β-adrenergic receptors in the up-regulation of COX2 expression and prostaglandin production in testicular macrophages: Possible relevance to male idiopathic infertility

Molecular and Cellular Endocrinology 498 (2019) 110545

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

β-adrenergic receptors in the up-regulation of COX2 expression and prostaglandin production in testicular macrophages: Possible relevance to male idiopathic infertility

T

María Eugenia Matzkina,b,∗, Eugenia Rivierea,c, Soledad Paola Rossia,b, Roberto Ponziod, Elisa Puigdomeneche, Oscar Levallef, Claudio Terradase,f,g, Ricardo Saúl Calandraa, Artur Mayerhoferh, Mónica Beatriz Frungieria,c a

Instituto de Biología y Medicina Experimental, CONICET, Ciudad de Buenos Aires, 1428, Argentina Cátedra de Bioquímica Humana, Facultad de Medicina, Universidad de Buenos Aires, Ciudad de Buenos Aires, 1121, Argentina Cátedra de Química, Ciclo Básico Común, Universidad de Buenos Aires, Ciudad de Buenos Aires, 1405, Argentina d Instituto de Investigaciones en Reproducción, Facultad de Medicina, Universidad de Buenos Aires, Ciudad de Buenos Aires, 1121, Argentina e Instituto Médico PREFER, San Martín, Buenos Aires, B1650, Argentina f División Endocrinología, Hospital C.G. Durand, Facultad de Medicina, Universidad de Buenos Aires, Ciudad de Buenos Aires, 1405, Argentina g Instituto de Alta Complejidad San Isidro, Buenos Aires, 1642, Argentina h Biomedical Center Munich (BMC), Cell Biology, Anatomy III, Ludwig-Maximilians-University (LMU), D-82152, Planegg, Germany b c

A R T I C LE I N FO

A B S T R A C T

Keywords: Macrophages Epinephrine Norepinephrine Cyclooxygenase 2 Inflammation Idiopathic infertility

Catecholaminergic neuronal elements (CNE) and macrophages (MACs) are increased in testes of patients with idiopathic infertility. Now, we describe an anatomical proximity between CNE and MACs, expression of specific α- and β-adrenergic receptors (ADRs) subtypes in MACs, and a positive correlation between the number of MACs and cyclooxygenase (COX2) expression - key enzyme in prostaglandin (PG) synthesis and an inflammatory marker - in testes of infertile men. To examine a potential effect of adrenergic input on COX2 expression, we used two additional experimental models: non-testicular human MACs (THP1 cell line) and non-human testicular MACs purified from adult Syrian hamsters. We found that epinephrine and norepinephrine up-regulate COX2 expression and PGD2 production through β1-and β2-ADRs. Our results demonstrate the existence of a yet unknown link between CNE and MACs in the human testis that could trigger inflammation and tissue homeostatic dysregulation associated with pathogenesis or maintenance of infertility states.

1. Introduction

not the only synthesizing location for NE, as the locus coeruleus has been recently shown to contain NE-synthesizing neurons (Benarroch, 2018). In response to an acute stressor, catecholamine levels in blood increase within minutes (Ward et al., 1983; Little et al., 1986; Neubert et al., 1996). Testicular catecholamines can also derive from neuronal elements. In non-human and human primates’ testes, catecholaminergic neuronal elements are comprised not only by catecholaminergic nerve fibers but also by neuron-like cells (Mayerhofer et al., 1999; Frungieri et al., 2000). The aforementioned nerve fibers and neuron-like cells were characterized by positive immunostaining for neuronal markers such as synaptosomal nerve-associated protein 25 (SNAP25), neurofilament 200 (NF200), dopamine transporter (DAT) as well as tyrosine hydroxylase (TH), the rate-limiting enzyme in cathecolamine synthesis

Neurotransmitters and neuropeptides have been shown to be involved in the maintenance of testicular homeostasis in several species. Over the years, it has been reported by our group and others the presence of epinephrine (Epi) and norepinephrine (NE) in rodents’ testes (e.g: rats and Syrian hamsters) (Mayerhofer et al., 1989; Campos et al., 1990) and in gonads of a non-human primate model, the rhesus monkey (Mayerhofer et al., 1996). At least in testes of adult rats, catecholamines are found not only in the capsule, but also in the interstitial compartment where they reach higher levels than those detected in circulation (Campos et al., 1990). In general terms, catecholamines are mainly produced in the adrenal gland and secreted into the circulation reaching peripheral tissues including the testis. The adrenal medulla is ∗

Corresponding author., Vuelta de Obligado 2490, Ciudad de Buenos Aires, 1428, Argentina. E-mail address: [email protected] (M.E. Matzkin).

https://doi.org/10.1016/j.mce.2019.110545 Received 23 May 2019; Received in revised form 25 July 2019; Accepted 13 August 2019 Available online 16 August 2019 0303-7207/ © 2019 Elsevier B.V. All rights reserved.

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

2. Materials and methods

(Mayerhofer et al., 1999; Frungieri et al., 2000). The intratesticular location of catecholaminergic neuronal elements suggests the existence of multiple sites of actions (Mayerhofer et al., 1999; Frungieri et al., 2000). Furthermore, catecholaminergic nerve fibers and neuron-like cells have been found to be in close anatomical association with interstitial cells, such as Leydig cells, and peritubular cells from the tubular wall (Mayerhofer et al., 1999). Effects of catecholamines on both of these cell populations have been extensively studied by our group and others (Miyake et al., 1986; Mayerhofer et al., 1993; Frungieri et al., 2002a; Stojkov et al., 2014; Rossi et al., 2018). Moreover, expression of TH and other enzymes involved in the biosynthesis of catecholamines has also been described in human Leydig cells (Davidoff et al., 2005). In addition, our group has previously reported an increase of NF200-immunoreactive neuronal elements in pathological testicular biopsies suggesting that the local neuronal system might participate in the pathogenesis or, at least, in the maintenance of infertility states (Mayerhofer et al., 1999). NE and/or Epi are implicated in a wide range of physiological processes through activation of nine different G-protein-coupled receptors. Based on pharmacological and molecular evidence, adrenergic receptors (ADRs) are classified into three major types: α1, α2 and β, each of which is further divided into at least three subtypes (α1A, α1B, α1D; α2A, α2B, α2C; β1, β2, and β3) (Ahlquist, 1966; Berthelsen and Pettinger, 1977; Fraser and Venter, 1980; Emorine et al., 1989). Different ADRs have been localized to several testicular cells. Both, α-ADRs and β-ADRs were described in Leydig cells, Sertoli cells, early spermatocytes, spermatozoa and myoid cells of the seminiferous tubules in different species (Anakwe et al., 1985; Skinner and Heindel, 1990; Adeoya-Osiguwa et al., 2006; Mhaouty-Kodja et al., 2007; Stojkov et al., 2014; Rossi et al., 2018). In this context, direct effects of NE and/or Epi have been reported on steroidogenesis, expression of inflammatory markers in seminiferous tubules as well as spermatozoa capacitation via specific ADRs (Mayerhofer et al., 1989; Frungieri et al., 2002a; Adeoya-Osiguwa et al., 2006; Rossi et al., 2018). There is another testicular cell population that could potentially be target of catecholamine actions that has been, thus far, neglected: the local macrophage (MAC) population. Numerous studies have demonstrated the expression of functional α- and β-ADRs on rodent peritoneal MACs, human alveolar and monocyte-derived MACs and even in MAC cell lines such as RAW264.7 and THP1 (Abrass et al., 1985; Liggett, 1989; Talmadge et al., 1993; Brown et al., 2003; Grisanti et al., 2010; Liao et al., 2015; Victoni et al., 2017). Nevertheless, until now, no studies had been performed to investigate the existence ADRs subtypes in testicular MACs and the potential role of catecholamines modulating cell function in this cell population. Interestingly, the increase of neuronal elements in testes of men suffering from idiopathic infertility is accompanied by a significant elevation in the number of testicular MACs (Frungieri et al., 2002b). Furthermore, our findings suggest that in such testicular pathologies, a pro-inflammatory environment prevails with another characteristic feature associated to the infertility status: the expression of cyclooxygenase 2 (COX2), key enzyme in prostaglandin (PG) synthesis (Frungieri et al., 2002b, 2002c). In this context, testicular MACs express COX2, thus being an important source of PGs (Matzkin et al., 2010; Rossi et al., 2014). Therefore, the aims of this study were to characterize the ADRs subtypes in testicular MACs and to analyze the potential role of Epi and NE on the regulation of COX2 expression and PG production in the local MAC population and consequently, on the development and/or maintenance of male infertility. Since no physiological experiments can be performed in testicular biopsy samples, we used two alternative experimental models that had been previously validated by our group: non-testicular human MACs (THP1 cell line) and non-human testicular MACs purified from adult Syrian hamsters (Matzkin et al., 2010; Rossi et al., 2014).

2.1. Human biopsies Eighteen (age range: 27–40 years old) men presenting idiopathic infertility, normal karyotype and non-obstructive azoospermia without an infection process were enrolled in this study. Informed consent was obtained from all the patients. Patients with known aetiology of infertility (i.e. varicocele, chromosome anomalies, genitourinary infections, mumps orchitis, hypogonadotropic hypogonadism, obstruction or agenesia of seminal ducts) were not included in this work. Patients underwent testicular biopsy. Samples were subjected to hematoxylin-eosin staining and were classified according to McLachlan et al. (2007). They were assigned to the following groups: infertile group showing altered spermatogenesis (hypospermatogenesis and Sertoli cell only Syndrome; n = 14) and control specimens (cases of idiopathic infertility revealing normal spermatogenesis without apparent histological abnormalities; n = 4). The protocol was designed in accordance with the Helsinki Declaration on human experimentation and its last modification (Taipei 2016), and approved by the Ethics Committees of Instituto de Biología y Medicina Experimental (IBYMECONICET, Buenos Aires, Argentina) and Hospital C. G. Durand (Buenos Aires, Argentina). 2.2. Animals Male Syrian hamsters (Mesocricetus auratus) were raised in our Animal Care Facility (Charles River descendants, Animal Care Lab., IBYME-CONICET, Buenos Aires) and kept from birth to adulthood in rooms at 23 ± 2 °C under a long-day (LD) photoperiod (14h light, 10h darkness; lights on 07:00–21:00 h). Animals had free access to water and Purina formula chow. Young adult hamsters aged 90 days were killed by asphyxia with carbon dioxide (CO2). At the time of sacrifice, testes were dissected and used for testicular MAC purification. All animal procedures were performed according to the regulations for the use of laboratory animals of the National Institute of Health (NIH, Bethesda, MA, USA) and approved by the Institutional Animal Care and Use Committee of IBYME-CONICET (CICUAL Protocol N° CE-039/ 2015). 2.3. Immunohistochemical analyses Human testicular biopsies were fixed in Bouin solution, dehydrated and embedded in paraffin wax. Consecutive testicular sections (5 μm) were used for immunodetection of CD68 and NF200 following the immunohistochemistry protocol described in Matzkin et al. (2016). The following primary antibodies were used: monoclonal mouse anti-CD68 antibody (1:50, DAKO #M0876, Hamburg, Germany) and monoclonal mouse anti-NF200 antibody (1:50, Boehringer Mannheim Biochemica #1178709, Mannheim, Germany). Immunoreactions were visualized using a biotinylated secondary antiserum (1:500, horse anti-mouse IgG serum, Vector Laboratories Inc., Burlingame, CA, USA) and an avidinbiotin-peroxidase system (Vector Laboratories Inc.). For control purposes, either the first antibody was omitted or incubation was carried out with normal non-immune sera. Quantification of CD68-immunoreactive testicular macrophages was performed using a Zeiss microscope with 400X magnification and a gridded eyepiece. In each testicular section, all fields were evaluated. The results are expressed as CD68-immunoreactive macrophages per mm2 and CD68-immunoreactive macrophages per tubule. 2.4. Laser capture microdissection and RT-PCR analyses in human testicular biopsies Testicular sections were deparaffinized and immunostained with anti-CD68 antibody as described above. Subsequently, laser capture 2

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

Table 1 Oligonucleotide primers used for RT-PCR and qRT-PCR analyses Gene

Primer sequence 5’-3’

Sample

Amplicon size

Application / Annealing T°

α1A ADR

Fw: GGCTCCTTCTACCTGCCTCT Rv: AGGGCTTGAAATCAGGGAAG Fw: GCTAAGACGTTGGGCATTGTGGT Rv: TGGGGTTGAGGCAGCTGTTGAAGT Fw: TTCTTCATCGCTCTACCGCT Rv: AGCCAGAACACCACCTTGAA Fw: TCTGCTGGTTCCCTTTCTTC Rv: CACGCAGCTGTTGAAGTAGC Fw: GTGCACCTGTGCGCCATC Rv: GCCGAGATGACCCACACG Fw: CTGGCCAACGAGCTGCTG Rv: GATGCGGCGCGGGGTGC Fw: CCGACGGCGCCGCCTAC Rv: TAGACCAGGCCCATGATGAG Fw: GCTGCAGACGCTCACCA Rv: GCGAGGTAGCGGTCCAG Fw: ACTTCCATTGATGTGCTGTG Rv: CAGGCTCTGGTACTTGAAAG Fw: CACAGCCATTGCCAAGTTCG Rv: CGGGCCTTATTCTTGGTCAG Fw: CTTTGCCAACGGCTCGAC Rv: CTTTGCCAACGGCTCGAC Fw: ACCTGGCTGTGACCAAC Rv: ACTGGCTCATGATGGGC Fw: CTGGCGCTCAGCCATACAG Rv: ACACTCATACATACACCTCGGT Fw: TGCACCACCAACTGCTTAGC Rv: GGCATGGACTGTGGTCATGAG Fw: GTRCCCATCCCCACYTG Rv: GAGAGCAGGTCVAGGTG Fw: GTGCTGGGTCACTGGCTG Rv: CCCGCACACAGCATGTC Fw: CTGGCTGTGGGGACACTC Rv: ATTGCCCACACACAGCTG Fw: GAGTGGAACCCCAATGTC Rv: GCACCATGCAAGTGGGAC Fw: ACACGGACAGGATTGACAGATT Rv: CGTTCGTTATCGGAATTAACCA

Human-tMAC, THP1-MAC, Hamster-tMAC

339 bp

RT-PCR / 60°C

Human-tMAC, THP1-MAC

160 bp

RT-PCR / 60°C

Hamster-tMAC

149 bp

RT-PCR / 60°C

Human-tMAC, THP1-MAC, Hamster-tMAC

115 bp

RT-PCR / 60°C

Human-tMAC, THP1-MAC, Hamster-tMAC

121 bp

RT-PCR / 60°C

Human-tMAC, THP1-MAC, Hamster-tMAC

179 bp

RT-PCR / 60°C

Human-tMAC, THP1-MAC, Hamster-tMAC

108 bp

RT-PCR / 60°C

Human-tMAC, THP1-MAC, Hamster-tMAC

212 bp

RT-PCR / 55°C

Human-tMAC

104 bp

RT-PCR / 58°C

THP1-MAC, Hamster-tMAC

287 bp

RT-PCR / 55°C

Human-tMAC

110 bp

RT-PCR / 55°C

THP1-MAC, Hamster-tMAC

122 bp

RT-PCR / 55°C

THP1-MAC, Hamster-tMAC

70 bp

qRT-PCR / 60°C

THP1-MAC, Hamster-tMAC

109 bp

qRT-PCR / 55°C

Human-tMAC

255 bp

RT-PCR / 55°C

Human-tMAC

177 bp

RT-PCR / 56°C

Human-tMAC

176 bp

RT-PCR / 56°C

Human-tMAC

244 bp

RT-PCR / 60°C

Human-tMAC

109 bp

RT-PCR / 60°C

α1B ADR α1B ADR α1D ADR α2A ADR α2B ADR α2C ADR β1 ADR β2 ADR β2 ADR β3 ADR β3 ADR

COX2 GAPDH CD68 Tryptase Chymase StAR 18S

ADR: adrenergic receptor; MAC: macrophages; tMAC: testicular macrophages; T°: temperature.

Pharmingen #554954, San Diego, CA) and ED2 antigen (mouse antiED2 antibody, BD Pharmingen #550573).

microdissection (LCM) was performed as described earlier (Matzkin et al., 2016). RNA from approximately 100 CD68-immunoreactive cells was extracted using TRIzol Reagent (Invitrogen, Valencia, MO, USA) following the manufacturer's instructions. Reverse transcription (RT)reactions were performed using 100 ng total RNA and dN6 random primers as described previously (Matzkin et al., 2016). RT-PCR analyses were performed using the specific oligonucleotides listed in Table 1. PCR conditions were 95 °C for 5 min, followed by cycles of 95 °C for 1 min, 55–60 °C (annealing temperature, see Table 1) for 1 min and 72 °C for 1 min, and a final incubation at 72 °C for 5 min. PCR products were separated on 2% agarose gels, and visualized with ethidium bromide. The identity of the cDNA products was confirmed by sequence analysis on an ABI 373A DNA sequencer (Applied Biosystems).

2.6. Cell culture The human THP-1 monocyte line (ATCC® TIB-202; Riversville, MD, USA) is derived from an acute monocytic leukemia patient. THP1 monocytes can be differentiated to MACs by in vitro incubation in the presence of phorbol 12-myristate 13-acetate (PMA) (adapted from Tsuchiya et al., 1982). THP1 cells were cultured at 37 °C in RPMI1640 medium supplemented with 10% fetal calf serum and 0.05 mM 2-mercaptoethanol (humidified atmosphere 5% CO2 - 95% air). For in vitro incubations, 3 × 106 cells were seeded in 6-well plates followed by THP1 differentiation for 24h in the presence of 30 nM PMA (as described in Matzkin et al., 2010). Non-attached cells were removed by gentle washing with culture medium before stimulations were performed.

2.5. Purification of testicular macrophages from adult Syrian hamster testes Testicular MACs were purified as previously described by Rossi et al. (2014) with minor modifications. Briefly, decapsulated testes were incubated in a shaking water bath at 34 °C for 5 min in the presence of 0.2 mg/ml collagenase type I (Sigma Chemical, St. Louis, MO, USA). Collagenase activity was stopped by dilution with RPMI1640 medium (Sigma Chemical), and the tubules were allowed to settle for 3 min. Supernatants were centrifuged and the pellet was resuspended in RPMI1640 medium. Cell suspension was seeded in 60 mm culture dishes and placed for 7 min in an incubator at 37 °C (humidified atmosphere 5% CO2-95% air). Unattached cells were discarded by gentle washing. Attached cells were 85–95% enriched with testicular MACs immunopositive for ED1 antigen (mouse anti-ED1 antibody, BD

2.7. In vitro incubations In vitro incubations of hamster testicular MACs and THP1 MACs were carried out at 37 °C (5% CO2 - 95% air) for 10 min, 30 min, 1h, 3h, 6h 12h or 24h in the presence or absence of the following chemicals: epinephrine (1 μM, ICN Biochemicals Inc., Aurora, OH, USA), norepinephrine (1 μM, Sigma Chemical), isoproterenol (1 μM, Sigma Chemical), denopamine (1 μM, Sigma Chemical), salbutamol (1 μM, Sigma Chemical) or phenylephrine (1 μM, ICN Biochemicals Inc.). In some experiments, testicular MACs and THP1 MACs were co3

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

incubated in the presence of ADRs antagonists: propranolol (1 μM, ICN Biochemicals Inc.), atenolol (10 nM, Gador, Buenos Aires, Argentina), or butoxamine (200 nM, Santa Cruz, Biotechnology Inc., Santa Cruz, CA, USA). In this study, denopamine stock solution was prepared in dimethyl sulfoxide (DMSO) (ICN Biomedicals Inc.), whereas the remainder of the chemicals stock solutions were prepared in 0.1 mM ascorbic acid. These solutions were then further diluted in RPMI1640 medium. An appropriate volume of DMSO (1 μl DMSO/ml RPMI1640 medium) or ascorbic acid (10 μl 0.01 mM ascorbic acid/ml RPMI1640 medium) was added to control experiments in order to account for possible effects of DMSO or ascorbic acid. After incubations, cells were used either for RNA extraction followed by real time quantitative reverse transcription polymerase chain reaction (qRT–PCR) or protein extraction followed by immunoblotting. Media were collected and used for PGD2 determination assays.

Arbor, MI, USA), rabbit monoclonal anti-GAPDH antibody (1:1000, Cell Signaling Technology Inc. #2118, Beverly, MA, USA) or mouse monoclonal anti-actin antibody (1:5000, Calbiochem #CP01, La Jolla, CA, USA). Subsequently, the following peroxidase-labeled secondary antibodies were used: goat anti-rabbit IgG antiserum (1:2500, SigmaAldrich #A0545, St Louis, MO, USA) for COX2 and GAPDH, and goat anti-mouse IgM antiserum (1:2000, Santa Cruz Biotechnology Inc. #sc2064, Santa Cruz, CA, USA) for actin. Signals were detected with an enhanced chemiluminescence kit (BIORAD). 2.11. PGD2 assay This assay was performed using a commercially available EIA kit (Cayman Chemical) as described earlier (Matzkin et al., 2010, 2016). PGD2 concentrations in human testicular samples were determined using 100 μg protein human testicular tissue lysates aliquots prepared as explained in section 2.10. Before the assay, proteins were precipitated as described earlier (Matzkin et al., 2016). In vitro production of PGD2 was assayed in cell culture supernatants as described previously (Matzkin et al., 2012). Supernatants were pre-treated with methoxylamine hydrochloride (MOX-HCl) and acidified using 1M citrate buffer (final pH 4.7) before being injected into 200 mg C18 columns. Samples were eluted with ethyl acetate, evaporated to dryness under a nitrogen stream and finally reconstituted in EIA assay buffer. The minimum detectable PGD2 concentration was 0.28 femtomole (fmol)/tube. Coefficients of variation were less than 10% (intra-assay) and 15% (inter-assay). Results were expressed as pmol PGD2/mg protein and fmol PGD2/1 × 106 cells.

2.8. qRT-PCR analyses Total RNA was extracted from Syrian hamster testicular MACs or THP1 MACs using TRIzol Reagent (Invitrogen). RT-reaction was performed using 500 ng total RNA and dN6 random primers. RNA extraction, RT-reaction and qRT-PCR assays were performed as described previously (Matzkin et al., 2016). Specific oligonucleotide primers listed in Table 1 were used. Reactions were conducted using FastStart Universal SYBR Green Master Mix (Roche Diagnostics GmbH, Mannheim, Germany) and the CFX96 Touch Real Time PCR Detection System (Biorad, Hercules, CA, USA). The reaction conditions were as follows: 10 min at 95 °C (one cycle), followed by 40 cycles of 30 s at 95 °C, 30 s at 55 °C, 1 min at 60°C and 1 min at 72 °C for COX2 and 10 min at 95 °C (one cycle), followed by 40 cycles of 15 s at 95 °C, 30 s at 55 °C, and 1 min at 60 °C for GAPDH. Following a mathematical model (Pfaffl, 2001), the relative levels of COX2 mRNA expression were determined for each sample. GAPDH was chosen as the housekeeping gene.

2.12. Statistical analyses For correlation studies, the variables (COX2 testicular relative expression levels, MAC/mm2 or MAC/tubule) were subjected to a Kolmogorov-Smirnov Normality Test in order to ensure a Gaussian distribution. Subsequently, Pearson's linear correlation coefficient (r) was calculated. Correlation coefficient was considered significantly different from zero when p < 0.05. Statistical analyses were performed using Student t-Test for comparing two groups (for testicular biopsies analyses) or ANOVA followed by Student-Newman-Keuls test for multiple comparisons (for in vitro experiments). Data are expressed as mean ± SEM. Differences were considered statistically significant when p < 0.05. For immunoblotting studies, bands were quantified by densitometry and normalized to GAPDH (for human testicular lysates) or actin (for cell culture lysates) using ImageJ software (ImageJ, U.S., NIH, Bethesda, MA, USA, http://imagej.nih.gov/ij/).

2.9. Immunofluorescence assays Freshly isolated hamster testicular MACs or human THP1 MACs were fixed in 4% formalin for 10 min at room temperature. Cells were washed in PBS followed by a 10 min incubation in block solution (2% normal goat serum, 0.3% Triton prepared in PBS). Incubation with policlonal rabbit anti-β2 ADR antiserum (1:50, LifeSpan BioSciences Inc. #LS-C117994, Seattle, WA, USA) diluted in incubation buffer (2% normal goat serum, 0.3% Triton prepared in PBS) was carried out in a humidified chamber at 4 °C for 18h. Cells were washed with PBS and incubated for 1h at room temperature with goat anti-rabbit-FITC antiserum (1:800, Santa Cruz Biotechnology #sc-2359). Cells were washed and nuclei were counterstained with 0.5 μg/ml DAPI (SIGMA-Aldrich #D9541) for 5 min. Cover slips were mounted using ProLong Gold Antifade Mountant (Thermo Fisher Scientific, Waltham, MA, USA). Examination was performed by fluorescence microscopy (Zeiss, Oberkochen, Germany). For control purposes, either the first antibody was omitted or incubation was carried out with 2% normal goat serum.

3. Results 3.1. COX2 expression levels and PGD2 production are increased in testicular biopsies of infertile patients: correlation with the local MAC number Total homogenates of human testicular samples without apparent histological abnormalities (control specimens) as well as from men suffering from idiopathic infertility (hypospermatogenesis and Sertoli cell only Syndrome) were evaluated by immunoblotting and immunoassay to determine the expression levels of COX2 and PGD2 production, respectively. In patients with impaired spermatogenesis, testicular COX2 expression levels (Fig. 1A) and PGD2 production (Fig. 1B) were doubled when compared to testes of men that showed no abnormalities in spermatogenesis. As our group had previously reported (Frungieri et al., 2002a), CD68-immunopositive MACs found in the interstitium, tubular wall, and tubular lumen showed a statistically increase in testicular biopsies of patients with hypospermatogenesis and Sertoli cell only Syndrome

2.10. Immunoblotting Human testicular samples, THP1 MACs and Syrian hamster testicular MACs were lysed in supplemented RIPA buffer as described earlier (Matzkin et al., 2010, 2016). Protein content was assayed by the method described by Lowry et al. (1951). Samples were used immediately or stored at −80 °C until needed. Blots were performed as previously described (Matzkin et al., 2010, 2016) using 50 μg protein human testicular tissue lysates or 10 μg protein cell lysates. Incubations were carried out using rabbit polyclonal anti-COX2 antiserum (1:250, Cayman Chemical #160106, Ann 4

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

Fig. 1. COX2 expression levels and PGD2 production are up-regulated in testes of men suffering from idiopathic infertility. Human testicular biopsy samples were divided into two groups: idiopathic infertility (hypospermatogenesis and Sertoli cell only Syndrome) and control specimens (cases of idiopathic infertility without apparent testicular abnormalities). Panel A: COX2 protein expression was evaluated by immunoblotting. Representative immunoblots for each group are shown. Lanes 1–4: control; lanes 5–6: Sertoli cell only Syndrome; lanes 7–8: hypospermatogenesis. Results were normalized to GAPDH and expressed as fold change relative to the control group. Panel B: PGD2 levels were evaluated by immunoassay in human testicular biopsies. Panel C: representative micrographs of CD68-immunoreactive macrophages (MACs) in human testicular biopsies are shown. Bar, 50 μm. Quantification of total testicular MACs are expressed as MACs per mm2 and MACs per tubule. Bar plot graphs represent the mean ± SEM (n = 4–15). *p < 0.05; Student's t-Test.

3.3. β-ADRs are involved in the induction of COX2 expression levels and the increase of PGD2 production in human THP1 MACs

compared to normal testes (Fig. 1C). In addition, a positive correlation between the overall CD68-immunoreactive MAC number and COX2 testicular expression levels has been detected (CD68-immunoreactive MACs/mm2; r = 0.605, p < 0.05 or CD68-immunopositive MACs/tubule; r = 0.654, p < 0.05).

ADRs expression was evaluated in human non-testicular THP1 MACs by RT-PCR. ADRs subtypes α1B, α1D, α2A, α2B, α2C, β1, β2 and β3 were found to be expressed (Fig. 3A). β2-ADR expression was further confirmed by immunofluorescence (Fig. 3B). In vitro THP1 MACs culture experiments were performed in the presence or absence of the following ADRs agonists: isoproterenol (β1β2-β3-ADRs agonist; 1 μM), phenylephrine (selective α1-ADR agonist; 1 μM) or clonidine (selective α2-ADR agonist; 1 μM), followed by the analysis of COX2 mRNA expression by qRT-PCR. Isoproterenol upregulated COX2 mRNA expression after 30 and 60 min incubations. No effect of isoproterenol was detected when THP1 MACs were incubated for 10 min. COX2 mRNA expression levels remained unchanged in the presence of the selective agonists phenylephrine (α1-ADR) or clonidine (α2-ADR) (Fig. 3C). To further confirm the participation of β-ADRs in the regulation of COX2 expression, THP1 MACs were incubated for 1h in the presence or absence of isoproterenol (β1-β2-β3-ADRs agonist; 1 μM) with or without the addition of different β-ADRs antagonists. The stimulatory effect of isoproterenol was completely abolished by the presence of propranolol (β1-β2-ADRs antagonist; 1 μM) or atenolol (selective β1ADR antagonist; 10 nM) and partially prevented by butoxamine (selective β2-ADR antagonist; 200 nM) (Fig. 4A). To determine which β-ADRs subtypes might actually be involved in this regulatory mechanism, THP1 MACs were incubated for 1h in the presence or absence of denopamine (selective β1-ADR agonist; 1 μM; Fig. 4B) or salbutamol (selective β2-ADR agonist; 1 μM; Fig. 4C). Both agonists significantly increased COX2 mRNA expression and their stimulatory effects were reversed in the presence of propranolol (β1-β2ADRs antagonist; 1 μM; Fig. 4B and C). The stimulatory effect of denopamine in THP1 MACs was abolished by atenolol (selective β1-ADR antagonist; 10 nM; Fig. 4B), while butoxamine (selective β2-ADR antagonist; 200 nM) reversed the positive effect exerted by salbutamol in this cell line (Fig. 4C). When THP1 MACs were incubated in the presence of epinephrine

3.2. Testicular MACs, which show an anatomical proximity with neuronal elements, express different ADRs subtypes in testes of infertile men Immunohistochemical analyses of consecutive testicular sections from a patient suffering from hypospermatogenesis show that MACs (CD68-immunoreactive) and neuronal elements (NF200-immunoreactive) display anatomical proximity (Fig. 2, upper Panel). The same results were obtained when consecutive testicular sections from Sertoli cell only Syndrome patients were evaluated (data not shown). Using laser capture microdissection (LCM), CD68-immunoreactive interstitial MACs were isolated from testicular sections of a control specimen (case of idiopathic infertility without apparent testicular abnormalities; Fig. 2, middle Panel) and a patient suffering from hypospermatogenesis (Fig. 2, lower Panel). In each case, the same section is portrayed before (Fig. 2A and E) and after LCM (Fig. 2B and F). RT-PCR studies performed in human testicular MACs isolated by LCM from control specimens and infertility patients showed that these immune cells express ADRs subtypes α1B, α2B, β1 and β3. No expression of ADRs subtypes α1A or α2A was detected (Fig. 2C and G). However, a differential expression of some ADRs subtypes was observed in these cell populations. Expression of ADRs subtypes α1D and β2 was observed in testicular MACs from infertile men while no expression of such receptors was detected in MACs isolated from control testicular sections (Fig. 2C and G). Moreover, ADR subtype α2C could only be detected in MACs isolated from control testicular sections (Fig. 2C and G). The isolated cells from both, idiopathic infertility patients and control specimens, represented pure cell populations of testicular MACs, as contamination with other possible interstitial cells was ruled out due to the lack of expression of specific cell markers for mast cells (tryptase, chymase) or Leydig cells (StAR) (Fig. 2E and H). 5

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

(1 μM) or norepinephrine (1 μM), mRNA expression levels of COX2 were induced following 1h incubations (Fig. 5A). The addition of propranolol (β1-β2-ADRs antagonist; 1 μM) to the incubation media, restored COX2 mRNA expression to levels comparable to those found under basal conditions (Fig. 5A). Propranolol alone had no effect on COX2 expression (Fig. 5A). Similar results were observed when COX2 protein expression levels were analyzed in THP1 MACs that were incubated for longer periods (6h and 12h) (Fig. 5B). No changes were detected in COX2 protein expression after 1h, 3h and 24h incubations in the presence of epinephrine (1 μM) or norepinephrine (1 μM) (data not shown). The analysis of PGD2 production was performed to confirm that COX2 up-regulation leads to the synthesis of an active enzyme. The stimulatory effect on COX2 protein expression observed at 6h and 12h following stimulation with epinephrine (1 μM) or norepinephrine (1 μM) was accompanied by an increase in PGD2 production as well (Fig. 5C). Moreover, this effect was partially abolished by the addition of propranolol (β1-β2-ADRs antagonist; 1 μM) (Fig. 5C). 3.4. β-ADRs are involved in the induction of COX2 expression levels and the increase of PGD2 production in Syrian hamster testicular MACs The expression of ADRs subtypes was assessed in Syrian hamster testicular MAC primary cell cultures by RT-PCR. α-ADRs subtypes 1B, 1D, 2A, 2B and 2C and β-ADRs subtypes 1, 2 and 3 were found to be expressed (Fig. 6A). The expression of β2-ADR was further confirmed by immunofluorescence (Fig. 6B). Relative COX2 mRNA expression levels were assessed by qRT-PCR following 1h incubations in the presence or absence of epinephrine (1 μM), norepinephrine (1 μM) and the following adrenergic agonists: isoproterenol (β1-β2-β3-ADRs agonist; 1 μM), denopamine (selective β1-ADR agonist; 1 μM), salbutamol (selective β2-ADR agonist; 1 μM), phenylephrine (selective α1-ADR agonist; 1 μM) and clonidine (selective α2-ADR agonist; 1 μM). Epinephrine and norepinephrine significantly induced COX2 mRNA expression, as did isoproterenol, denopamine (to a lesser extent) and salbutamol (Fig. 6C). In contrast, αADRs agonists did not show any effect on COX2 mRNA expression (Fig. 6C). COX2 protein levels (Fig. 6D) and PGD2 production (Fig. 6E) were induced by epinephrine (1 μM) and norepinephrine (1 μM) after 6 and 12h incubations. The β1-β2-ADRs antagonist propranolol (1 μM) was able to, at least, partially block the stimulatory effect of epinephrine (1 μM) and norepinephrine (1 μM) on COX2 protein expression (Fig. 6D) and PGD2 production (Fig. 6E). 4. Discussion Although the testis is an immunoprivileged organ, immune cells present in the interstitium retain the ability to mount inflammatory and innate immune responses (Pérez et al., 2013). Local inflammation in the testis is very much accepted as an important factor in male idiopathic infertility. In general terms, infiltration of non-resident inflammatory immune cells can be observed in the testis indicating a profound disturbance of the delicate local immune regulation. We have previously reported a significant increase in the number of CD68-immunoreactive MACs in testes of men suffering from idiopathic infertility (Frungieri et al., 2002b; Matzkin et al., 2010). Our current results show that testicular expression levels of COX2 positively correlate with the number of local MACs, therefore suggesting the participation of these immune cells in the up-regulation of COX2 expression in men with impaired spermatogenesis. Immunohistochemical studies have previously shown that COX2 is mostly expressed in interstitial cells from testes showing abnormal spermatogenesis but can hardly be detected in normal testes (Frungieri et al., 2002c). Among the interstitial cell populations, most, but not all, Leydig cells found in the testis of infertile patients express COX2 (Frungieri et al., 2015). In addition, COX2 expression has also been described in MACs of the human

Fig. 2. Expression of adrenoreceptors (ADRs) in human testicular macrophages showing anatomical proximity with neuronal elements. Upper panel: immunolocalization of CD68 (macrophage marker) and neurofilament 200 (NF200, neuronal element marker) in consecutive testicular sections of men suffering from hypospermatogenensis were examined using a light microscope. Bar, 20 μm. Middle panel: interstitial CD68-immunoreactive testicular macrophages were isolated by Laser Capture Microdissection (LCM) from control specimens (cases of idiopathic infertility without apparent testicular abnormalities). The same section is illustrated before (Panel A) and after (Panel B) LCM. Bar, 20 μm. Lower panel: interstitial CD68-immunoreactive macrophages were isolated by LCM from biopsies of men suffering from hypospermatogenesis. The same section is illustrated before (Panel E) and after (Panel F) LCM. Bar, 20 μm. A total of approximately 100 CD68-immunopositive testicular macrophages were isolated by LCM and subsequently used to evaluate the expression of αADRs (α1A, α1B, α1D, α2A, α2B, α2C) and β-ADRs (β1, β2, β3) by RT-PCR (Panels C and G). To discard a potential contamination with other interstitial cell types, the expression of mast cell markers such as tryptase (Tryp) and chymase (Chym) as well as the expression of the Leydig cell marker StAR and housekeeping gene 18S was assessed (Panels D and H). 6

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

Fig. 3. COX2 mRNA levels are induced via β-ADRs expressed in the human THP1 MAC cell line. Panel A: ADRs subtypes (α1A, α1B, α1D, α2A, α2B, α2C, β1, β2, β3) expression was analyzed by RT-PCR in THP1 MACs. Panel B: ADR subtype β2 (green) was detected by immunofluorescence (left). Nuclei were counterstained with DAPI (middle) and the merged image is shown (right). Bar, 25 μm. Panel C: THP1 MACs were incubated for 10, 30 or 60 min in the presence or absence of the β1-β2β3-ADRs agonist isoproterenol (1 μM), the selective α1-ADR agonist phenylephrine (1 μM) or the selective α2-ADR agonist clonidine (1 μM). COX2 mRNA expression was assessed by qRT-PCR. Results were normalized to GAPDH housekeeping gene and analyzed using the mathematical model of Pfaffl. Bar plot graphs represent the mean ± SEM (n = 3 experiments). Different letters denote statistical difference (p < 0.05; Newman-Keuls Test).

detected except for α1A. In this context, Grisanti et al. (2010) had previously reported only the expression of ADRs subtypes α1B, α1D, β1 and β2 in THP1 monocytes prior to their PMA-induced differentiation into MACs, which could account for the slight differences in the expression pattern observed. In human testes, we showed the expression of ADRs subtypes α1B, α2B, β1 and β3 in testicular MACs isolated from, both, men suffering from idiopathic infertility and control specimens. No expression of ADRs subtypes α1A and α2A could be detected in any of the testicular MACs samples analyzed. Interestingly, there was a differential expression profile of specific ADRs subtypes in these cell populations. Expression of ADRs subtypes α1D and β2 was observed in testicular MACs from infertile men while no expression of such receptors was detected in MACs isolated from control testicular sections. Moreover, ADR subtype α2C could only be detected in MACs isolated from control testicular sections. Kelsen et al. (1997) have reported that the pro-inflammatory cytokine IL-1β induces β2-ADR mRNA expression levels, at least, in human airway epithelial cells. Our group has previously shown evidence of IL-1β being secreted by testicular MACs and Leydig cells in the infertile testis (Frungieri et al., 2002b; Matzkin et al., 2010; Rossi et al., 2014). Moreover, we have described that, in such testicular pathologies, a pro-inflammatory environment prevails leading to the up-regulation of COX2 expression which positively correlates with IL-1β testicular expression (Matzkin et al., 2010). On the other hand, unpublished data from our group indicates that expression levels of β2-ADR are higher in testes of men suffering from idiopathic infertility compared to those detected in testes without apparent abnormalities. Hence, it is possible to speculate that elevated IL-1β levels could account, at least in part, for the β2-ADR expression detected solely in MACs from infertile testes. As for the differential expression of ADRs subtypes α1D, α2C, at this point a possible explanation remains elusive. However, in general terms, the altered expression profile described in human testicular MACs from control and infertile testes involving ADRs subtypes could be related to differential activation states

infertile testis (Rossi et al., 2014). Hence, a better understanding of the different mechanisms that control COX2 expression in testes of patients suffering from idiopathic infertility seems relevant to explain how such pathological condition is initiated and/or sustained. Our group has previously reported that a significant increase of catecholaminergic neuronal elements can be detected in the testes of infertile men (Mayerhofer et al., 1999). Because our immunohistochemical analysis showed that some of these catecholaminergic neuronal elements are in close anatomical association with the local MAC population, which expresses a repertoire of α- and β-ADRs subtypes, in the present study we investigated whether the increased number of catecholaminergic neuronal elements detected in the testis of men suffering from idiopathic infertility could heighten a pro-inflammatory response (e.g: COX2 expression and PGD2 production) from the local MAC population through selective activation of specific ADRs subtypes. Unfortunately, no physiological experiments can be performed in testicular biopsy samples. In addition, to our knowledge, there are no human testicular MAC cell lines available. Hence, we performed in vitro experiments using two alternative models that had been previously validated by our group: non-testicular human MACs (THP1 cell line) and non-human testicular MACs purified from adult Syrian hamsters (Matzkin et al., 2010; Rossi et al., 2014). The latter, being chosen as the source of primary cell cultures of testicular MACs because we have previously demonstrated that testicular COX2 expression is much more abundant in this readily available species in comparison with other rodents (Frungieri et al., 2006). The presence of functional α- and β- ADRs in MACs has been reported previously by several groups (Abrass et al., 1985; Liggett, 1989; Talmadge et al., 1993; Brown et al., 2003; Liao et al., 2015; Victoni et al., 2017). However, to our knowledge, this is the first time that ADRs have been localized to testicular MACs, both in the human and the Syrian hamster. With respect to Syrian hamster testicular MACs and human non-testicular THP1 MACs, all ADRs subtypes evaluated were 7

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

experiments). Different letters denote statistical difference (p < 0.05; Newman-Keuls Test).

of these MAC populations as it was proposed for microglia by Gyoneva and Traynelis (2013). Certainly, further analyses are required to address this matter. It is worth noting that when expression of ADRs at the mRNA level could not be detected, the same primer sets were employed in samples of the human breast cancer MCF7 cell line and Syrian hamster brain tissue, which were used as positive controls, revealing the correspondent specific bands (data not shown). Using pharmacological tools, we found an up-regulation of COX2 expression in human THP1 MACs and testicular MACs purified from Syrian hamsters in the presence of isoproterenol (β1-β2-β3-ADRs agonist), while no effect was observed in the presence of phenylephrine (selective α1-ADR agonist) or clonidine (selective α2-ADR agonist), thus suggesting that COX2 mRNA expression is positively regulated via β-ADRs but not via α-ADRs. We were able to determine in both, human non-testicular THP1 MACs and hamster testicular MACs, a stimulatory effect on COX2 mediated via β1-ADRs and β2-ADRs independently, in response to denopamine (selective β1-ADR agonist) and salbutamol (selective β2-ADR agonist), respectively. Moreover, each corresponding stimulatory effect was prevented in the presence of selective β1-or β2ADR antagonists. Even though the stimulatory effect of isoproterenol (β1-β2-β3-ADRs agonist) was completely abolished in the presence of propranolol (β1-β2-ADRs antagonist), at this point we cannot completely rule out the possibility that β3-ADR might also participate to some extent in the regulation of COX2 expression in MACs. Further studies are required to address this matter. Our results stating a positive regulation exerted on COX2 expression via β-ADRs are supported by previous studies in other cell types such as rat primary microglial cell cultures and human ovarian cancer cells (Schlachetzki et al., 2010; Nagaraja et al., 2016). We, then, analyzed the effect of ADRs physiological ligands: Epi and NE. Both catecholamines stimulated COX2 mRNA and protein expression as well as PGD2 production in human THP1 MACs and Syrian hamster testicular MACs. In agreement with our results, Muthuswamy et al. (2017) have just recently reported that a prolonged exposure to Epi induces a significant increase of COX2 mRNA expression in human MACs derived from peripheral blood monocytes. Moreover, our group has recently described a positive modulation of COX2 mRNA expression by Epi in human testicular peritubular cells (Rossi et al., 2018). Epi and NE stimulatory effects in human THP1 MACs and Syrian hamster testicular MACs are exerted via β1- and β2-ADRs. At least at the mRNA level, Epi effect on COX2 expression was significantly higher than that of NE. While the affinity of the β1-ADR for NE and Epi does not differ, the affinity of the β2-ADR is significantly higher for Epi than for NE (Frielle et al., 1989). Therefore, we could speculate that β2-ADR elicits its effect on COX2 expression primarily by binding Epi. Bearing in mind, on the one hand, the plasma catecholamine levels previously described in humans in basal conditions as well as during stress (Ward et al., 1983; Little et al., 1986; Sofuoglu et al., 2001; Wortsman, 2002; Goldstein, 2003) and, on the other hand, the testicular catecholaminergic concentrations initially reported at least in rodents and non-human primates (Mayerhofer et al., 1989, 1996; Campos et al., 1990), the catecholaminergic effects on testicular COX2 expression and PGD2 production observed in the present study using a 1 μM dose can be considered of physio-pathological relevance. In the present work we described for the first time a novel potential link between the increase of catecholaminergic neuronal elements and the local MAC population in testes of patients with idiopathic infertility. Because we detected the expression of ADRs in MACs isolated from testicular biopsies of infertile men and testes of the Syrian hamster, and an Epi-/NE-mediated up-regulation of COX2 expression in MACs, we postulate that catecholamines may act as pro-inflammatory factors in

Fig. 4. COX2 mRNA expression is induced via ADRs subtypes β1 and β2 in the human THP1 MAC cell line. Panel A: THP1 MACs were incubated for 1h in the presence or absence of the β1-β2-β3-ADRs agonist isoproterenol (1 μM) with or without the β1-β2-ADRs antagonist propranolol (1 μM), the selective β1-ADR antagonist atenolol (10 nM) or the selective β2-ADR antagonist butoxamine (200 nM). Panel B: THP1 MACs were incubated for 1h in the presence or absence of the selective β1-ADR agonist denopamine (1 μM) with or without the β1-β2-ADRs antagonist propranolol (1 μM) or the selective β1-ADR antagonist atenolol (10 nM). Panel C: THP1 MACs were incubated for 1h in the presence or absence of the selective β2-ADR agonist salbutamol (1 μM) with or without the β1-β2-ADRs antagonist propranolol (1 μM) or the selective β2-ADR antagonist butoxamine (200 nM). COX2 mRNA expression was assessed by qRT-PCR. Results were normalized to GAPDH housekeeping gene and analyzed using the mathematical model of Pfaffl. Bar plot graphs represent the mean ± SEM (n = 3 8

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

Fig. 5. Epinephrine and norepinephrine induce COX2 expression and PGD2 production via β-ADRs in the human THP1 MAC cell line. THP1 MACs were incubated for 1h (Panel A), 6h or 12h (Panels B, C) in the presence or absence of epinephrine (1 μM) or norepinephrine (1 μM) with or without the β1-β2ADRs antagonist propranolol (1 μM). Panel A: COX2 mRNA expression was assessed by qRT-PCR. Results were normalized to GAPDH housekeeping gene and analyzed using the mathematical model of Pfaffl. Panel B: COX2 protein expression was assessed by immunoblot. Results were normalized to Actin and expressed as fold change relative to the control group (Basal), which was assigned a value of 1. PGD2 production was assessed by immunoassay in cell culture supernatants (Panel C). Bar plot graphs represent the mean ± SEM (n = 3 experiments). Different letters denote statistical difference (p < 0.05; Newman-Keuls Test).

(Rossi et al., 2018). Our studies are also important in terms of the extensive use of βADR antagonists, alone or in combination, to treat both cardiovascular and non-cardiovascular diseases, including hypertension, ischemic heart disease, arrhythmias, heart failure, hyperthyroidism, glaucoma

the infertile human testis. It is worth bearing in mind that, stress activates the sympathetic nervous system and is linked to impaired fertility in man. Thus, stress-associated elevation of circulating catecholamines may be able to promote inflammatory events by targeting MACs in the human testis, as it was recently suggested in human peritubular cells 9

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

1. PGD2 production was assessed by immunoassay in cell culture supernatants (Panel E). Bar plot graphs represent the mean ± SEM (n = 3 experiments). Different letters denote statistical difference (p < 0.05; Newman-Keuls Test).

and anxiety disorders (Sudhakar et al., 2016). There is virtually no information available about the impact of β-ADR antagonists on testicular function. Oyedeji et al. (2018) have recently reported an antispermatogenic effect of atenolol in rats. Authors claim that the drug was able to permeate the blood-testis barrier resulting in the alteration of the micro-environment of the seminiferous tubules. No additional experiments were performed to confirm this. The activation of the COX2/PGs system can impact heavily on testicular homeostasis. Previous reports from our group and others demonstrated specific roles for different PGs on several cellular processes. In this context, we have described a stimulatory effect of PGD2 on basal testosterone production in Syrian hamster Leydig cells (Frungieri et al., 2006). Conversely, an inhibitory role of PGF2α on hCG/LH inducedtestosterone synthesis, and StAR and 17β-hydroxysteroid dehydrogenase expression has been observed (Romanelli et al., 1995; Frungieri et al., 2006). We have also shown that glucose uptake is impaired by 15d-PGJ2 in Sertoli cells of the Syrian hamster (Matzkin et al., 2012). Additionally, 15d-PGJ2 has been linked to changes of the contractile ability and fibrotic thickening of the wall of the seminiferous tubules in patients with idiopathic infertility (Frungieri et al., 2002c; Kampfer et al., 2012). In this study, we report that along with COX2 protein expression levels, PGD2 production is significantly increased in men suffering from impaired spermatogenesis (hypospermatogenesis and Sertoli cell only Syndrome). PGD2 has previously been implicated in the regulation of the migration capacity of murine MACs (Tajima et al., 2008). This raises the possibility that local production of PGD2 could contribute to tissue recruitment of MACs thus intensifying the overall pro-inflammatory status of the testis. In summary, our work highlights the relevance of Epi/NE as paracrine factors that acting through the local MAC population, might trigger inflammatory events and tissue homeostatic dysregulation in the testis of patients with idiopathic infertility. 5. Disclosure statement The authors have nothing to disclose. CRediT authorship contribution statement María Eugenia Matzkin: Conceptualization, Methodology, Funding acquisition, Data curation, Formal analysis, Project administration, Writing - original draft, Writing - review & editing. Eugenia Riviere: Methodology. Soledad Paola Rossi: Methodology. Roberto Ponzio: Methodology, Writing - review & editing. Elisa Puigdomenech: Writing - review & editing. Oscar Levalle: Writing review & editing. Claudio Terradas: Writing - review & editing. Ricardo Saúl Calandra: Writing - review & editing. Artur Mayerhofer: Methodology, Funding acquisition, Writing - review & editing. Mónica Beatriz Frungieri: Conceptualization, Funding acquisition, Writing - review & editing, Data curation, Project administration.

Fig. 6. Epinephrine and norepinephrine induce COX2 expression and PGD2 production via β-ADRs in testicular MACs of the Syrian hamster. ADRs subtypes (α1A, α1B, α1D, α2A, α2B, α2C, β1, β2, β3) expression was analyzed by RTPCR in primary cell cultures of testicular MACs isolated from young adult Syrian hamsters (Panel A). ADR subtype β2 (green) was detected by immunofluorescence (Panel B, left). Nuclei were counterstained with DAPI (Panel B, middle) and the merged image is shown (Panel B, right). Bar, 25 μm. Panel C: testicular MACs isolated from young adult Syrian hamsters were incubated for 1h in the presence or absence of epinephrine (1 μM), norepinephrine (1 μM), the β1-β2-β3-ADRs agonist isoproterenol (1 μM), the selective β1-ADR agonist denopamine (1 μM), the selective β2-ADR agonist salbutamol (1 μM), the selective α1-ADR agonist phenylephrine (1 μM) or the selective α2-ADR agonist clonidine (1 μM). COX2 mRNA expression was assessed by qRT-PCR. Results were normalized to GAPDH housekeeping and analyzed using the mathematical model of Pfaffl. Additionally, hamster testicular MACs were incubated for 6h or 12h (Panels D, E) in the presence or absence of epinephrine (1 μM) or norepinephrine (1 μM) with or without the β1β2-ADRs antagonist propranolol (1 μM). COX2 protein expression was assessed by immunoblot (Panel D). Results were normalized to Actin and expressed as fold change relative to the control group (Basal), which was assigned a value of

Acknowledgements We are grateful to Dr. Pablo Pomata from the Instituto de Biología y Medicina Experimental (IBYME-CONICET, Argentina), for his expert technical assistance during the laser capture microdissection procedure. This study was supported by grants from Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET PIP 2015–2017 10

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

11220150100267CO); Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT BID PICT 2012 N°1917, BID PICT 2014 N°1200, BID PICT 2015 N°2337); Fundación Alberto J. Roemmers; Fundación René Barón, Fundación Williams of Argentina and Deutsche Forschungsgemeinschaft (DFG MA 1080/29-1) of Germany.

epithelial cells. Am. J. Physiol. 273, L694–L700. https://doi.org/10.1152/ajplung. 1997.273.3.L694. Liao, Y.T., Wang, S.M., Wang, J.R., Yu, C.K., Liu, C.C., 2015. Norepinephrine and epinephrine enhanced the infectivity of enterovirus 71. PLoS One 10, e0135154. https:// doi.org/10.1371/journal.pone.0135154. Liggett, S.B., 1989. Identification and characterization of a homogeneous population of β2-adrenergic receptors on human alveolar macrophages. Am. Rev. Respir. Dis. 139, 552–555. https://doi.org/10.1164/ajrccm/139.2.552. Little, R.A., Frayn, K.N., Randall, P.E., Stoner, H.B., Morton, C., Yates, D.W., Laing, G.S., 1986. Plasma catecholamines in the acute phase of the response to myocardial infarction. Arch. Emerg. Med. 3, 20–27. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Mayerhofer, A., Bartke, A., Steger, R.W., 1989. Catecholamine effects on testicular testosterone production in the gonadally active and the gonadally regressed adult golden hamster. Biol. Reprod. 40, 752–761. Mayerhofer, A., Bartke, A., Began, T., 1993. Catecholamines stimulate testicular steroidogenesis in vitro in the siberian hamster, Phodopus sungorus. Biol. Reprod. 48, 883–888. Mayerhofer, A., Danilchik, M., Pau, K.Y.F., Lara, H.E., Russell, L.D., Ojeda, S.R., 1996. Testis of prepubertal rhesus monkeys receives a dual catecholaminergic input provided by the extrinsic innervation and an intragonadal source of catecholamines. Biol. Reprod. 55, 509–518. Mayerhofer, A., Frungieri, M.B., Fritz, S., Bulling, A., Jessberger, B., Vogt, H.J., 1999. Evidence for catecholaminergic, neuronlike cells in the adult human testis: changes associated with testicular pathologies. J. Androl. 20, 341–347. https://doi.org/10. 1002/j.1939-4640.1999.tb02527.x. Matzkin, M.E., Mayerhofer, A., Rossi, S.P., Gonzalez, B., Gonzalez, C.R., Gonzalez-Calvar, S.I., Terradas, C., Ponzio, R., Puigdomenech, E., Levalle, O., Calandra, R.S., Frungieri, M.B., 2010. Cyclooxygenase-2 (COX-2) in testes of infertile men: evidence for the induction of prostaglandins (PGs) synthesis by interleukin-1β (IL-1β). Fertil. Steril. 94, 1933–1936. https://doi.org/10.1016/j.fertnstert.2010.01.039. Matzkin, M.E., Pellizzari, E.H., Rossi, S.P., Calandra, R.S., Cigorraga, S.B., Frungieri, M.B., 2012. Exploring the cyclooxygenase 2 (COX2)/15d-Δ12,14PGJ2 system in hamster Sertoli cells: regulation by FSH/testosterone and relevance to glucose uptake. Gen. Comp. Endocrinol. 179, 254–264. https://doi.org/10.1016/j.ygcen.2012.08.020. Matzkin, M.E., Miquet, J.G., Fang, Y., Hill, C.M., Turyn, D., Calandra, R.S., Bartke, A., Frungieri, M.B., 2016. Alterations in oxidative, inflammatory and apoptotic events in short-lived and long-lived mice testes. Aging (Albany NY) 8, 95–110. https://doi.org/ 10.18632/aging.100875. McLachlan, R.I., Rajpert-De Meyts, E., Hoei-Hansen, C.E., de Kretser, D.M., Skakkebaek, N.E., 2007. Histological evaluation of the human testis–approaches to optimizing the clinical value of the assessment. Hum. Reprod. 22, 2–16. https://doi.org/10.1093/ humrep/del279. Mhaouty-Kodja, S., Lozach, A., Habert, R., Tanneux, M., Guigon, C., Brailly-Tabard, S., Maltier, J.P., Legrand-Maltier, C., 2007. Fertility and spermatogenesis are altered in α1b-adrenergic receptor knockout male mice. J. Endocrinol. 195, 281–292. https:// doi.org/10.1677/JOE-07-0071. Miyake, K., Yamamoto, M., Narita, H., Hashimoto, J., Mitsuya, H., 1986. Evidence for contractility of the human seminiferous tubule confirmed by its response to noradrenaline and acetylcholine. Fertil. Steril. 46, 734–737. https://doi.org/10.1016/ S0015-0282(16)49663-9. Muthuswamy, R., Okada, N.J., Jenkins, F.J., McGuire, K., McAuliffe, P.F., Zeh, H.J., Bartlett, D.L., Wallace, C., Watkins, S., Henning, J.D., Bovbjerg, D.H., Kalinski, P., 2017. Epinephrine promotes COX-2-dependent immune suppression in myeloid cells and cancer tissues. Brain Behav. Immun. 62, 78–86. https://doi.org/10.1016/j.bbi. 2017.02.008. Nagaraja, A.S., Dorniak, P.L., Sadaoui, N.C., Kang, Y., Lin, T., Armaiz-Pena, G., Wu, S.Y., Rupaimoole, R., Allen, J.K., Gharpure, K.M., Pradeep, S., Zand, B., Previs, R.A., Hansen, J.M., Ivan, C., Rodriguez-Aguayo, C., Yang, P., Lopez-Berestein, G., Lutgendorf, S.K., Cole, S.W., Sood, A.K., 2016. Sustained adrenergic signaling leads to increased metastasis in ovarian cancer via increased PGE2 synthesis. Oncogene 35, 2390–2397. https://doi.org/10.1038/onc.2015.302. Neubert, E., Gürtler, H., Vallentin, G., 1996. Effect of acute stress on plasma levels of catecholamines and cortisol in addition to metabolites in stress-susceptible growing swine. Berl. Münchener Tierärztliche Wochenschr. 109, 381–384. Oyedeji, K.O., Ebipatei, R., Peter, A., Ayobami, D., 2018. Effect of atenolol (beta blocker) on reproductive parameters in male wistar rats. J. Pharm. Sci. Res. 10, 497–500. Pérez, C.V., Theas, M.S., Jacobo, P.V., Jarazo-Dietrich, S., Guazzone, V.A., Lustig, L., 2013. Dual role of immune cells in the testis. Protective or pathogenic for germ cells? Spermatogenesis 3, e23870–e23871. https://doi.org/10.4161/spmg.23870. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29, e45. Romanelli, F., Valenca, M., Conte, D., Isidori, A., Negro-Vilar, A., 1995. Arachidonic acid and its metabolites effects on testosterone production by rat Leydig cells. J. Endocrinol. Investig. 18, 186–193. https://doi.org/10.1007/BF03347801. Rossi, S.P., Windschuettl, S., Matzkin, M.E., Terradas, C., Ponzio, R., Puigdomenech, E., Levalle, O., Calandra, R.S., Mayerhofer, A., Frungieri, M.B., 2014. Melatonin in testes of infertile men: evidence for anti-proliferative and anti-oxidant effects on local macrophage and mast cell populations. Andrology 2, 436–449. https://doi.org/10. 1111/j.2047-2927.2014.00207.x. Rossi, S.P., Walenta, L., Rey-Ares, V., Köhn, F.M., Schwarzer, J.U., Welter, H., Calandra, R.S., Frungieri, M.B., Mayerhofer, A., 2018. Alpha 1 adrenergic receptor-mediated inflammatory responses in human testicular peritubular cells. Mol. Cell. Endocrinol. 474, 1–9. https://doi.org/10.1016/j.mce.2018.01.027. Schlachetzki, J.C.M., Fiebich, B.L., Haake, E., de Oliveira, A.C.P., Candelario-Jalil, E.,

References Abrass, C.K., O'Connor, S.W., Scarpace, P.J., Abrass, I.B., 1985. Characterization of the beta-adrenergic receptor of the rat peritoneal macrophage. J. Immunol. 135, 1338–1341. Adeoya-Osiguwa, S.A., Gibbons, R., Fraser, L.R., 2006. Identification of functional α2and β-adrenergic receptors in mammalian spermatozoa. Hum. Reprod. 21, 1555–1563. https://doi.org/10.1093/humrep/del016. Ahlquist, R.P., 1966. The adrenergic receptor. J. Pharmacol. Sci. 55, 359–367. https:// doi.org/10.1002/jps.2600550402. 1966. Anakwe, O.O., Murphy, P.R., Moger, W.H., 1985. Characterization of beta-adrenergic binding sites on rodent Leydig cells. Biol. Reprod. 33, 815–826. https://doi.org/10. 1095/biolreprod33.4.815. Benarroch, E.E., 2018. Locus coeruleus. Cell Tissue Res. 373, 221–232. https://doi.org/ 10.1007/s00441-017-2649-1. Berthelsen, S., Pettinger, W.A., 1977. A functional basis for classification of alpha-adrenergic receptors. Life Sci. 21, 595–606. https://doi.org/10.1016/0024-3205(77) 90066-2. Brown, S.W., Meyers, R.T., Brennan, K.M., Rumble, J.M., Narasimhachari, N., Perozzi, E.F., Ryan, J.J., Stewart, J.K., Fisher-Stenger, K., 2003. Catecholamines in a macrophage cell line. J. Neuroimmunol. 135, 47–55. https://doi.org/10.1016/S01655728(02)00435-6. Campos, M.B., Vitale, M.L., Ritta, M.N., Chiocchio, S.R., Calandra, R.S., 1990. Catecholamine distribution in adult rat testis. Andrologia 22, 247–252. https://doi. org/10.1111/j.1439-0272.1990.tb01974.x. Davidoff, M.S., Ungefroren, H., Middendorff, R., Koeva, Y., Bakalska, M., Atanassova, N., Holstein, A.F., Jezek, D., Pusch, W., Müller, D., 2005. Catecholamine-synthesizing enzymes in the adult and prenatal human testis. Histochem. Cell Biol. 124, 313–323. https://doi.org/10.1007/s00418-005-0024-x. Emorine, L.J., Marullo, S., Briend-Sutren, M.M., Patey, G., Tate, K., Delavier-Klutchko, C., Strosberg, A.D., 1989. Molecular characterization of the human beta 3-adrenergic receptor. Science 245, 1118–1121. https://doi.org/10.1126/science.2570461. Fraser, C.M., Venter, J.C., 1980. Monoclonal antibodies to beta-adrenergic receptors: use in purification and molecular characterization of beta receptors. Proc. Natl. Acad. Sci. U.S.A. 77, 7034–7708. https://doi.org/10.1073/pnas.77.12.7034. Frielle, T., Caron, M.G., Lefkowitz, R.J., 1989. Properties of the β1- and β2-adrenergic receptor subtypes revealed by molecular cloning. Clin. Chem. 35, 721–725. Frungieri, M.B., Urbanski, H.F., Höhne-Zell, B., Mayerhofer, A., 2000. Neuronal elements in the testis of the rhesus monkey: ontogeny, characterization and relationship to testicular cells. Neuroendocrinology 71, 43–50. https://doi.org/10.1159/ 000054519. Frungieri, M.B., Zitta, K., Pignataro, O.P., Gonzalez-Calvar, S.I., Calandra, R.S., 2002a. Interactions between testicular serotoninergic, catecholaminergic, and corticotropinreleasing hormone systems modulating cAMP and testosterone production in the golden hamster. Neuroendocrinology 76, 35–46. https://doi.org/10.1159/ 000063682. Frungieri, M.B., Calandra, R.S., Lustig, L., Meineke, V., Köhn, F.M., Vogt, H.J., Mayerhofer, A., 2002b. Number, distribution pattern, and identification of macrophages in the testes of infertile men. Fertil. Steril. 78, 298–306. https://doi.org/10. 1016/S0015-0282(02)03206-5. Frungieri, M.B., Weidinger, S., Meineke, V., Köhn, F.M., Mayerhofer, A., 2002c. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARγ: possible relevance to human fibrotic disorders. Proc. Natl. Acad. Sci. U.S.A. 99, 15072–15077. https://doi.org/10.1073/pnas.232422999. Frungieri, M.B., Gonzalez-Calvar, S.I., Parborell, F., Albrecht, M., Mayerhofer, A., Calandra, R.S., 2006. Cyclooxygenase-2 and prostaglandin F2α in Syrian hamster Leydig cells: inhibitory role on luteinizing hormone/human chorionic gonadotropinstimulated testosterone production. Endocrinology 147, 4476–4485. https://doi.org/ 10.1210/en.2006-0090. Frungieri, M.B., Calandra, R.S., Mayerhofer, A., Matzkin, M.E., 2015. Cyclooxygenase and prostaglandins in somatic cell populations in the testis. Reproduction 149, R169–R180. https://doi.org/10.1530/REP-14-0392. Goldstein, D.S., 2003. Catecholamines and stress. Endocr. Regul. 37, 69–80. Grisanti, L.A., Evanson, J., Marchus, E., Jorissen, H., Woster, A.P., DeKrey, W., Sauter, E.R., Combs, C.K., Porter, J.E., 2010. Pro-inflammatory responses in human monocytes are β1-adrenergic receptor subtype dependent. Mol. Immunol. 1244–1254. https://doi.org/10.1016/j.molimm.2009.12.013. Gyoneva, S., Traynelis, S.F., 2013. Norepinephrine modulates the motility of resting and activated microglia via different adrenergic receptors. J. Biol. Chem. 288, 15291–15302. https://doi.org/10.1074/jbc.M113.458901. Kampfer, C., Spillner, S., Spinnler, K., Schwarzer, J.U., Terradas, C., Ponzio, R., Puigdomenech, E., Levalle, O., Köhn, F.M., Matzkin, M.E., Calandra, R.S., Frungieri, M.B., Mayerhofer, A., 2012. Evidence for an adaptation in ROS scavenging systems in human testicular peritubular cells from infertility patients. Int. J. Androl. 35, 793–801. https://doi.org/10.1111/j.1365-2605.2012.01281.x. Kelsen, S.G., Anakwe, O., Aksoy, M.O., Reddy, P.J., Dhanasekaran, N., 1997. IL-1 beta alters beta-adrenergic receptor adenylyl cyclase system function in human airway

11

Molecular and Cellular Endocrinology 498 (2019) 110545

M.E. Matzkin, et al.

pharmacology of the beta-adrenergic receptor on THP-1 cells. Int. J. Immunopharmacol. 15, 219–228. https://doi.org/10.1016/0192-0561(93)90098-J. Tajima, T., Murata, T., Aritake, K., Urade, Y., Hirai, H., Nakamura, M., Ozaki, H., Hori, M., 2008. Lipopolysaccharidae induces macrophage migration via prostaglandin D2 and prostaglandin E2. J. Pharmacol. Exp. Ther. 326, 493–501. https://doi.org/10. 1124/jpet.108.137992. Tsuchiya, S., Kobayashi, Y., Goto, Y., Okumura, H., Nakae, S., Konno, T., Tada, K., 1982. Induction of maturation in cultured human monocytic leukemia cells by a phorbol diester. Cancer Res. 42, 1530–1536. Victoni, T., Salvator, H., Abrial, C., Brollo, M., Porto, L.C.S., Lagente, V., Naline, E., Grassin-Delyle, S., Devillier, P., 2017. Human lung and monocyte-derived macrophages differ with regard to the effects of β2-adrenoceptor agonists on cytokine release. Respir. Res. 18, 126. https://doi.org/10.1186/s12931-017-0613-y. Ward, M.M., Mefford, I.N., Parker, S.D., Chesney, M.A., Taylor, C.B., Keegan, D.L., Barchas, J.D., 1983. Epinephrine and norepinephrine responses in continuously collected human plasma to a series of stressors. Psychosom. Med. 45, 471–486. Wortsman, J., 2002. Role of epinephrine in acute stress. Endocrinol. Metab. Clin. N. Am. 31, 79–106. https://doi.org/10.1016/S0889-8529(01)00024-X.

Heneka, M.T., Hüll, M., 2010. Norepinephrine enhances the LPS-induced expression of COX-2 and secretion of PGE2 in primary rat microglia. J. Neuroinflammation 7, 2. https://doi.org/10.1186/1742-2094-7-2. Skinner, T.J., Heindel, J.J., 1990. Identification and characterization of a β-adrenergic receptor in hamster Sertoli cells. J. Androl. 11, 293–300. https://doi.org/10.1002/j. 1939-4640.1990.tb03243.x. Sofuoglu, M., Nelson, D., Babb, D.A., Hatsukamia, D.K., 2001. Intravenous cocaine increases plasma epinephrine and norepinephrine in humans. Pharmacol. Biochem. Behav. 68, 455–459. https://doi.org/10.1016/s0091-3057(01)00482-8. Stojkov, N.J., Baburski, A.Z., Bjelic, M.M., Sokanovic, S.J., Mihajlovic, A.I., Drljaca, D.M., Janjic, M.M., Kostic, T.S., Andric, S.A., 2014. In vivo blockade of α1-adrenergic receptors mitigates stress-disturbed cAMP and cGMP signaling in Leydig cells. Mol. Hum. Reprod. 20, 77–88. https://doi.org/10.1093/molehr/gat052. Sudhakar, R., George, M.K., Yasaswini, B., Sundararajan, N., Ahamada Safna Mariyam, M., 2016. Adverse drug reactions associated with anti-hypertensive drugs and its management. Int. J. Pharm. Sci. Res. 7, 898–905. https://doi.org/10.13040/IJPSR. 0975-8232.7(3).898-05. Talmadge, J., Scott, R., Castelli, P., Newman-Tarr, T., Lee, J., 1993. Molecular

12