:7–20. [3] Chilliard Y, Delavaud C, Bonnet M. Leptin expression in ruminants: nutritional and physiological regulations in relation with energy metabolism. Domest Anim Endocrinol 2005;29:3–22. [4] Bonnet M, Delavaud C, Rouel J, Chilliard Y. Pregnancy increases plasma leptin in nulliparous but not primiparous goats while lactation depresses it. Domest Anim Endocrinol 2005;28:216–23.

102

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103

[5] Block SS, Rhoads RP, Bauman DE, et al. Demonstration of a role for insulin in the regulation of leptin in lactating dairy cows. J Dairy Sci 2003;86:3508–15. [6] Leury BJ, Baumgard LH, Block SS, et al. Effect of insulin and growth hormone on plasma leptin in periparturient dairy cows. Am J Physiol Regul Integr Comp Physiol 2003;285:R1107–1115. [7] Chelikani PK, Keisler DH, Kennelly JJ. Response of plasma leptin concentration to jugular infusion of glucose or lipid is dependent on the stage of lactation of Holstein cows. J Nutr 2003;133:4163–71. [8] Bradford BJ, Oba M, Ehrhardt RA, Boisclair YR, Allen MS. Propionate is not an important regulator of plasma leptin concentration in dairy cattle. Domest Anim Endocrinol 2006;30:65–75. [9] Selberg KT, Staples CR, Luchini ND, Badinga L. Dietary trans octadecenoic acids upregulate the liver gene encoding peroxisome proliferator-activated receptor-alpha in transition dairy cows. J Dairy Res 2005;72:107–14. [10] Baumgard LH, Corl BA, Dwyer DA, Bauman DE. Effects of conjugated linoleic acids (CLA) on tissue response to homeostatic signals and plasma variables associated with lipid metabolism in lactating dairy cows. J Anim Sci 2002;80:1285–93. [11] Chelikani PK, Glimm DR, Keisler DH, Kennelly JJ. Effects of feeding or abomasal infusion of canola oil in Holstein cows 2. Gene expression and plasma concentrations of cholecystokinin and leptin. J Dairy Res 2004;71:288–96. [12] Kokkonen T, Taponen J, Tuori M, Lohenoja S, Kulcsar M, Delavaud C, Chilliard Y, Tesfa T. Effects of fat supplementation in early lactation dairy cows. J Anim Feed Sci 2004;13:499–502. [13] Loor JJ, Ferlay A, Ollier A, Doreau M, Chilliard Y. Relationship among trans and conjugated fatty acids and bovine milk fat yield due to dietary concentrate and linseed oil. J Dairy Sci 2005;88:726–40. [14] Kay JK, Roche JR, Moore CE, Baumgard LH. Effects of dietary conjugated linoleic acid on production and metabolic parameters in transition dairy cows grazing fresh pasture. J Dairy Res 2006;73:367–77. [15] Bernard L, Leroux C, Bonnet M, Rouel J, Martin P, Chilliard Y. Expression and nutritional regulation of lipogenic genes in mammary gland and adipose tissues of lactating goats. J Dairy Res 2005;72:250–5. [16] Bernard L, Rouel J, Leroux C, et al. Mammary lipid metabolism and milk fatty acid secretion in alpine goats fed vegetable lipids. J Dairy Sci 2005;88:1478–89. [17] Bernard L, Rouel J, Ferlay A, Chilliard Y. Effects of concentrate level and starch degradability on milk yield and fatty acid (FA) composition in goats receiving a diet supplemented with sunflower oil. In: van der Honing Y, editor. Book of Abstracts, 56th Annual Meeting of European Association for Animal Production, Uppsala, Sweden, June 5-8, 2005. Wageningen Acad. Publ. (NL); 2005. p. 161. [18] Bernard L, Shingfield KJ, Rouel J, Ferlay A, Chilliard Y. Effect of plant oils in the diet on performance and milk fatty acid composition in goats fed diets based on grass hay or maize silage. Br J Nutr 2009;101:213–24. [19] Delavaud C, Bocquier F, Chilliard Y, Keisler DH, Gertler A, Kann G. Plasma leptin determination in ruminants: effect of nutritional status and body fatness on plasma leptin concentration assessed by a specific RIA in sheep. J Endocrinol 2000;165:519–26. [20] Barnouin J, El Idilbi N, Chilliard Y, Chacornac JP, Lefaivre R. Micro-dosage automatisé sans déprotéinisation du 3hydroxybutyrate plasmatique chez les bovins (An automated micro-method for the determination of 3-hydroxybutyrate in

[21]

[22]

[23]

[24] [25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

bovine plasma without acid precipitation). Ann Rech Vet 1986;17:129–39. Robelin J. Cellularity of bovine adipose tissues: developmental changes from 15 to 65 percent mature weight. J Lipid Res 1981;22:452–7. Bonnet M, Leroux C, Faulconnier Y, et al. Lipoprotein lipase activity and mRNA are up-regulated by refeeding in adipose tissue and cardiac muscle of sheep. J Nutr 2000;130:749–56. Bonnet M, Gourdou I, Leroux C, Chilliard Y, Djiane J. Leptin expression in the ovine mammary gland: putative sequential involvement of adipose, epithelial and myoepithelial cells during pregnancy and lactation. J Anim Sci 2002;80:723–8. Chilliard Y. Dietary fat and adipose tissue metabolism in ruminants, pigs, and rodents: a review. J Dairy Sci 1993;76:3897–931. Garcia MR, Amstalden M, Morrison CD, Keisler DH, Williams GL. Age at puberty, total fat and conjugated linoleic acid content of carcass, and circulating metabolic hormones in beef heifers fed a diet high in linoleic acid beginning at four months of age. J Anim Sci 2003;81:261–8. Gillis MH, Duckett SK, Sackmann JR, Realini CE, Keisler DH, Pringle TD. Effects of supplemental rumen-protected conjugated linoleic acid or linoleic acid on feedlot performance, carcass quality, and leptin concentrations in beef cattle. J Anim Sci 2004;82:851–9. Cha MC, Jones PJ. Dietary fat type and energy restriction interactively influence plasma leptin concentration in rats. J Lipid Res 1998;39:1655–60. Takahashi Y, Ide T. Effect of dietary fats differing in degree of unsaturation on gene expression in rat adipose tissue. Ann Nutr Metab 1999;43:86–97. Rodriguez VM, Pico C, Portillo MP, Teresa Macarulla M, Palou A. Dietary fat source regulates ob gene expression in white adipose tissue of rats under hyperphagic feeding. Br J Nutr 2002;87:427–34. Soliman M, Kimura K, Ahmed M, et al. Inverse regulation of leptin mRNA expression by short- and long-chain fatty acids in cultured bovine adipocytes. Domest Anim Endocrinol 2007;33:400–9. Sutton JD, Dhanoa MS, Morant SV, France J, Napper DJ, Schuller E. Rates of production of acetate, propionate, and butyrate in the rumen of lactating dairy cows given normal and low-roughage diets. J Dairy Sci 2003;86:3620–33. Loncke C, Ortigues-Marty I, Vernet J, Lapierre H, Sauvant D, Noziere P. Empirical prediction of net portal appearance of volatile fatty acids, glucose, and their secondary metabolites (beta-hydroxybutyrate, lactate) from dietary characteristics in ruminants: a meta-analyses approach. J Anim Sci 2009;87:253–68. Ji S, Willis GM, Scott RR, Spurlock ME. Partial cloning and expression of the bovine leptin gene. Anim Biotechnol 1998;9:1–14. Kim H, Chi Y, Chung K, Kim K, Choi Y, Baik M. Differential response of obese gene expression from fasting in bovine adipose tissues. Biosci Biotechnol Biochem 2000;64:2240–2. Yang S, Matsui T, Kawachi H, Yamada T, Nakanishi N, Yano H. Fat depot-specific differences in leptin mRNA expression and its relation to adipocyte size in steers. Anim Sci J 2003;74:17–21. Kumar B, Francis SM, Suttie JM, Thompson MP. Expression of obese mRNA in genetically lean and fat selection lines of sheep. Comp Biochem Physiol B Biochem Mol Biol 1998;120:543–8. Lemor A, Mielenz M, Altmann M, Von Borel E, Sauerwein H. Differential expression of adiponectin, adiponectin receptor 1

M. Bonnet et al. / Domestic Animal Endocrinology 37 (2009) 93–103 (Adipor1) and leptin mRNA in different adipose depots in sheep. J Anim Sci 2007;85:449. [38] Chilliard Y, Bonnet M, Delavaud C, et al. Leptin in ruminants. Gene expression in adipose tissue and mammary gland, and regulation of plasma concentration. Domest Anim Endocrinol 2001;21:271–95. [39] Meikle A, Kulcsar M, Chilliard Y, et al. Effects of parity and body condition at parturition on endocrine and reproductive parameters of the cow. Reproduction 2004;127:727–37.

103

[40] Delavaud C, Bocquier F, Baumont R, Chaillou E, Ban-Tokuda T, Chilliard Y. Body fat content and feeding level interact strongly in the short- and medium-term regulation of plasma leptin during underfeeding and re-feeding in adult sheep. Br J Nutr 2007;98:106–15. [41] Delavaud C, Ferlay A, Faulconnier Y, Bocquier F, Kann G, Chilliard Y. Plasma leptin concentration in adult cattle: effects of breed, adiposity, feeding level, and meal intake. J Anim Sci 2002;80:1317–28.