- Email: [email protected]
Α 2-stage, nested-like nucleic acid amplification method (IsoPCR) for the highly sensitive detection of HPV16 and HPV18 DNA
Molecular and Cellular Probes 45 (2019) 1–7
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Original research article
Α 2-stage, nested-like nucleic acid amplification method (IsoPCR) for the highly sensitive detection of HPV16 and HPV18 DNA
T
M. Daskoua, D. Tsakogiannisa,∗, T.G. Dimitrioua, M. Manalia, C. Aptia, G.D. Amoutziasb, D. Mossialosa, C. Kottaridic, P. Markoulatosa a
University of Thessaly, School of Health Sciences, Department of Biochemistry & Biotechnology, Microbiology-Virology Laboratory, Biopolis, 41500, Larissa, Greece Bioinformatics Laboratory, University of Thessaly, School of Health Sciences, Department of Biochemistry & Biotechnology, Biopolis, Larissa, Greece c Department of Cytopathology, National and Kapodistrian University of Athens, Medical School, “ATTIKON” University Hospital, 1 Rimini, Haidari, 12462, Athens, Greece b
A R T I C LE I N FO
A B S T R A C T
Keywords: IsoPCR LAMP HPV genotyping HPV16 HPV18 Cervical dysplasia
Molecular detection of HPV DNA is considered as the gold standard for the diagnosis of cervical disease. Although the molecular assays for the identification of HPV16 and HPV18 have helped identify cervical cancer incidents, they are restricted to specialized laboratories. Thus, we developed a novel 2-stage, nested-like nucleic acid amplification method, named IsoPCR, to amplify the E6 gene of HPV16 and HPV18 with high analytical sensitivity and specificity. The performance of IsoPCR was compared to that of conventional PCR and LAMP. The analytical sensitivity of IsoPCR (1 copy/test) was 10-fold higher than conventional PCR and 25-fold higher than conventional LAMP. IsoPCR displayed significant amplification specificity (100%) and efficiency, as well. In conclusion, IsoPCR is a highly sensitive and specific diagnostic tool and it is suitable for the detection of low copy number of viral DNA in clinical specimens, providing critical information to healthcare providers.
1. Introduction Human Papillomaviruses (HPVs) are small, non-enveloped, capsidenclosed, icosahedral, double stranded DNA viruses that infect the mucosal and cutaneous epithelia [1,2]. It is widely accepted that persistent infection with high-risk (HR) HPV genotypes is the major causative agent for cervical cancer which is the second leading cause of cancer-related death among women worldwide [3]. Epidemiological analyses have revealed that HPV16 and HPV18 are the two most carcinogenic genotypes, accounting for about 50% and 20% of cervical cancer cases, respectively [4,5]. Although cytology-based tests have reduced the cervical cancer incidents and mortality rates, they exhibit low specificity and variable levels of sensitivity (30–87%) [6,7]. The causal role of HR-HPV infections in cervical disease growth triggered the development of molecular assays that lie mainly on the detection of HPV DNA and RNA [8]. Molecular detection of HPV DNA is currently the gold standard for viral identification and exhibits higher analytical sensitivity (84–100%) than cytological tests [8–11]. Nowadays, several molecular assays have been commercialized and used in HPV diagnosis, while the US FDA has approved a total of five different
HPV molecular assays including the Hybrid Capture 2 (HC2), Cervista™ HPV HR and Genfind™ DNA Extraction Kit, Cobas HPV, APTIMA HPV Assay [8,12,13]. It is noteworthy, that research and clinical laboratories mainly use Polymerase Chain Reaction assay (PCR) in HPV genotyping, since it is regarded as a cost effective, non labor-intensive technique that requires non-sophisticated equipment and confers high analytical sensitivity and specificity in the detection of HPV genotypes [8]. Loop-mediated isothermal amplification (LAMP) is an appealing molecular method for the amplification of small nucleic-acid targets under isothermal conditions and was recently introduced to the field of HPV-DNA identification [14–17]. LAMP reaction is based on strand displacement by a Bst DNA polymerase under isothermal conditions with a temperature range between 60 °C to 70 °C. Moreover, the assay requires a set of four (or six) different primers that bind to six (or eight) different regions on the target gene, thus increasing the specificity of the methodology. In particular, LAMP comprises an outer primer set (forward outer primer - F3 and backward outer primer - B3), an inner primer set (forward inner primer - FIP and backward inner primer – BIP) and/or a set of loop primers (loop forward primer - LF and loop backward primer - LB) [18–20]. The reaction can be completed within
Abbreviations: LAMP, Loop-mediated isothermal amplification; FIP, forward inner primer; BIP, backward inner primer; F3, forward outer primer; B3, backward outer primer; LF, loop forward primer; LB, loop backward primer; GuSCN, guanidine thiocyanate; HPV, Human papillomavirus. ∗ Corresponding author. E-mail addresses: [email protected], [email protected] (D. Tsakogiannis). https://doi.org/10.1016/j.mcp.2019.03.003 Received 14 November 2018; Received in revised form 20 January 2019; Accepted 14 March 2019 Available online 19 March 2019 0890-8508/ © 2019 Elsevier Ltd. All rights reserved.
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
gov), while the complete E6 ORF of the reference sequence of HPV18 DNA was obtained from Genbank database (accession number NC_ 001357). The specificity of the E6 type-specific LAMP primer was evaluated with the MEGA BLAST algorithm within NCBI website. Each set of E6 LAMP type-specific primers consists of two outer (F3, B3) and two inner (FIP, BIP) primers (Table 2).
1 h using simple and inexpensive equipment such as a heating dry block and it demonstrates high analytical sensitivity (10 copies of viral genomes/reaction) [21]. Recently, a 2-stage, nested-like nucleic acid amplification method, named IsoPCR has been developed [22] for the amplification of nucleic acid targets with improved limit of detection and shorter amplification time, than conventional PCR. The assay is accomplished in two stages, merging the advantages of PCR and LAMP and is considered as a point of care method [22]. The present study focuses on the development of a point of care method that is based on the IsoPCR, for the specific detection of the E6 gene of HPV16 and HPV18. The proposed protocol combined the advantages of both PCR and LAMP and comprises a first stage of PCR for a limited number of cycles (10 cycles) that is followed by a second stage of LAMP. We investigated the analytical sensitivity, specificity and potential for clinical amplification of this new IsoPCR method and compared it to conventional PCR and LAMP assays.
2.4. Quantitative Real-Time PCR for HPV16 and HPV18 genotyping The outer E6 type-specific F3/B3 primer sets were used to establish a quantitative Real-Time PCR protocol for the detection of HPV16 and HPV18 DNA as well as to calculate the copy numbers of viral DNA in the examined cervical samples. All cervical samples were tested in duplicate. Both quantitative Real-Time PCR assays were conducted on the Mx3005P@ instrument and were carried out in a final volume of 20 μl. Briefly, each Real-Time PCR mixture contained 5 pmol of outer primer set, 2Χ Master Mix (SYBR Select qPCR Master Mix Kit, Thermo Fischer Scientific Inc., Massachusetts, USA) and ROX Reference Dye. The cycling conditions were as follows: An initial denaturation step at 95 °C for 2 min followed by 40 cycles in two steps: 95 °C for 15s, and 60 °C for 1min. Data acquisition at 510 nm was performed at anneal/ extension step (60 °C). The melting curve was generated by heating from 55 °C to 95 °C in increments of 2 °C. The total run time was 110 min including the time needed for melting temperature analysis. In order to confirm the outcomes of Real-Time PCR, the amplicons were monitored in a 2% agarose gel electrophoresis stained with 1 μg/ ml of ethidium bromide in Tris-borate-EDTA buffer using a 100-bp DNA ladder as a molecular weight marker (Invitrogen, Life Technologies, Paisley, UK). The HPV16 F3/B3 primer set generated a fragment of 206bp in size, while the HPV18 F3/B3 yielded a fragment of 201bp in size (Table 2).
2. Materials and methods 2.1. Cervical samples and DNA extraction Cervical specimens were obtained from 129 women positive for HPV infection. The women attended the colposcopy clinic of the 3rd Department of Gynecology and Obstetrics in the tertiary care “ATTIKON” University General Hospital between June 2013 and June 2017 (Table 1). The study population did not represent a normally screened population, since most patients attended the outpatient clinics after a referral abnormal cytology and or colposcopy. Moreover, a total of twenty-two cervical samples with normal cytology and without HPV infection were incorporated in the present study, as well. All patients signed an informed consent form and the study was approved by the Bioethics committee of the hospital (Approval number 5/14-06-2013).
2.5. A 2-stage nested-like nucleic acid amplification assay (IsoPCR)
2.2. DNA isolation and HPV16 and HPV18 genotyping
Cervical specimens that were found to be positive with quantitative Real-Time PCR were used in order to develop the IsoPCR assay. This assay consists of a first step of a preamplification PCR and a second step of LAMP assay, for the isothermal amplification of the specific nucleotide target. More specifically, the first-stage PCR was performed in a final volume of 50 μl. Each PCR mixture consisted of 25 pmol of inner primer set (FIB/BIP), 10 X PCR buffer (DreamTaq DNA Polymerase, Thermo Fischer Scientific Inc., Massachusetts, USA), containing 2 mM MgCl2, 0.25 mM from each dNTP (Invitrogen, Life Technologies, Paisley, UK) and 1.5U of DreamTaq DNA Polymerase (DreamTaq DNA Polymerase, Thermo Fischer Scientific Inc., Massachusetts, USA). The cycling conditions were as follows: 10 cycles of 10 s at 95 °C, 10 s at 55 °C, and 10 s at 72 °C. The first cycle was proceeded by a 3 min denaturation step at 95 °C and the final cycle was followed by a 5 min elongation step at 72 °C [24]. The preamplification total run time was 30 min. Subsequently, the amplicons were denatured at 94 °C for 3min, and 2 μl of each PCR product were transferred into a new tube in which a second-stage LAMP was performed. Briefly, each isothermal reaction was carried out in a final volume of 25 μl volume. Each LAMP mixture comprised of 1.6μΜ of each inner primer (FIP/BIP), 0.2μΜ of each outer primer (F3, B3), the isothermal amplification buffer II 1X with 1.4 mM from each dNTP and 8 units of Bst 3.0 DNA polymerase (New England Biolabs, Ipswich, MA, USA). This particular polymerase is an in silico designed homologue of Bacillus stearothermophilus DNA Polymerase I, Large Fragment, engineered for improved isothermal amplification performance. Bst 3.0 DNA Polymerase contains 5′-3′ DNA polymerase activity and strong strand displacement activity, but lacks 5′-3′ and 3′-5′ exonuclease activity. Bst 3.0 DNA Polymerase exhibits robust performance and increased tolerance to inhibitors from clinical samples, allowing more consistent reactions. The assay was performed at 65 °C for 30 min followed by heat inactivation at 80 °C for 5 min. The products were monitored in a 2% agarose gel electrophoresis as it was
Genomic DNA from ThinPrep specimens (patients and controls) was isolated, using the chaotropic agent guanidine thiocyanate (GuSCN) [23]. The HPV genotyping was performed by quantitative Real-Time PCR and the use of LAMP type-specific primer sets that target highly conserved regions of the E6 gene of HPV16 and HPV18 DNA, respectively. The corresponding primer sets were used for the subsequent development of IsoPCR methodology. 2.3. Design of LAMP E6 type-specific primer sets for HPV16 and HPV18 genotyping The LAMP E6 type-specific primer sets were designed with the software PrimerExplorer V5 (http://primerexplorer.jp/lampv5e/index. html). The complete E6 ORF of the reference sequence of HPV16 DNA was obtained from the sequence database PaVE (http://pave.niaid.nih. Table 1 Distribution of HPV genotypes in the examined cervical samples and results obtained from the application of IsoPCR for the detection of HPV16 and HPV18 genotypes. HPV genotype
HPV16 IsoPCR
HPV18 IsoPCR
Total Number (n = 129)
HPV16 HPV18 HPV31 HPV33 HPV35 HPV45 HPV51 HPV58 HPV66
20/20 0/23 0/18 0/23 0/7 0/7 0/22 0/8 0/22
0/20 23/23 0/18 0/2 0/7 0/7 0/22 0/8 0/22
20 23 18 2 7 7 22 8 22
2
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Table 2 Sequences of type-specific LAMP primers and the positions they target for the isothermal amplification of the E6 gene of HPV16 and HPV18. Two outer primers (forward outer primer - F3 and backward outer primer - B3) and two inner primers (forward inner primer - FIP and backward inner primer – BIP) were designed for each individual HPV genotype. LAMP primers HPV16 HPV16 E6 HPV16 E6 HPV16 E6 HPV16 E6 HPV18 HPV18 E6 HPV18 E6 HPV18 E6 HPV18 E6
Sequence (5′-3′)
Position
F3 B3 FIP BIP
ATGCACCAAAAGAGAACTGC ACAGCATATGGATTCCCATCTC TGTTTGCAGCTCTGTGCATAA-GTTTCAGGACCCACAGGA AGAATGTGTGTACTGCAAGCAA-ATCCCGAAAAGCAAAGTCAT
83 288 106 249
F3 B3 FIP BIP
AAAAACTAACTAACACTGGGTTA ACTTGTGTTTCTCTGCGT GGTGTCTAAGTTTTTCTGCTGGAT-AATTTATTAATAAGGTGCTGCG CGACGATTTCACAACATAGCTGG-GTTGGAGTCGTTCCTGTC
376 577 402 558
Fig. 1. Detection of HPV16 DNA through (A) conventional PCR (analytical sensitivity; 10 copies/test), (B) conventional LAMP (analytical sensitivity; 25 copies/test) and (C) IsoPCR (analytical sensitivity; 1 copy/test) in the same clinical samples. In all agarose gels (lane 1) a molecular weight marker, 100bp–1.500bp with 100bp increments and an additional fragment at 2.017bp was used (Invitrogen, Life Technologies, Paisley, UK). Lane 2, sample LBC54 (4 copies); lane 3, sample D61 (10 copies); lane 4, sample 9983.14 (20 copies), lane 5, sample 158.15 (55 copies), lane 6, sample 212.15 (110 copies); lane 7, sample 10657.15 (8 copies); lane 8 negative control (ddH2O).
2.8. Conventional LAMP assay for the detection of HPV16 and HPV18 DNA
previously described. The newly established protocol of IsoPCR was applied in HPV16 and HPV18 positive and negative samples. The amplification total run time was 65 min.
A LAMP assay was developed for the detection of HPV16 and HPV18 DNA, respectively. Briefly, each LAMP, was performed in a final volume of 25 μl volume. Each mixture contained 1.6μΜ of each inner primer (FIP/BIP), 0.2μΜ of each outer primer (F3, B3), the isothermal amplification buffer II 1X with 1.4 mM from each dNTP and 8 units of Bst 3.0 DNA polymerase (New England Biolabs, Ipswich, MA, USA). The assay was performed at 65 °C for 40 min followed by heat inactivation at 80 °C for 5 min. The products were monitored in a 2% agarose gel electrophoresis as it was previously described.
2.6. HPV genotyping through multiplex PCR assay The suitability of IsoPCR in the detection of HPV16 and HPV18 DNA was validated by subjecting all the examined cervical specimens to the previously described protocol of Multiplex PCR [25]. The assay enables the concurrent detection of HPV genotypes 16, 18, 45, 35, 66, 33, 51, 58, and 31 in three different multiplex PCR assays, using type-specific primer sets that target the L1 gene of the corresponding viruses [25].
2.9. Analytical sensitivity and specificity of IsoPCR, conventional PCR and LAMP
2.7. Conventional PCR for the detection of HPV16, HPV18 DNA A conventional PCR was established, using the designed outer LAMP E6 type-specific primer sets (F3/B3) for the detection of HPV16 and HPV18 DNA, respectively. Both PCR assays were accomplished in a final volume of 50 μl. Briefly, each PCR mixture consisted of 25 pmol of type-specific outer primer set, 10 X PCR buffer (DreamTaq DNA Polymerase, Thermo Fischer Scientific Inc., Massachusetts, USA) containing 2 mM MgCl2, 0.25 mM from each dNTP (Invitrogen, Life Technologies, Paisley, UK) and 1.5U of DreamTaq DNA Polymerase. The cycling conditions were as follows: 40 cycles of 30 s at 95 °C, 30 s at 50 °C, and 1 min at 72 °C. The first cycle was proceeded by a 3 min denaturation step at 95 °C and the final cycle was followed by a 5 min elongation step at 72 °C. The results of PCR were monitored in a 2% agarose gel as it was previously described. The amplification total run time was 135 min.
The analytical sensitivity of the newly established IsoPCR as well as that of conventional PCR and LAMP for the detection of E6 gene of HPV16 and HPV18 was evaluated through clinical samples of known viral copy number, as they were calculated by quantitative Real-Time PCR. In particular, clinical samples positive for HPV16 and HPV18 DNA were subjected to IsoPCR, conventional PCR and LAMP for the detection of HPV16 and HPV18 DNA, respectively (Figs. 1 and 2). Moreover, two different plasmids were constructed, each containing a partial fragment of HPV16 and HPV18 E6 genes in order to test for the sensitivity of PCR, LAMP and IsoPCR. HPV16 and HPV18 E6 plasmids were assembled through PCR amplification of the partial fragment of the E6 gene that was generated through the outer LAMP E6 type-specific primer sets F3/B3. Subsequently, amplicons were subjected to cloning 3
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Fig. 2. Detection of HPV18 DNA through (A) conventional PCR (analytical sensitivity; 10 copies/test), (B) conventional LAMP (analytical sensitivity; 25 copies/test) and (C) IsoPCR (analytical sensitivity; 1 copy/test) in the same clinical samples. In all agarose gels (lane 1) a molecular weight marker, 100bp–1.500bp with 100bp increments and an additional fragment at 2.017bp was used (Invitrogen, Life Technologies, Paisley, UK). Lane 2, sample 9973.14 (4 copies); lane 3, sample S401-16 (5 copies); lane 4, sample, S1099.13 (145 copies), lane 5, sample S118-13 (1978 copies), lane 6 negative control (ddH2O).
Fig. 3. Detection of HPV16 DNA plasmid through (A) conventional PCR (analytical sensitivity; 10 copies/test), (B) conventional LAMP (analytical sensitivity; 25 copies/test) and (C) IsoPCR (analytical sensitivity; 1 copy/test). In all agarose gels (lane 1) a molecular weight marker, 100bp–1.500bp with 100bp increments and an additional fragment at 2.017bp was used (Invitrogen, Life Technologies, Paisley, UK). Lane 2, 1 copy; lane 3, 10 copies; lane 4, 25 copies, lane 5, 50 copies, lane 6, 100 copies; lane 7, negative control (ddH2O).
sets were designed to target highly conserved regions of the E6 gene of the HPV16 and HPV18 DNA, respectively. In the present analysis, a total of 129 cervical samples were examined (Table 1). The initial detection of HPV16 and HPV18 DNA was conducted through quantitative Real-Time PCR and the copy number of the respective HPV genotypes was calculated. According to our results, 20 cervical specimens were diagnosed as HPV16 positive and 23 were diagnosed as HPV18 positive (Table 1). The viral load of the respective clinical samples ranged between 10–5.000 copies/reaction, while two HPV16-positive cervical samples and four HPV18-positive cervical samples harbored less than 10 copies of viral DNA (Table 3). The clinical application of the newly established protocol of IsoPCR confirmed the initial outcomes of quantitative Real-Time PCR assay for the detection of HPV16 and HPV18 DNA, respectively. In order to test the reliability of IsoPCR, the previously described methodology of Multiplex PCR was applied in the same clinical samples. Multiplex PCR detected the HPV16 and HPV18 DNA in the clinical samples that were found to be positive with IsoPCR but it could not amplify the viral DNA in cervical cases that contained less than 10 copies of viral DNA (Table 3), (Figs. 1 and 2). Of note, the analytical sensitivity of Multiplex PCR has been previously estimated to be at 10 viral copies/reaction and consequently clinical samples with less than 10 copies of viral DNA cannot be diagnosed as HPV16 and HPV18 positive [25]. Moreover,
using the TOPO TA Cloning KIT (Life Technologies, Carlsbad, CA, USA). The recombinant plasmid DNA was extracted using the Nucleospin plasmid kit (Macherey Nagel, Duren, Germany) following the manufacturer's protocol and the plasmids were sequenced at Macrogen Europe, Amsterdam, the Netherlands. The cloned sequences were characterized by database search at the NCBI website. DNA plasmids of 1, 10, 25, 50 and 100 copies were used in order to determine the minimum HPV DNA copy number that conventional PCR, conventional LAMP and IsoPCR were able to detect (Fig. 3). The products of each assay were analyzed by 2% agarose gel electrophoresis and visualized under an UV transilluminator and the detection limit of each assay was determined (Fig. 3). Finally, the specificity of IsoPCR assay conventional PCR and LAMP was determined by using DNA extracts collected from clinical samples that were negative for HPV16 or HPV18 DNA, but were positive for HPV genotypes 31, 33, 35, 45, 51, 58 and 66. The amplicons were monitored by a 2% agarose gel electrophoresis. 3. Results In the present study, a 2-stage nested-like nucleic acid amplification assay, named IsoPCR was established to detect the two most carcinogenic HPV genotypes 16 and 18. Hence, E6 LAMP type-specific primers 4
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Table 3 Results collected from quantitative Real-Time PCR, IsoPCR, Multiplex PCR, conventional PCR and conventional LAMP. (+) indicates positive amplification signal, (−) indicates negative amplification signal. The analytical sensitivity of IsoPCR is 1 copy/test for the detection of both HPV16 and HPV18 DNA. The analytical sensitivity of conventional PCR is 10 copies/test, while the analytical sensitivity of simple LAMP is 25 copies/test for the detection of viral DNA. Finally, the analytical sensitivity of Multiplex PCR has been previously estimated at 10 copies/test for the detection of viral genome [25]. HPV16 Positive Specimens
qRT-PCR Copies/test
IsoPCR
Multiplex PCR
Conventional PCR
Simple LAMP
9969.14 LBC54 D61 10715 14 9983.14 158.15 212.15 10657.15 2095 1759
3 4 10 11 20 55 110 11 11 13
+ + + + + + + + + +
– – + + + + + + + +
– – + + + + + + + +
– – – – – + + – – –
HPV18 Positive Specimens
qRT-PCR Copies/test
IsoPCR
Multiplex PCR
Conventional PCR
Simple LAMP
9991.14 1002.14 PNL38 s1099.13 s118.13 9973.14 S401-16
4 4 5 145 1978 4 10
+ + + + + + +
– – – + + – +
– – – + + – +
– – – + + – –
4. Discussion
conventional PCR and LAMP, using the newly designed E6 type-specific primer sets were applied in the same clinical samples. Conventional PCR confirmed the outcomes of Multiplex PCR. In contrast, the assay of conventional LAMP identified viral DNA in clinical samples that were diagnosed as positive with IsoPCR, Multiplex PCR and PCR but failed to detect the viral DNA in cervical samples with viral load lower than 25 copies/reaction (Table 3), (Figs. 1 and 2). In order to prove the competences of IsoPCR as well as to elucidate the inconsistency among the different molecular approaches a sensitivity control was conducted, while the analytical sensitivity of IsoPCR was considered together with that of conventional PCR and LAMP. In particular, solutions with different copy numbers of HPV16 and HPV18 DNA (100, 50, 25, 10 and 1 copy), were subjected to IsoPCR, conventional PCR and LAMP, respectively. The analytical sensitivity of the newly established protocol of IsoPCR was found to be 1 copy/reaction for the identification of both HPV16 and HPV18 DNA, while that of conventional PCR was determined at 10 and that of conventional LAMP at 25 copies/reaction for the detection of both HPV16 and HPV18 DNA (Fig. 3). In addition, the specificity of IsoPCR was assessed by testing the cross-reactivity of the newly designed E6 type-specific HPV16 and HPV18 primer sets for HPV genotypes 31, 33,35, 45, 51, 58 and 66. Amplicons were only observed when the primer sets were reacted with HPV16 and HPV18 genome. Hence, the primer sets that were used in the present assay were specific only for HPV16 and HPV18 E6 genes, respectively. Finally, optimal IsoPCR assay was evaluated for the detection of HPV16 and HPV18 in clinical specimens along with control cohort (Figs. 1 and 2). The diagnostic performance of IsoPCR was tested using the clinical samples that were found to be positive for HPV16 and HPV18 infection through quantitative Real-Time PCR. Moreover, a total of eighty-six HPV positive samples (genotypes 45, 35, 66, 33, 51, 58, and 31) and twenty-two HPV negative samples were also incorporated in the present study. Regarding the suitability of IsoPCR, HPV genotypes were detected with the same efficiency as with quantitative RealTime PCR, while the assay exhibited negative amplification signal in clinical samples that contained different HPV genotypes other than 16 or 18 or in samples that were negative for HPV infection. The analytical sensitivity, specificity, positive predictive value and negative predictive value of the IsoPCR assay were 100%.
Molecular methods for the detection of HR-HPV DNA are the goldstandard for the diagnosis of HPV infection as well as for the prediction of cervical disease development, especially in patients without any indications of abnormal cytological outcomes. The American Society for Colposcopy and Cervical Pathology (ASCCP; 2006, 2009 and 2012) recommends that women with a negative cytopathological test, but with a positive HPV test should be subjected to HPV genotyping screening. The detection of HPV16 and HPV18 in clinical specimens offers considerable information regarding the triage of colposcopy of HR-HPV-positive women who have greater risk in developing more severe dysplasias [9,10]. Although molecular approaches for HPV genotyping are used in regular cervical cancer screening, they are considered as time consuming, rather laborious and expensive, thus prohibiting their application in clinical laboratories [8,13]. As a result, it has become mandatory for research and clinical laboratories to implement more rapid and sensitive methodologies for HPV DNA genotyping. Towards this end we developed a 2-stage, nested-like nucleic acid amplification method, named IsoPCR, to amplify HPV16 and HPV18 DNA with increased analytical sensitivity [22]. It has been previously reported that IsoPCR confers an increased amplification sensitivity, down to 1 copy number of nucleotide-target per reaction, thus suggesting that IsoPCR is a point of care test for the detection of a wide range of human pathogens [22,26]. The increased analytical sensitivity of IsoPCR lies mainly on the fact that the assay combines the benefits of both PCR and LAMP, since it comprises of a first-stage PCR, followed by LAMP [22]. In the present analysis, an IsoPCR protocol was developed to specifically amplify a conserved region of the E6 gene of HPV16 and HPV18 by designing E6 type-specific primer sets, while the monitoring of results was conducted by a simple gel electrophoresis. The performance of IsoPCR was compared to that of conventional PCR and LAMP. The analytical sensitivity of this newly established protocol (of IsoPCR) was 10-fold higher than that of conventional PCR and 25-fold higher than that of LAMP for the detection of HPV16 and HPV18 DNA, respectively. In particular, the analytical sensitivity of IsoPCR was estimated at 1 copy/reaction for the detection of both HPV16 and HPV18 DNA, while the analytical sensitivity of conventional PCR and LAMP with the same E6 type-specific primer sets was evaluated at 10 copies/ reaction and 25 copies/reaction of viral DNA, respectively (Fig. 3). The 5
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Programme “Toxicology” code 5050, of the University of Thessaly, School of Health Sciences, Department of Biochemistry & Biotechnology.
high analytical sensitivity of IsoPCR was confirmed in seven cervical samples positive for HPV16 DNA and five cervical samples positive for HPV18 DNA (Table 3). IsoPCR managed to detect HPV positive the above mentioned samples, whereas they were falsely diagnosed as negative by conventional PCR or conventional LAMP (Table 3). In particular, the conventional PCR failed to detect the viral DNA in clinical samples that contained < 10 copies of HPV16 and HPV18 DNA, while conventional LAMP could not amplify the viral DNA in clinical specimens that harbored < 25 copies (Table 3). In addition, IsoPCR showed equivalent sensitivity than that of Real-Time PCR. However, Real-Time PCR requires expensive and sophisticated equipment, which constraints its use in low budget laboratories [31]. It is important to underline that a previous study by Søe et al. [22] suggested that the method of IsoPCR facilitates the detection down to 1 copy of a specific nucleotide-target per test, thus strongly supporting our findings. Moreover, considering that the analytical sensitivity of the commercially available FDA approved HPV genotyping tests as well as the analytical sensitivity of most in-house HPV nucleic acid detection methods is between 10 and 100 copies/reaction we conclude that the newly developed protocol of IsoPCR is a highly sensitive molecular approach suitable for the detection of HPV16 and HPV18 DNA, even with very low viral load [8,20,25–30]. The newly developed protocol of IsoPCR conferred a considerable amplification specificity and efficiency, as well. In particular, no crossreaction was observed with HPV genotypes 31, 33, 35, 45, 51, 58 and 66. Also, no false positive amplicons were generated due to primer carryover from the pre-amplification step, since this step was only performed for 10 cycles, eliminating the generation of false positive results. As a consequence, we have developed a simple methodology that reaches the analytical sensitivity of the gold-standard Real-Time PCR.
References [1] H. zur Hausen, Papillomavirus infections - a major cause of human cancers, Biochim. Biophys. Acta 1288 (1996) F55–F78. [2] J. Doorbar, W. Quint, L. Banks, I.G. Bravo, M. Stoler, T.R. Broker, M.A. Stanley, The biology and life-cycle of human papillomaviruses, Vaccine 30 (2012) F55–F70. [3] T.A. Berman, J.T. Schiller, Human papillomavirus in cervical cancer and oropharyngeal cancer: one cause, two diseases, Cancer 123 (2017) 2219–2229. [4] Y. Li, C. Xu, Human papillomavirus-related cancers, Adv. Exp. Med. Biol. 1018 (2017) 23–34. [5] D. Saslow, D. Solomon, H.W. Lawson, M. Killackey, S.L. Kulasingam, J.M. Cain, et al., American cancer society, American society for colposcopy and cervical Pathology, and American society for clinical Pathology screening guidelines for the prevention and early detection of cervical cancer, J. Low. Genit. Tract Dis. 16 (2012) 175–204. [6] S. Good man, R.R. Mody, D. Coffey, B.K. Gorman, E. Luna, D. Armylagos, et al., Negative Pap tests in women with high-grade cervical lesions on follow-up biopsies: contributing factors and role of human papillomavirus genotyping, Diagn. Cytopathol. 46 (2018) 239–243. [7] P. Sinha, P. Srivastava, A. Srivastava, Comparison of visual inspection with acetic acid and the pap smear for cervical cancer screening, Acta Cytol. 62 (2018) 34–38. [8] D. Tsakogiannis, C. Gartzonika, S. Levidiotou-Stefanou, P. Markoulatos, Molecular approaches for HPV genotyping and HPV-DNA physical status, Expert Rev. Mol. Med. 19 (2017) e1. [9] P.E. Castle, M.H. Stoler, T.C. Wright, A. Jr Sharma, T.L. Wright, C.M. Behrens, Performance of carcinogenic human papillomavirus (HPV) testing and HPV16 or HPV18 genotyping for cervical cancer screening of women aged 25 years and older: a subanalysis of the ATHENA study, Lancet Oncol. 12 (2011) 880–890. [10] J.T. Cox, P.E. Castle, C.M. Behrens, A. Sharma, T.C. Wright Jr., J. CuzickAthena HPV Study Group, Comparison of cervical cancer screening strategies incorporating different combinations of cytology, HPV testing, and genotyping for HPV 16/18: results from the ATHENA HPV study, Am. J. Obstet. Gynecol. 208 (2013) 184.e1–184.e11. [11] M. Schiffman, N. Wentzensen, A suggested approach to simplify and improve cervical screening in the United States, J. Low. Genit. Tract Dis. 20 (2016) 1–7. [12] M. Del Pino, I. Alonso, A. Rodriguez-Trujillo, S. Bernal, D. Geraets, N. Guimerà, A. Torne, J. Ordi, Comparison of the analytical and clinical performance of five tests for the detection of human papillomavirus genital infection, J. Virol. Methods 248 (2017) 238–243. [13] A. Gradíssimo, R.D. Burk, Molecular tests potentially improving HPV screening and genotyping for cervical cancer prevention, Expert Rev. Mol. Diagn. 17 (2017) 379–391. [14] T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, T. Hase, Loop-mediated isothermal amplification of DNA, Nucleic Acids Res. 28 (2000) E63. [15] T. Notomi, Y. Mori, N. Tomita, H. Kanda, Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects, J. Microbiol. 53 (2015) 1–5. [16] P. Kumvongpin, C. Jearanaikool, N. Wilailuckana, P. Sae-Ung, S. Prasongdee, et al., High sensitivity, loop-mediated isothermal amplification combined with colorimetric gold-nanoparticle probes for visual detection of high risk human papillomavirus genotypes 16 and 18, J. Virol. Methods 234 (2016) 90–95. [17] D.M. Livingstone, M. Rohatensky, P. Mintchev, S.C. Nakoneshny, D.J. Demetrick, G. van Marle, J.C. Dort, Loop mediated isothermal amplification (LAMP) for the detection and subtyping of human papillomaviruses (HPV) in oropharyngeal squamous cell carcinoma (OPSCC), J. Clin. Virol. 75 (2016) 37–41. [18] K. Nagamine, T. Hase, T. Notomi, Accelerated reaction by loop-mediated isothermal amplification using loop primers, Mol. Cell. Probes 16 (2002) 223–229. [19] J. Fischbach, N.C. Xander, M. Frohme, J.F. Glökler, Shining a light on LAMP assays– a comparison of LAMP visualization methods including the novel use of berberine, Biotechniques 58 (2015) 189–194. [20] N.A. Tanner, Y. Zhang, T.C. Evans, Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes, Biotechniques 58 (2015) 59–68. [21] A.L. Blomström, M. Hakhverdyan, S.M. Reid, J.P. Dukes, D.P. King, S. Belák, M. Berg, A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus, J. Virol. Methods 147 (2008) 188–193. [22] M.J. Søe, M. Rohde, J. Mikkelsen, P. Warthoe, IsoPCR: an analytically sensitive,nested, multiplex nucleic acid amplification method, Clin. Chem. 59 (2013) 436–439. [23] I. Casas, L. Powell, P.E. Klapper, G.M. Cleator, New method for the extraction of viral RNA and DNA from cerebrospinal fluid for use in the polymerase chain reaction assay, J. Virol. Methods 53 (1995) 25–36. [24] P. Markoulatos, N. Siafakas, T. Katsorchis, M. Moncany, Multiplex PCR: rapid DNA cycling in a conventional thermal cycler, J. Clin. Lab. Anal. 17 (2003) 108–112. [25] D. Tsakogiannis, V. Diamantidou, E. Toska, Z. Kyriakopoulou, T.G. Dimitriou, I.G. Ruether, P. Gortsilas, P. Markoulators, Multiplex PCR assay for the rapid identification of human papillomavirus genotypes 16, 18, 45, 35, 66, 33, 51, 58, and 31 in clinical samples, Arch. Virol. 160 (2015) 207–214. [26] J. Song, C. Liu, M.G. Mauk, S.C. Rankin, J.B. Lok, R.M. Greenberg, H.H. Bau, Twostage isothermal enzymatic amplification for concurrent multiplex molecular
5. Conclusions In conclusion, IsoPCR is a cost effective, highly sensitive and specific molecular protocol for HPV16 and HPV18 DNA detection, halving the amplification time compared to PCR that is routinely used in HPV diagnosis. The analytical sensitivity, specificity, positive predictive value and negative predictive value of the IsoPCR assay for the detection of HPV16 and HPV18 DNA in clinical specimens were 100%. To the best of our knowledge, this is the first study that incorporates IsoPCR in HPV DNA detection and our results clearly show that this new method can be regarded as a highly sensitive and specific point of care diagnostic tool that requires non-sophisticated instrumentation and offers significant information, concerning HPV16 and HPV18 infection to healthcare providers and epidemiologists. Conflicts of interest All authors declare that they have not conflicting or dual interests. Ethical approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional research committee and with the 1964 Helsinki declaration and its later amendments. Informed consent Informed consent was obtained from all individual participants included in the study. Funding This study was funded by research grants of the Postgraduate 6
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
1161–1168. [29] T. Souho, B. Bennani, Oncogenic human papillomavirus genotyping by multiplex PCR and fragment analysis, J. Virol. Methods 196 (2014) 45–49. [30] D. Tsakogiannis, M. Papacharalampous, E. Toska, Z. Kyriakopoulou, T.G. Dimitriou, I.G. Ruether, D. Komiotis, P. Markoulatos, Duplex Real-time PCR assay and SYBR green I melting curve analysis for molecular identification of HPV genotypes 16, 18, 31, 35, 51 and 66, Mol. Cell. Probes 29 (2015) 13–18. [31] M.L. Wong, J.F. Medrano, Real-time PCR for mRNA quantitation, Biotechniques 39 (2005) 75–85.
detection, Clin. Chem. 63 (2017) 714–722. [27] K. Sotlar, D. Diemer, A. Dethleffs, Y. Hack, A. Stubner, N. Vollmer, S. Menton, M. Menton, K. Dietz, D. Wallwiener, R. Kandolf, B. Bültmann, Detection and typing of human papillomavirus by e6 nested multiplex PCR, J. Clin. Microbiol. 42 (2004) 3176–3184. [28] M. Nishiwaki, T. Yamamoto, S. Tone, T. Murai, T. Ohkawara, T. Matsunami, M. Koizumi, Y. Takagi, J. Yamaguchi, N. Kondo, J. Nishihira, T. Horikawa, T. Yoshiki, Genotyping of human papillomaviruses by a novel one-step typing method with multiplex PCR and clinical applications, J. Clin. Microbiol. 46 (2008)
7
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Original research article
Α 2-stage, nested-like nucleic acid amplification method (IsoPCR) for the highly sensitive detection of HPV16 and HPV18 DNA
T
M. Daskoua, D. Tsakogiannisa,∗, T.G. Dimitrioua, M. Manalia, C. Aptia, G.D. Amoutziasb, D. Mossialosa, C. Kottaridic, P. Markoulatosa a
University of Thessaly, School of Health Sciences, Department of Biochemistry & Biotechnology, Microbiology-Virology Laboratory, Biopolis, 41500, Larissa, Greece Bioinformatics Laboratory, University of Thessaly, School of Health Sciences, Department of Biochemistry & Biotechnology, Biopolis, Larissa, Greece c Department of Cytopathology, National and Kapodistrian University of Athens, Medical School, “ATTIKON” University Hospital, 1 Rimini, Haidari, 12462, Athens, Greece b
A R T I C LE I N FO
A B S T R A C T
Keywords: IsoPCR LAMP HPV genotyping HPV16 HPV18 Cervical dysplasia
Molecular detection of HPV DNA is considered as the gold standard for the diagnosis of cervical disease. Although the molecular assays for the identification of HPV16 and HPV18 have helped identify cervical cancer incidents, they are restricted to specialized laboratories. Thus, we developed a novel 2-stage, nested-like nucleic acid amplification method, named IsoPCR, to amplify the E6 gene of HPV16 and HPV18 with high analytical sensitivity and specificity. The performance of IsoPCR was compared to that of conventional PCR and LAMP. The analytical sensitivity of IsoPCR (1 copy/test) was 10-fold higher than conventional PCR and 25-fold higher than conventional LAMP. IsoPCR displayed significant amplification specificity (100%) and efficiency, as well. In conclusion, IsoPCR is a highly sensitive and specific diagnostic tool and it is suitable for the detection of low copy number of viral DNA in clinical specimens, providing critical information to healthcare providers.
1. Introduction Human Papillomaviruses (HPVs) are small, non-enveloped, capsidenclosed, icosahedral, double stranded DNA viruses that infect the mucosal and cutaneous epithelia [1,2]. It is widely accepted that persistent infection with high-risk (HR) HPV genotypes is the major causative agent for cervical cancer which is the second leading cause of cancer-related death among women worldwide [3]. Epidemiological analyses have revealed that HPV16 and HPV18 are the two most carcinogenic genotypes, accounting for about 50% and 20% of cervical cancer cases, respectively [4,5]. Although cytology-based tests have reduced the cervical cancer incidents and mortality rates, they exhibit low specificity and variable levels of sensitivity (30–87%) [6,7]. The causal role of HR-HPV infections in cervical disease growth triggered the development of molecular assays that lie mainly on the detection of HPV DNA and RNA [8]. Molecular detection of HPV DNA is currently the gold standard for viral identification and exhibits higher analytical sensitivity (84–100%) than cytological tests [8–11]. Nowadays, several molecular assays have been commercialized and used in HPV diagnosis, while the US FDA has approved a total of five different
HPV molecular assays including the Hybrid Capture 2 (HC2), Cervista™ HPV HR and Genfind™ DNA Extraction Kit, Cobas HPV, APTIMA HPV Assay [8,12,13]. It is noteworthy, that research and clinical laboratories mainly use Polymerase Chain Reaction assay (PCR) in HPV genotyping, since it is regarded as a cost effective, non labor-intensive technique that requires non-sophisticated equipment and confers high analytical sensitivity and specificity in the detection of HPV genotypes [8]. Loop-mediated isothermal amplification (LAMP) is an appealing molecular method for the amplification of small nucleic-acid targets under isothermal conditions and was recently introduced to the field of HPV-DNA identification [14–17]. LAMP reaction is based on strand displacement by a Bst DNA polymerase under isothermal conditions with a temperature range between 60 °C to 70 °C. Moreover, the assay requires a set of four (or six) different primers that bind to six (or eight) different regions on the target gene, thus increasing the specificity of the methodology. In particular, LAMP comprises an outer primer set (forward outer primer - F3 and backward outer primer - B3), an inner primer set (forward inner primer - FIP and backward inner primer – BIP) and/or a set of loop primers (loop forward primer - LF and loop backward primer - LB) [18–20]. The reaction can be completed within
Abbreviations: LAMP, Loop-mediated isothermal amplification; FIP, forward inner primer; BIP, backward inner primer; F3, forward outer primer; B3, backward outer primer; LF, loop forward primer; LB, loop backward primer; GuSCN, guanidine thiocyanate; HPV, Human papillomavirus. ∗ Corresponding author. E-mail addresses: [email protected], [email protected] (D. Tsakogiannis). https://doi.org/10.1016/j.mcp.2019.03.003 Received 14 November 2018; Received in revised form 20 January 2019; Accepted 14 March 2019 Available online 19 March 2019 0890-8508/ © 2019 Elsevier Ltd. All rights reserved.
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
gov), while the complete E6 ORF of the reference sequence of HPV18 DNA was obtained from Genbank database (accession number NC_ 001357). The specificity of the E6 type-specific LAMP primer was evaluated with the MEGA BLAST algorithm within NCBI website. Each set of E6 LAMP type-specific primers consists of two outer (F3, B3) and two inner (FIP, BIP) primers (Table 2).
1 h using simple and inexpensive equipment such as a heating dry block and it demonstrates high analytical sensitivity (10 copies of viral genomes/reaction) [21]. Recently, a 2-stage, nested-like nucleic acid amplification method, named IsoPCR has been developed [22] for the amplification of nucleic acid targets with improved limit of detection and shorter amplification time, than conventional PCR. The assay is accomplished in two stages, merging the advantages of PCR and LAMP and is considered as a point of care method [22]. The present study focuses on the development of a point of care method that is based on the IsoPCR, for the specific detection of the E6 gene of HPV16 and HPV18. The proposed protocol combined the advantages of both PCR and LAMP and comprises a first stage of PCR for a limited number of cycles (10 cycles) that is followed by a second stage of LAMP. We investigated the analytical sensitivity, specificity and potential for clinical amplification of this new IsoPCR method and compared it to conventional PCR and LAMP assays.
2.4. Quantitative Real-Time PCR for HPV16 and HPV18 genotyping The outer E6 type-specific F3/B3 primer sets were used to establish a quantitative Real-Time PCR protocol for the detection of HPV16 and HPV18 DNA as well as to calculate the copy numbers of viral DNA in the examined cervical samples. All cervical samples were tested in duplicate. Both quantitative Real-Time PCR assays were conducted on the Mx3005P@ instrument and were carried out in a final volume of 20 μl. Briefly, each Real-Time PCR mixture contained 5 pmol of outer primer set, 2Χ Master Mix (SYBR Select qPCR Master Mix Kit, Thermo Fischer Scientific Inc., Massachusetts, USA) and ROX Reference Dye. The cycling conditions were as follows: An initial denaturation step at 95 °C for 2 min followed by 40 cycles in two steps: 95 °C for 15s, and 60 °C for 1min. Data acquisition at 510 nm was performed at anneal/ extension step (60 °C). The melting curve was generated by heating from 55 °C to 95 °C in increments of 2 °C. The total run time was 110 min including the time needed for melting temperature analysis. In order to confirm the outcomes of Real-Time PCR, the amplicons were monitored in a 2% agarose gel electrophoresis stained with 1 μg/ ml of ethidium bromide in Tris-borate-EDTA buffer using a 100-bp DNA ladder as a molecular weight marker (Invitrogen, Life Technologies, Paisley, UK). The HPV16 F3/B3 primer set generated a fragment of 206bp in size, while the HPV18 F3/B3 yielded a fragment of 201bp in size (Table 2).
2. Materials and methods 2.1. Cervical samples and DNA extraction Cervical specimens were obtained from 129 women positive for HPV infection. The women attended the colposcopy clinic of the 3rd Department of Gynecology and Obstetrics in the tertiary care “ATTIKON” University General Hospital between June 2013 and June 2017 (Table 1). The study population did not represent a normally screened population, since most patients attended the outpatient clinics after a referral abnormal cytology and or colposcopy. Moreover, a total of twenty-two cervical samples with normal cytology and without HPV infection were incorporated in the present study, as well. All patients signed an informed consent form and the study was approved by the Bioethics committee of the hospital (Approval number 5/14-06-2013).
2.5. A 2-stage nested-like nucleic acid amplification assay (IsoPCR)
2.2. DNA isolation and HPV16 and HPV18 genotyping
Cervical specimens that were found to be positive with quantitative Real-Time PCR were used in order to develop the IsoPCR assay. This assay consists of a first step of a preamplification PCR and a second step of LAMP assay, for the isothermal amplification of the specific nucleotide target. More specifically, the first-stage PCR was performed in a final volume of 50 μl. Each PCR mixture consisted of 25 pmol of inner primer set (FIB/BIP), 10 X PCR buffer (DreamTaq DNA Polymerase, Thermo Fischer Scientific Inc., Massachusetts, USA), containing 2 mM MgCl2, 0.25 mM from each dNTP (Invitrogen, Life Technologies, Paisley, UK) and 1.5U of DreamTaq DNA Polymerase (DreamTaq DNA Polymerase, Thermo Fischer Scientific Inc., Massachusetts, USA). The cycling conditions were as follows: 10 cycles of 10 s at 95 °C, 10 s at 55 °C, and 10 s at 72 °C. The first cycle was proceeded by a 3 min denaturation step at 95 °C and the final cycle was followed by a 5 min elongation step at 72 °C [24]. The preamplification total run time was 30 min. Subsequently, the amplicons were denatured at 94 °C for 3min, and 2 μl of each PCR product were transferred into a new tube in which a second-stage LAMP was performed. Briefly, each isothermal reaction was carried out in a final volume of 25 μl volume. Each LAMP mixture comprised of 1.6μΜ of each inner primer (FIP/BIP), 0.2μΜ of each outer primer (F3, B3), the isothermal amplification buffer II 1X with 1.4 mM from each dNTP and 8 units of Bst 3.0 DNA polymerase (New England Biolabs, Ipswich, MA, USA). This particular polymerase is an in silico designed homologue of Bacillus stearothermophilus DNA Polymerase I, Large Fragment, engineered for improved isothermal amplification performance. Bst 3.0 DNA Polymerase contains 5′-3′ DNA polymerase activity and strong strand displacement activity, but lacks 5′-3′ and 3′-5′ exonuclease activity. Bst 3.0 DNA Polymerase exhibits robust performance and increased tolerance to inhibitors from clinical samples, allowing more consistent reactions. The assay was performed at 65 °C for 30 min followed by heat inactivation at 80 °C for 5 min. The products were monitored in a 2% agarose gel electrophoresis as it was
Genomic DNA from ThinPrep specimens (patients and controls) was isolated, using the chaotropic agent guanidine thiocyanate (GuSCN) [23]. The HPV genotyping was performed by quantitative Real-Time PCR and the use of LAMP type-specific primer sets that target highly conserved regions of the E6 gene of HPV16 and HPV18 DNA, respectively. The corresponding primer sets were used for the subsequent development of IsoPCR methodology. 2.3. Design of LAMP E6 type-specific primer sets for HPV16 and HPV18 genotyping The LAMP E6 type-specific primer sets were designed with the software PrimerExplorer V5 (http://primerexplorer.jp/lampv5e/index. html). The complete E6 ORF of the reference sequence of HPV16 DNA was obtained from the sequence database PaVE (http://pave.niaid.nih. Table 1 Distribution of HPV genotypes in the examined cervical samples and results obtained from the application of IsoPCR for the detection of HPV16 and HPV18 genotypes. HPV genotype
HPV16 IsoPCR
HPV18 IsoPCR
Total Number (n = 129)
HPV16 HPV18 HPV31 HPV33 HPV35 HPV45 HPV51 HPV58 HPV66
20/20 0/23 0/18 0/23 0/7 0/7 0/22 0/8 0/22
0/20 23/23 0/18 0/2 0/7 0/7 0/22 0/8 0/22
20 23 18 2 7 7 22 8 22
2
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Table 2 Sequences of type-specific LAMP primers and the positions they target for the isothermal amplification of the E6 gene of HPV16 and HPV18. Two outer primers (forward outer primer - F3 and backward outer primer - B3) and two inner primers (forward inner primer - FIP and backward inner primer – BIP) were designed for each individual HPV genotype. LAMP primers HPV16 HPV16 E6 HPV16 E6 HPV16 E6 HPV16 E6 HPV18 HPV18 E6 HPV18 E6 HPV18 E6 HPV18 E6
Sequence (5′-3′)
Position
F3 B3 FIP BIP
ATGCACCAAAAGAGAACTGC ACAGCATATGGATTCCCATCTC TGTTTGCAGCTCTGTGCATAA-GTTTCAGGACCCACAGGA AGAATGTGTGTACTGCAAGCAA-ATCCCGAAAAGCAAAGTCAT
83 288 106 249
F3 B3 FIP BIP
AAAAACTAACTAACACTGGGTTA ACTTGTGTTTCTCTGCGT GGTGTCTAAGTTTTTCTGCTGGAT-AATTTATTAATAAGGTGCTGCG CGACGATTTCACAACATAGCTGG-GTTGGAGTCGTTCCTGTC
376 577 402 558
Fig. 1. Detection of HPV16 DNA through (A) conventional PCR (analytical sensitivity; 10 copies/test), (B) conventional LAMP (analytical sensitivity; 25 copies/test) and (C) IsoPCR (analytical sensitivity; 1 copy/test) in the same clinical samples. In all agarose gels (lane 1) a molecular weight marker, 100bp–1.500bp with 100bp increments and an additional fragment at 2.017bp was used (Invitrogen, Life Technologies, Paisley, UK). Lane 2, sample LBC54 (4 copies); lane 3, sample D61 (10 copies); lane 4, sample 9983.14 (20 copies), lane 5, sample 158.15 (55 copies), lane 6, sample 212.15 (110 copies); lane 7, sample 10657.15 (8 copies); lane 8 negative control (ddH2O).
2.8. Conventional LAMP assay for the detection of HPV16 and HPV18 DNA
previously described. The newly established protocol of IsoPCR was applied in HPV16 and HPV18 positive and negative samples. The amplification total run time was 65 min.
A LAMP assay was developed for the detection of HPV16 and HPV18 DNA, respectively. Briefly, each LAMP, was performed in a final volume of 25 μl volume. Each mixture contained 1.6μΜ of each inner primer (FIP/BIP), 0.2μΜ of each outer primer (F3, B3), the isothermal amplification buffer II 1X with 1.4 mM from each dNTP and 8 units of Bst 3.0 DNA polymerase (New England Biolabs, Ipswich, MA, USA). The assay was performed at 65 °C for 40 min followed by heat inactivation at 80 °C for 5 min. The products were monitored in a 2% agarose gel electrophoresis as it was previously described.
2.6. HPV genotyping through multiplex PCR assay The suitability of IsoPCR in the detection of HPV16 and HPV18 DNA was validated by subjecting all the examined cervical specimens to the previously described protocol of Multiplex PCR [25]. The assay enables the concurrent detection of HPV genotypes 16, 18, 45, 35, 66, 33, 51, 58, and 31 in three different multiplex PCR assays, using type-specific primer sets that target the L1 gene of the corresponding viruses [25].
2.9. Analytical sensitivity and specificity of IsoPCR, conventional PCR and LAMP
2.7. Conventional PCR for the detection of HPV16, HPV18 DNA A conventional PCR was established, using the designed outer LAMP E6 type-specific primer sets (F3/B3) for the detection of HPV16 and HPV18 DNA, respectively. Both PCR assays were accomplished in a final volume of 50 μl. Briefly, each PCR mixture consisted of 25 pmol of type-specific outer primer set, 10 X PCR buffer (DreamTaq DNA Polymerase, Thermo Fischer Scientific Inc., Massachusetts, USA) containing 2 mM MgCl2, 0.25 mM from each dNTP (Invitrogen, Life Technologies, Paisley, UK) and 1.5U of DreamTaq DNA Polymerase. The cycling conditions were as follows: 40 cycles of 30 s at 95 °C, 30 s at 50 °C, and 1 min at 72 °C. The first cycle was proceeded by a 3 min denaturation step at 95 °C and the final cycle was followed by a 5 min elongation step at 72 °C. The results of PCR were monitored in a 2% agarose gel as it was previously described. The amplification total run time was 135 min.
The analytical sensitivity of the newly established IsoPCR as well as that of conventional PCR and LAMP for the detection of E6 gene of HPV16 and HPV18 was evaluated through clinical samples of known viral copy number, as they were calculated by quantitative Real-Time PCR. In particular, clinical samples positive for HPV16 and HPV18 DNA were subjected to IsoPCR, conventional PCR and LAMP for the detection of HPV16 and HPV18 DNA, respectively (Figs. 1 and 2). Moreover, two different plasmids were constructed, each containing a partial fragment of HPV16 and HPV18 E6 genes in order to test for the sensitivity of PCR, LAMP and IsoPCR. HPV16 and HPV18 E6 plasmids were assembled through PCR amplification of the partial fragment of the E6 gene that was generated through the outer LAMP E6 type-specific primer sets F3/B3. Subsequently, amplicons were subjected to cloning 3
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Fig. 2. Detection of HPV18 DNA through (A) conventional PCR (analytical sensitivity; 10 copies/test), (B) conventional LAMP (analytical sensitivity; 25 copies/test) and (C) IsoPCR (analytical sensitivity; 1 copy/test) in the same clinical samples. In all agarose gels (lane 1) a molecular weight marker, 100bp–1.500bp with 100bp increments and an additional fragment at 2.017bp was used (Invitrogen, Life Technologies, Paisley, UK). Lane 2, sample 9973.14 (4 copies); lane 3, sample S401-16 (5 copies); lane 4, sample, S1099.13 (145 copies), lane 5, sample S118-13 (1978 copies), lane 6 negative control (ddH2O).
Fig. 3. Detection of HPV16 DNA plasmid through (A) conventional PCR (analytical sensitivity; 10 copies/test), (B) conventional LAMP (analytical sensitivity; 25 copies/test) and (C) IsoPCR (analytical sensitivity; 1 copy/test). In all agarose gels (lane 1) a molecular weight marker, 100bp–1.500bp with 100bp increments and an additional fragment at 2.017bp was used (Invitrogen, Life Technologies, Paisley, UK). Lane 2, 1 copy; lane 3, 10 copies; lane 4, 25 copies, lane 5, 50 copies, lane 6, 100 copies; lane 7, negative control (ddH2O).
sets were designed to target highly conserved regions of the E6 gene of the HPV16 and HPV18 DNA, respectively. In the present analysis, a total of 129 cervical samples were examined (Table 1). The initial detection of HPV16 and HPV18 DNA was conducted through quantitative Real-Time PCR and the copy number of the respective HPV genotypes was calculated. According to our results, 20 cervical specimens were diagnosed as HPV16 positive and 23 were diagnosed as HPV18 positive (Table 1). The viral load of the respective clinical samples ranged between 10–5.000 copies/reaction, while two HPV16-positive cervical samples and four HPV18-positive cervical samples harbored less than 10 copies of viral DNA (Table 3). The clinical application of the newly established protocol of IsoPCR confirmed the initial outcomes of quantitative Real-Time PCR assay for the detection of HPV16 and HPV18 DNA, respectively. In order to test the reliability of IsoPCR, the previously described methodology of Multiplex PCR was applied in the same clinical samples. Multiplex PCR detected the HPV16 and HPV18 DNA in the clinical samples that were found to be positive with IsoPCR but it could not amplify the viral DNA in cervical cases that contained less than 10 copies of viral DNA (Table 3), (Figs. 1 and 2). Of note, the analytical sensitivity of Multiplex PCR has been previously estimated to be at 10 viral copies/reaction and consequently clinical samples with less than 10 copies of viral DNA cannot be diagnosed as HPV16 and HPV18 positive [25]. Moreover,
using the TOPO TA Cloning KIT (Life Technologies, Carlsbad, CA, USA). The recombinant plasmid DNA was extracted using the Nucleospin plasmid kit (Macherey Nagel, Duren, Germany) following the manufacturer's protocol and the plasmids were sequenced at Macrogen Europe, Amsterdam, the Netherlands. The cloned sequences were characterized by database search at the NCBI website. DNA plasmids of 1, 10, 25, 50 and 100 copies were used in order to determine the minimum HPV DNA copy number that conventional PCR, conventional LAMP and IsoPCR were able to detect (Fig. 3). The products of each assay were analyzed by 2% agarose gel electrophoresis and visualized under an UV transilluminator and the detection limit of each assay was determined (Fig. 3). Finally, the specificity of IsoPCR assay conventional PCR and LAMP was determined by using DNA extracts collected from clinical samples that were negative for HPV16 or HPV18 DNA, but were positive for HPV genotypes 31, 33, 35, 45, 51, 58 and 66. The amplicons were monitored by a 2% agarose gel electrophoresis. 3. Results In the present study, a 2-stage nested-like nucleic acid amplification assay, named IsoPCR was established to detect the two most carcinogenic HPV genotypes 16 and 18. Hence, E6 LAMP type-specific primers 4
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Table 3 Results collected from quantitative Real-Time PCR, IsoPCR, Multiplex PCR, conventional PCR and conventional LAMP. (+) indicates positive amplification signal, (−) indicates negative amplification signal. The analytical sensitivity of IsoPCR is 1 copy/test for the detection of both HPV16 and HPV18 DNA. The analytical sensitivity of conventional PCR is 10 copies/test, while the analytical sensitivity of simple LAMP is 25 copies/test for the detection of viral DNA. Finally, the analytical sensitivity of Multiplex PCR has been previously estimated at 10 copies/test for the detection of viral genome [25]. HPV16 Positive Specimens
qRT-PCR Copies/test
IsoPCR
Multiplex PCR
Conventional PCR
Simple LAMP
9969.14 LBC54 D61 10715 14 9983.14 158.15 212.15 10657.15 2095 1759
3 4 10 11 20 55 110 11 11 13
+ + + + + + + + + +
– – + + + + + + + +
– – + + + + + + + +
– – – – – + + – – –
HPV18 Positive Specimens
qRT-PCR Copies/test
IsoPCR
Multiplex PCR
Conventional PCR
Simple LAMP
9991.14 1002.14 PNL38 s1099.13 s118.13 9973.14 S401-16
4 4 5 145 1978 4 10
+ + + + + + +
– – – + + – +
– – – + + – +
– – – + + – –
4. Discussion
conventional PCR and LAMP, using the newly designed E6 type-specific primer sets were applied in the same clinical samples. Conventional PCR confirmed the outcomes of Multiplex PCR. In contrast, the assay of conventional LAMP identified viral DNA in clinical samples that were diagnosed as positive with IsoPCR, Multiplex PCR and PCR but failed to detect the viral DNA in cervical samples with viral load lower than 25 copies/reaction (Table 3), (Figs. 1 and 2). In order to prove the competences of IsoPCR as well as to elucidate the inconsistency among the different molecular approaches a sensitivity control was conducted, while the analytical sensitivity of IsoPCR was considered together with that of conventional PCR and LAMP. In particular, solutions with different copy numbers of HPV16 and HPV18 DNA (100, 50, 25, 10 and 1 copy), were subjected to IsoPCR, conventional PCR and LAMP, respectively. The analytical sensitivity of the newly established protocol of IsoPCR was found to be 1 copy/reaction for the identification of both HPV16 and HPV18 DNA, while that of conventional PCR was determined at 10 and that of conventional LAMP at 25 copies/reaction for the detection of both HPV16 and HPV18 DNA (Fig. 3). In addition, the specificity of IsoPCR was assessed by testing the cross-reactivity of the newly designed E6 type-specific HPV16 and HPV18 primer sets for HPV genotypes 31, 33,35, 45, 51, 58 and 66. Amplicons were only observed when the primer sets were reacted with HPV16 and HPV18 genome. Hence, the primer sets that were used in the present assay were specific only for HPV16 and HPV18 E6 genes, respectively. Finally, optimal IsoPCR assay was evaluated for the detection of HPV16 and HPV18 in clinical specimens along with control cohort (Figs. 1 and 2). The diagnostic performance of IsoPCR was tested using the clinical samples that were found to be positive for HPV16 and HPV18 infection through quantitative Real-Time PCR. Moreover, a total of eighty-six HPV positive samples (genotypes 45, 35, 66, 33, 51, 58, and 31) and twenty-two HPV negative samples were also incorporated in the present study. Regarding the suitability of IsoPCR, HPV genotypes were detected with the same efficiency as with quantitative RealTime PCR, while the assay exhibited negative amplification signal in clinical samples that contained different HPV genotypes other than 16 or 18 or in samples that were negative for HPV infection. The analytical sensitivity, specificity, positive predictive value and negative predictive value of the IsoPCR assay were 100%.
Molecular methods for the detection of HR-HPV DNA are the goldstandard for the diagnosis of HPV infection as well as for the prediction of cervical disease development, especially in patients without any indications of abnormal cytological outcomes. The American Society for Colposcopy and Cervical Pathology (ASCCP; 2006, 2009 and 2012) recommends that women with a negative cytopathological test, but with a positive HPV test should be subjected to HPV genotyping screening. The detection of HPV16 and HPV18 in clinical specimens offers considerable information regarding the triage of colposcopy of HR-HPV-positive women who have greater risk in developing more severe dysplasias [9,10]. Although molecular approaches for HPV genotyping are used in regular cervical cancer screening, they are considered as time consuming, rather laborious and expensive, thus prohibiting their application in clinical laboratories [8,13]. As a result, it has become mandatory for research and clinical laboratories to implement more rapid and sensitive methodologies for HPV DNA genotyping. Towards this end we developed a 2-stage, nested-like nucleic acid amplification method, named IsoPCR, to amplify HPV16 and HPV18 DNA with increased analytical sensitivity [22]. It has been previously reported that IsoPCR confers an increased amplification sensitivity, down to 1 copy number of nucleotide-target per reaction, thus suggesting that IsoPCR is a point of care test for the detection of a wide range of human pathogens [22,26]. The increased analytical sensitivity of IsoPCR lies mainly on the fact that the assay combines the benefits of both PCR and LAMP, since it comprises of a first-stage PCR, followed by LAMP [22]. In the present analysis, an IsoPCR protocol was developed to specifically amplify a conserved region of the E6 gene of HPV16 and HPV18 by designing E6 type-specific primer sets, while the monitoring of results was conducted by a simple gel electrophoresis. The performance of IsoPCR was compared to that of conventional PCR and LAMP. The analytical sensitivity of this newly established protocol (of IsoPCR) was 10-fold higher than that of conventional PCR and 25-fold higher than that of LAMP for the detection of HPV16 and HPV18 DNA, respectively. In particular, the analytical sensitivity of IsoPCR was estimated at 1 copy/reaction for the detection of both HPV16 and HPV18 DNA, while the analytical sensitivity of conventional PCR and LAMP with the same E6 type-specific primer sets was evaluated at 10 copies/ reaction and 25 copies/reaction of viral DNA, respectively (Fig. 3). The 5
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
Programme “Toxicology” code 5050, of the University of Thessaly, School of Health Sciences, Department of Biochemistry & Biotechnology.
high analytical sensitivity of IsoPCR was confirmed in seven cervical samples positive for HPV16 DNA and five cervical samples positive for HPV18 DNA (Table 3). IsoPCR managed to detect HPV positive the above mentioned samples, whereas they were falsely diagnosed as negative by conventional PCR or conventional LAMP (Table 3). In particular, the conventional PCR failed to detect the viral DNA in clinical samples that contained < 10 copies of HPV16 and HPV18 DNA, while conventional LAMP could not amplify the viral DNA in clinical specimens that harbored < 25 copies (Table 3). In addition, IsoPCR showed equivalent sensitivity than that of Real-Time PCR. However, Real-Time PCR requires expensive and sophisticated equipment, which constraints its use in low budget laboratories [31]. It is important to underline that a previous study by Søe et al. [22] suggested that the method of IsoPCR facilitates the detection down to 1 copy of a specific nucleotide-target per test, thus strongly supporting our findings. Moreover, considering that the analytical sensitivity of the commercially available FDA approved HPV genotyping tests as well as the analytical sensitivity of most in-house HPV nucleic acid detection methods is between 10 and 100 copies/reaction we conclude that the newly developed protocol of IsoPCR is a highly sensitive molecular approach suitable for the detection of HPV16 and HPV18 DNA, even with very low viral load [8,20,25–30]. The newly developed protocol of IsoPCR conferred a considerable amplification specificity and efficiency, as well. In particular, no crossreaction was observed with HPV genotypes 31, 33, 35, 45, 51, 58 and 66. Also, no false positive amplicons were generated due to primer carryover from the pre-amplification step, since this step was only performed for 10 cycles, eliminating the generation of false positive results. As a consequence, we have developed a simple methodology that reaches the analytical sensitivity of the gold-standard Real-Time PCR.
References [1] H. zur Hausen, Papillomavirus infections - a major cause of human cancers, Biochim. Biophys. Acta 1288 (1996) F55–F78. [2] J. Doorbar, W. Quint, L. Banks, I.G. Bravo, M. Stoler, T.R. Broker, M.A. Stanley, The biology and life-cycle of human papillomaviruses, Vaccine 30 (2012) F55–F70. [3] T.A. Berman, J.T. Schiller, Human papillomavirus in cervical cancer and oropharyngeal cancer: one cause, two diseases, Cancer 123 (2017) 2219–2229. [4] Y. Li, C. Xu, Human papillomavirus-related cancers, Adv. Exp. Med. Biol. 1018 (2017) 23–34. [5] D. Saslow, D. Solomon, H.W. Lawson, M. Killackey, S.L. Kulasingam, J.M. Cain, et al., American cancer society, American society for colposcopy and cervical Pathology, and American society for clinical Pathology screening guidelines for the prevention and early detection of cervical cancer, J. Low. Genit. Tract Dis. 16 (2012) 175–204. [6] S. Good man, R.R. Mody, D. Coffey, B.K. Gorman, E. Luna, D. Armylagos, et al., Negative Pap tests in women with high-grade cervical lesions on follow-up biopsies: contributing factors and role of human papillomavirus genotyping, Diagn. Cytopathol. 46 (2018) 239–243. [7] P. Sinha, P. Srivastava, A. Srivastava, Comparison of visual inspection with acetic acid and the pap smear for cervical cancer screening, Acta Cytol. 62 (2018) 34–38. [8] D. Tsakogiannis, C. Gartzonika, S. Levidiotou-Stefanou, P. Markoulatos, Molecular approaches for HPV genotyping and HPV-DNA physical status, Expert Rev. Mol. Med. 19 (2017) e1. [9] P.E. Castle, M.H. Stoler, T.C. Wright, A. Jr Sharma, T.L. Wright, C.M. Behrens, Performance of carcinogenic human papillomavirus (HPV) testing and HPV16 or HPV18 genotyping for cervical cancer screening of women aged 25 years and older: a subanalysis of the ATHENA study, Lancet Oncol. 12 (2011) 880–890. [10] J.T. Cox, P.E. Castle, C.M. Behrens, A. Sharma, T.C. Wright Jr., J. CuzickAthena HPV Study Group, Comparison of cervical cancer screening strategies incorporating different combinations of cytology, HPV testing, and genotyping for HPV 16/18: results from the ATHENA HPV study, Am. J. Obstet. Gynecol. 208 (2013) 184.e1–184.e11. [11] M. Schiffman, N. Wentzensen, A suggested approach to simplify and improve cervical screening in the United States, J. Low. Genit. Tract Dis. 20 (2016) 1–7. [12] M. Del Pino, I. Alonso, A. Rodriguez-Trujillo, S. Bernal, D. Geraets, N. Guimerà, A. Torne, J. Ordi, Comparison of the analytical and clinical performance of five tests for the detection of human papillomavirus genital infection, J. Virol. Methods 248 (2017) 238–243. [13] A. Gradíssimo, R.D. Burk, Molecular tests potentially improving HPV screening and genotyping for cervical cancer prevention, Expert Rev. Mol. Diagn. 17 (2017) 379–391. [14] T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, T. Hase, Loop-mediated isothermal amplification of DNA, Nucleic Acids Res. 28 (2000) E63. [15] T. Notomi, Y. Mori, N. Tomita, H. Kanda, Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects, J. Microbiol. 53 (2015) 1–5. [16] P. Kumvongpin, C. Jearanaikool, N. Wilailuckana, P. Sae-Ung, S. Prasongdee, et al., High sensitivity, loop-mediated isothermal amplification combined with colorimetric gold-nanoparticle probes for visual detection of high risk human papillomavirus genotypes 16 and 18, J. Virol. Methods 234 (2016) 90–95. [17] D.M. Livingstone, M. Rohatensky, P. Mintchev, S.C. Nakoneshny, D.J. Demetrick, G. van Marle, J.C. Dort, Loop mediated isothermal amplification (LAMP) for the detection and subtyping of human papillomaviruses (HPV) in oropharyngeal squamous cell carcinoma (OPSCC), J. Clin. Virol. 75 (2016) 37–41. [18] K. Nagamine, T. Hase, T. Notomi, Accelerated reaction by loop-mediated isothermal amplification using loop primers, Mol. Cell. Probes 16 (2002) 223–229. [19] J. Fischbach, N.C. Xander, M. Frohme, J.F. Glökler, Shining a light on LAMP assays– a comparison of LAMP visualization methods including the novel use of berberine, Biotechniques 58 (2015) 189–194. [20] N.A. Tanner, Y. Zhang, T.C. Evans, Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes, Biotechniques 58 (2015) 59–68. [21] A.L. Blomström, M. Hakhverdyan, S.M. Reid, J.P. Dukes, D.P. King, S. Belák, M. Berg, A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus, J. Virol. Methods 147 (2008) 188–193. [22] M.J. Søe, M. Rohde, J. Mikkelsen, P. Warthoe, IsoPCR: an analytically sensitive,nested, multiplex nucleic acid amplification method, Clin. Chem. 59 (2013) 436–439. [23] I. Casas, L. Powell, P.E. Klapper, G.M. Cleator, New method for the extraction of viral RNA and DNA from cerebrospinal fluid for use in the polymerase chain reaction assay, J. Virol. Methods 53 (1995) 25–36. [24] P. Markoulatos, N. Siafakas, T. Katsorchis, M. Moncany, Multiplex PCR: rapid DNA cycling in a conventional thermal cycler, J. Clin. Lab. Anal. 17 (2003) 108–112. [25] D. Tsakogiannis, V. Diamantidou, E. Toska, Z. Kyriakopoulou, T.G. Dimitriou, I.G. Ruether, P. Gortsilas, P. Markoulators, Multiplex PCR assay for the rapid identification of human papillomavirus genotypes 16, 18, 45, 35, 66, 33, 51, 58, and 31 in clinical samples, Arch. Virol. 160 (2015) 207–214. [26] J. Song, C. Liu, M.G. Mauk, S.C. Rankin, J.B. Lok, R.M. Greenberg, H.H. Bau, Twostage isothermal enzymatic amplification for concurrent multiplex molecular
5. Conclusions In conclusion, IsoPCR is a cost effective, highly sensitive and specific molecular protocol for HPV16 and HPV18 DNA detection, halving the amplification time compared to PCR that is routinely used in HPV diagnosis. The analytical sensitivity, specificity, positive predictive value and negative predictive value of the IsoPCR assay for the detection of HPV16 and HPV18 DNA in clinical specimens were 100%. To the best of our knowledge, this is the first study that incorporates IsoPCR in HPV DNA detection and our results clearly show that this new method can be regarded as a highly sensitive and specific point of care diagnostic tool that requires non-sophisticated instrumentation and offers significant information, concerning HPV16 and HPV18 infection to healthcare providers and epidemiologists. Conflicts of interest All authors declare that they have not conflicting or dual interests. Ethical approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional research committee and with the 1964 Helsinki declaration and its later amendments. Informed consent Informed consent was obtained from all individual participants included in the study. Funding This study was funded by research grants of the Postgraduate 6
Molecular and Cellular Probes 45 (2019) 1–7
M. Daskou, et al.
1161–1168. [29] T. Souho, B. Bennani, Oncogenic human papillomavirus genotyping by multiplex PCR and fragment analysis, J. Virol. Methods 196 (2014) 45–49. [30] D. Tsakogiannis, M. Papacharalampous, E. Toska, Z. Kyriakopoulou, T.G. Dimitriou, I.G. Ruether, D. Komiotis, P. Markoulatos, Duplex Real-time PCR assay and SYBR green I melting curve analysis for molecular identification of HPV genotypes 16, 18, 31, 35, 51 and 66, Mol. Cell. Probes 29 (2015) 13–18. [31] M.L. Wong, J.F. Medrano, Real-time PCR for mRNA quantitation, Biotechniques 39 (2005) 75–85.
detection, Clin. Chem. 63 (2017) 714–722. [27] K. Sotlar, D. Diemer, A. Dethleffs, Y. Hack, A. Stubner, N. Vollmer, S. Menton, M. Menton, K. Dietz, D. Wallwiener, R. Kandolf, B. Bültmann, Detection and typing of human papillomavirus by e6 nested multiplex PCR, J. Clin. Microbiol. 42 (2004) 3176–3184. [28] M. Nishiwaki, T. Yamamoto, S. Tone, T. Murai, T. Ohkawara, T. Matsunami, M. Koizumi, Y. Takagi, J. Yamaguchi, N. Kondo, J. Nishihira, T. Horikawa, T. Yoshiki, Genotyping of human papillomaviruses by a novel one-step typing method with multiplex PCR and clinical applications, J. Clin. Microbiol. 46 (2008)
7