- Email: [email protected]
β-Catenin Signaling Pathway in Ovariectomized Rats
Archives of Medical Research 43 (2012) 274e282
ORIGINAL ARTICLE
Effects of Pulsed Electromagnetic Fields on Bone Mass and Wnt/b-Catenin Signaling Pathway in Ovariectomized Rats Jun Zhou, Hongchen He, Lin Yang, Shiju Chen, Hua Guo, Lu Xia, Huifang Liu, Yuxi Qin, Chuan Liu, Xiaofei Wei, Yujing Zhou, and Chengqi He Rehabilitation Key Laboratory of Sichuan Province, Department of Rehabilitation, West China Hospital, Sichuan University, Chengdu, Sichuan, People’s Republic of China Received for publication February 29, 2012; accepted May 23, 2012 (ARCMED-D-12-00116).
Background and Aims. The therapeutic effects of pulsed electromagnetic fields (PEMFs) on osteoporosis have been documented. However, the precise mechanisms by which PEMFs elicit these favorable biological responses are still not fully understood. This study aimed to systematically investigate the effects of PEMFs on bone mass and Wnt/ b-catenin signaling pathway in ovariectomized rats. Methods. Thirty 3-month-old female Sprague Dawley rats were randomly assigned to one of three groups: sham-operated control (sham), ovariectomy (OVX), and ovariectomy with PEMFs treatment (PEMFs). One week following ovariectomy surgery, rats in the PEMFs group were exposed to PEMFs for 40 min/day, 5 days/week, for 12 weeks. Results. After 12-week interventions, serum 17b-estradiol and bone-specific alkaline phosphatase levels increased in the PEMFs group. Bone mineral density of the femur and the fifth lumbar vertebral body also increased in the PEMFs group. Histomorphometrical studies showed that PEMFs improved trabecular area, trabecular width, and trabecular number by 77.50%, 17.38% and 51.06%, respectively, and reduced trabecular separation by 44.28% compared with the OVX group. Biomechanical studies showed that PEMFs increased maximum load and energy to failure in the fifth lumbar vertebral body. Quantitative real-time RT-PCR analysis showed that PEMFs increased the mRNA expressions of Wnt3a, low-density lipoprotein receptor-related protein 5(LRP5), b-catenin, c-myc and runt-related gene 2 (Runx2), and reduced dickkopf1 (DKK1) in ovariectomized rats. However, mRNA expression of Axin2 was not affected by PEMFs. Conclusions. PEMFs can prevent ovariectomy-induced bone loss and deterioration of bone microarchitecture and strength, at least partly, through activation of Wnt/b-catenin signaling pathway. Ó 2012 IMSS. Published by Elsevier Inc. Key Words: Osteoporosis, Ovariectomy, Pulsed electromagnetic fields, Wnt/b-catenin, Bone mass.
Introduction Osteoporosis (OP) is a chronic skeletal disease characterized by a systemic impairment of bone mass and microarchitecture resulting in fragility fractures (1,2). Current treatment of osteoporosis remains a great challenge in the medical
Address reprint requests to: Chengqi He, Rehabilitation Key Laboratory of Sichuan Province, Department of Rehabilitation, West China Hospital, Sichuan University, Chengdu, Sichuan, 610041 People’s Republic of China; Phone: þ86 28 85423819; FAX: þ86 28 85423652; E-mail: [email protected]
field. Pharmacological interventions can help prevent and treat osteoporosis, but such therapies are often accompanied by undesirable side effects (3,4). Safe and effective forms of physiotherapies including pulsed electromagnetic fields (PEMFs) have been suggested as promising alternatives to drug-based therapies. It has been reported that PEMFs can increase bone mineral density (BMD) in OP patients (5,6), prevent bone loss in ovariectomy-induced OP in vivo (7,8), and increase alkaline phosphatase, extracellular matrix production and osteoblastic proliferation, improving bone formation in vitro (9,10). Although the beneficial effects of PEMFs on osteoporosis are apparent, the precise
0188-4409/$ - see front matter. Copyright Ó 2012 IMSS. Published by Elsevier Inc. doi: 10.1016/j.arcmed.2012.06.002
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling
275
mechanisms by which PEMFs elicit these favorable biological responses are still not fully understood. Recently, Wnt/b-catenin signaling pathway was shown to play a critical role in maintenance of bone mass. Evidence has shown that activation of Wnt/b-catenin signaling pathway can increase bone mass through a number of mechanisms including stem cell renewal, stimulation of preosteoblast replication, induction of osteoblastogenesis, and inhibition of osteoblast and osteocyte apoptosis (11). Because the importance of Wnt/b-catenin signaling pathway for bone health is apparent, this information would be significant in understanding the effects of PEMFs therapy on Wnt/ b-catenin signaling pathway. According to our knowledge, however, little is known about the contribution of PEMFs to Wnt/b-catenin signaling in vivo. Therefore, the aim of the present study was to characterize the effects of PEMFs on bone mass and the activity of Wnt/b-catenin signaling in ovariectomized (OVX) rats. For this purpose we examined the effects of PEMFs on serum 17b-estradiol (E2) and bonespecific alkaline phosphatase (BALP), BMD, bone microarchitecture and biomechanical properties and further explored the mRNA expressions for several important components of Wnt/b-catenin signaling, Wnt1, Wnt3a, low-density lipoprotein receptor-related protein 5(LRP5), b-catenin, dickkopf1(DKK1), Axin2, c-myc and runtrelated gene 2(Runx2) in bone marrow cells of OVX rats.
xtmed Co., Ltd, Tianjin, China) with a frequency of 8 Hz and an intensity of 3.82 mT (Figure 1). At the same time, rats in the OVX and sham groups were exposed to placebo PEMFs (identical instrument as PEMFs group but without activating the on switch). All surgical and therapeutic procedures were approved by the ethics committee at Sichuan University.
Materials and Methods
Histopathological and Histomorphometrical Analysis
OVX Model and Treatments
Samples were obtained from the fourth lumbar (L4) vertebral body, fixed by immersion in buffered formalin for 72 h, then decalcified in 10% ethylenediaminetetraacetic acid (EDTA) for 4 weeks, dehydrated in a desiccator with
Thirty 3-month-old female Sprague Dawley rats weighing 261.5 10.7 g (purchased from the experimental animal center of West China Hospital, Sichuan University, China) were randomly divided into the following three groups (ten rats in each group) according to random digits tables: shamoperated control group (sham), ovariectomy group (OVX), and ovariectomy with PEMFs treatment group (PEMFs). Rats in each group were housed in cages at room temperature (20e26 C), 60e70% humidity, and under a 12/12 h light/dark cycle with free access to water and normal diet. After 1 week of acclimatization, all rats were subjected to either a sham surgery or bilateral ovariectomy as described previously (12). All rats were anesthetized with an i.p. injection of 10% chloraldurat. The sham surgery involved the exposure of the ovaries with extraction of the surrounding fatty tissue of bilateral ovaries, leaving the ovaries intact, whereas bilateral ovariectomy involved the full removal of both the left and right ovaries. After the procedure, penicillin was injected i.m. to each rat to prevent infection once daily for 3 days. One week following the surgery, rats (whole body) in the PEMFs group were exposed to PEMFs with free running during exposure for 40 min/day, 5 days/week, for 12 weeks. PEMFs were generated by the XT-2000B therapeutic stimulator (Tianjin
Biochemical Analysis of Serum After 12 weeks PEMFs exposure, all rats were killed by cervical dislocation. Blood samples were collected from all rats, centrifuged at 2,000 g for 20 min at 4 C and stored at 70 C. Serum E2 and BALP levels were detected using an enzyme-linked immunosorbent assay (ELISA) kit (Shanghai QaYee Biological Technology Co., Ltd, Shanghai, China) according to the protocols provided by the manufacturers. Bone Mineral Density Measurement To evaluate bone mass, BMD of the left femur and the fifth lumbar (L5) vertebrae body was measured using dual energy X-ray absorptiometry (DEXA; Lunar-DPX-IQ, Madison, WI). Samples were scanned using the small animal analysis protocol. After measuring BMD, the fifth lumbar vertebrae bodies were stored at 20 C until subsequent biomechanical examination.
Figure 1. Procedure for PEMF therapy. Two rats were in every cage and exposed at one time. PEMFs were generated by the XT-2000B therapeutic stimulator (Tianjin xtmed Co., Ltd, Tianjin, China) with a frequency of 8 Hz and an intensity of 3.82 mT. The waveform of PEMFs is square wave with pulse width 0.2 msec. (A color figure can be found in the online version of this article.)
276
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
graded ethanol, defatted in xylene, and embedded in paraffin. Five-mm-thick longitudinally oriented sections were cut, stained with hematoxylineeosin (HE) for histopathological analysis, and stained with Safranin-O/Fast green for histomorphometrical analysis. Bone histomorphometrical parameters were quantified using the ImagePro Plus 6.0 software (Media Cybernetics, Silver Spring, MD). Static parameters including the percentage of trabecular area (%Tb.Ar): (Tb.Ar/T.Ar,%); trabecular width (Tb.Wi): ([2000/1.199] [Tb.Ar/Tb.Pm], mm); trabecular number (Tb.N): ([1.199/2] [Tb.Pm/T.Ar], n/mm] and trabecular separation (Tb.Sp): ([2000/1.199] [T.Are Tb.Ar]/Tb.Pm, mm) were calculated and expressed according to previous studies (12,13). In this study, the region of interest for trabecular bone was an area (1 mm2) 0.5 mm below the growth plate of L4 vertebral body. Biomechanical Examination To evaluate the structural integrity of L5 vertebral body, biomechanical examination was conducted using the AGeIS (Shimadzu, Kyoto, Japan) biomechanical testing system. The samples were slowly thawed overnight and warmed to room temperature before mechanical testing. The compression examination was performed by applying load at a constant displacement rate of 2 mm/min until a fracture occurred. Data were plotted on a load-displacement curve to determine maximum load and energy to failure. Quantitative Real-time RT-PCR Measurements of Gene Expression Total RNA was extracted from the bone marrow cells obtained from the right femur and tibia using TrizolReagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Real-time RT-PCR was performed by applying a FTC-2000 Real-Time PCR machine (Funglyn, Toronto, Canada). The mRNA expressions of target genes in the bone marrow cells included Wnt1, Wnt3a, LRP5, b-catenin, DKK1, Axin2, c-myc and Runx2. b-actin was selected as an endogenous housekeeping gene. Primer sequences, the expected RT-PCR products and the accession number for the genes of interest and the housekeeping gene were as follows: NM_001105714 for Wnt1 (forward 5’-GGGGAGCAACCAAAGTCG-3’, reverse 5’-TGGAGGAGGCTATGTTCACG-3’, product length, 187 bp), XM_220546 for Wnt3a (forward 5’- GAGTCTCGTGGCTGGGTGGA -3’, reverse 5’-GGGCTCGCAGAAGTTAGG -3’, product length, 108 bp), NM_001106321 for LRP5 (forward 5’-GACATTTACTGGCCCAATGG-3’, reverse 5’-CTGCCCTCCA CCACCTTCT -3’, product length, 131 bp), NM_053357 for b-catenin (forward 5’-GGAAAGCAAGCTCATCATTCT-3’, reverse 5’-AGTGCCTGCATCCCACCA-3’, product length, 171 bp), NM_001106350 for DKK1 (forward 5’-TTTCCCTAAGTGACCGACAG-3’, reverse 5’-TGGGACCATTCTTCAGCA-3’, product length,
158 bp), NM_024355 for Axin2 (forward 5’-AGTGAGCGTCAGAGCAAGT-3’, reverse 5’-GTCCTGGGTAAATGGGTG -3’, product length, 168 bp), NM_012603 for c-myc (forward 5’-ACGGCGAGAACAGTTGAA-3’, reverse 5’-AGAAAGAA GATGGGAAGCA -3’, product length, 255 bp), NM_053470 for Runx2 (forward 5’-AGTAGCAAACCGAAACAC-3’, reverse 5’-GAAATAGGCATCAGACAAA-3’, product length, 174 bp), and NM_031144 for b-actin (forward 5’-GCCAACACAGTGCTGTCT-3’, reverse 5’-AGGAGCAATGATCTTGATCTT-3’, product length, 114 bp). Gene expression levels were normalized to the housekeeping gene b-actin. Statistical Analysis In order to limit bias, study results were evaluated by independent, blinded researchers. All data were presented as mean standard deviation (SD) for each group. Statistical comparisons with results of multiple groups were analyzed using one-way ANOVA followed by the Tukey’s post hoc test. Statistical comparisons were performed using SPSS v. 13.0 statistical software (Chicago, IL). Differences between groups were considered significant when p #0.05.
Results Body Weight There was no significant difference in body weight among the three groups at the beginning of the study ( p O0.05). A gradual increase in body weight of the rats of each group throughout the experiment was observed. At the end of the experiment, the body weight gain of each group was as follows: sham group—76.3 13.7 g, OVX group— 96.3 16.9 g, and PEMFs group—83.4 11.0 g. Body weight gain in the OVX group was significantly higher than in the sham group ( p !0.05). However, the body weight gain decreased in the PEMFs group, but without statistical difference from that in the OVX group ( p O0.05). Serum E2 and BALP Levels As shown in Table 1, OVX led to a significant decrease in serum E2 level ( p !0.01). However, after 12-week PEMFs interventions, serum E2 significantly increased in the PEMFs group as compared with the OVX group ( p !0.05). Serum BALP level in the OVX group was higher than in the sham operated group ( p !0.01). Furthermore, this increase in serum BALP level was significantly enhanced following PEMFs treatment as compared with the OVX group ( p !0.05). Bone Mineral Density Measurement BMD of the left femur and L5 vertebral body was measured using DEXA. BMD was reduced by 14.5% ( p !0.01) in
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling Table 1. Serum E2 and BALP levels
Biomechanical Examination
Group
E2 (pg/mL)
BALP (U/L)
Sham OVX PEMFs
42.70 10.70 24.50 7.35a 36.00 11.13b
90.59 9.43 106.11 9.28a 117.33 8.53b
PEMFs, pulsed electromagnetic fields. Data are expressed as mean SD. a p !0.01 vs. sham group. b p !0.05 vs. OVX group.
the femur of OVX rats (0.242 0.021 g/cm2) when compared with the sham-operated rats (0.283 0.020 g/ cm2). As expected, BMD values of the femur were elevated by 12.8% ( p !0.05) in the PEMFs group (0.273 0.024 g/ cm2) when compared with the OVX group. BMD was reduced by 34.9% ( p !0.01) in L5 vertebral body of OVX rats (0.121 0.024 g/cm2) when compared with the sham-operated rats (0.186 0.018 g/cm2). As expected, BMD values of L5 vertebral body were elevated by 29.8% ( p !0.05) in the PEMFs group (0.157 0.017g/cm2) when compared with the OVX group. Histomorphometrical and Histopathological Examination The static histomorphometric parameters in L4 vertebral body are shown in Table 2 and Figure 2Ae2C. OVX resulted in a significant decrease in Tb.Ar (46.54%) and Tb.N (44.38%) ( p !0.01, p !0.01, respectively) and a significant increase in Tb.Sp (þ119.53%) ( p !0.01) as compared with the sham group. However, PEMFs significantly increased Tb.Ar, Tb.Wi and Tb.N by 77.50%, 17.38% and 51.06%, respectively ( p !0.01, p !0.05, p !0.01, respectively) and reduced Tb.Sp by 44.28% ( p !0.01) as compared with the OVX group. The changes of histomorphometric parameters are further proven by histopathological examination. As shown in Figure 2De2F, there was apparent reduction of trabecular bone area, trabecular number and trabecular connection, and expanded marrow cavity in the OVX group compared to the sham group. However, PEMFs treatment could partially reverse these changes of OVX rats after 12-week PEMFs interventions. Table 2. Changes of static histomorphometric parameters in L4 vertebral body Group
Tb.Ar (%)
Tb.Wi (mm)
277
Tb.N (n/mm)
Tb.Sp (mm)
Sham 31.67 2.62 62.85 7.85 5.07 0.37 135.46 11.01 OVX 16.93 1.59a 60.42 7.69 2.82 0.29a 297.37 32.92a PEMFs 30.05 2.18b 70.92 6.53c 4.26 0.40b 165.69 17.54b PEMFs, pulsed electromagnetic fields; Tb.Ar, trabecular area; Tb.Wi, trabecular width; Tb.N, trabecular number; Tb.Sp, trabecular separation. Data are expressed as mean SD. a p !0.01 vs. sham group. b p !0.01 vs. OVX group. c p !0.05 vs. OVX group.
As shown in Table 3, maximum load and energy to failure in L5 vertebral body of the OVX rats were significantly lower than those of the sham-operated rats ( p !0.01, p !0.01, respectively). However, after 12-week PEMFs interventions, maximum load and energy to failure in L5 vertebral body significantly increased ( p !0.01, p !0.05, respectively) compared to the OVX group. mRNA Expressions The mRNA expressions were estimated using real-time RTPCR. As shown in Figure 3, PEMFs treatment significantly increased the expressions of the mRNAs of Wnt3a, LRP5, b-catenin, c-myc and Runx2 ( p !0.05, p !0.01, p !0.01, p !0.05, p !0.01, respectively) and significantly reduced DKK1 ( p !0.01) as compared with the OVX group. There was no significant difference in Axin2 mRNA expression among the three groups. Interestingly, among the genes studied, mRNA expression of Wnt1 was not detected throughout the experimental period in all three groups.
Discussion During the past three decades, evidence has shown that PEMFs, as an alternative noninvasive method, presented satisfying clinic therapeutic effects on osteoporosis (5,6). Several experimental studies have demonstrated that PEMFs stimulation could prevent bone loss and microarchitecture deterioration in OVX rats (7,8). However, the potential mechanisms responsible for the effects of PEMFs on preservation of bone mass are not well understood. In this study we systematically evaluated the effects of 12-week PEMFs exposure on bone loss in OVX rats. The findings clearly demonstrated that PEMFs could increase serum E2 and BALP levels, preserve bone mass, inhibit deterioration of trabecular bone microarchitecture and strength, and activate Wnt/b-catenin signaling in OVX rats. This is actually the first paper to report the effects of PEMFs on Wnt/b-catenin signaling pathway in OVX rats. Studies showed that there were obvious biological windows of stimulus parameters of PEMFs therapy on various diseases. The biological window could be identified by intensity, frequency, or their combinations (14). In our previous studies (15e17), we explored the effects of PEMFs with different parameters on OVX rats. These parameters include different frequencies: 2 Hz, 8 Hz, 16 Hz; different intensity of magnetism: 0.77 mT, 3.82 mT, 9.87 mT; different exposure time: 20 min, 40 min, 60 min. From results of these studies mentioned above, we found the proper stimulus parameters for treating OVXinduced osteoporosis in rats: field frequency of 8 Hz, intensity of magnetism of 3.82 mT for 40 min/day. The reason for selecting this particular specification in the present
278
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
Figure 2. Histomorphometrical and histopathological analysis of L4 vertebral body. The L4 vertebral body was stained with Safranin-O/Fast green. (A) Sham group. (B) OVX group. (C) PEMFs group at 40 magnification. The L4 vertebral body was stained with hematoxylin and eosin (H&E). (D) Sham group. (E) OVX group. (F) PEMF group. 100 magnification. (A color figure can be found in the online version of this article.)
study was that it had been investigated by our research group for a long experimental period and proven to be effective in prevention of osteoporosis (15e17). Our previous studies (15e17) also showed that the effects of PEMFs exposure with 30 consective days were demonstrated to be satisfactory in the treatment of OVX-induced osteoporosis. Chang et al. (7) also found trabecular bone mass of OVX rats after PEMFs stimulation for 30 days was restored to levels of age-matched intact rats. Jing et al. (8) found PEMFs exposure for 12 weeks presented efficacy in prevention against OVX-induced bone loss and deterioration of trabecular bone architecture. From the results of the studies mentioned above, PEMFs exposure for 12 consecutive weeks seemed to be sufficient. Our results showed that OVX led to increase in body weight of rats, which was consistent with several previous Table 3. Biomechanical parameters for L5 vertebral body Group
Maximum load (N )
Energy to failure (J )
OVX Sham PEMFs
317.57 14.86a 407.56 25.07 360.47 16.94b
0.026 0.002a 0.050 0.003 0.037 0.011c
PEMFs, pulsed electromagnetic fields. Data are expressed as mean SD. a p !0.01 vs. sham group. b p !0.01 vs. OVX group. c p !0.05 vs. OVX group.
studies (8,18). The significant increase of body weight in OVX rats was regarded as one piece of evidence of successful ovariectomy because estrogen deficiency had a direct influence on energy metabolism (19). In this study we found serum E2 level significantly decreased in OVX rats. However, PEMFs interventions increased E2 levels in OVX rats, a finding that supported our preliminary study suggesting that PEMFs have systemic effects on estrogen metabolism in OVX rats (20). We also found that the PEMF-treated rats had increased serum BALP (an indicator of osteoblast activity) (21), suggesting that PEMFs improved new bone formation. Normal bone homeostasis is the result of cross-talk between the anabolic axis (bone-forming osteoblasts) and catabolic axis (bone-resorbing osteoclasts). A disruption of this tightly regulated relationship leads to imbalanced bone turnover, which ultimately results in diseases of the skeleton (22). Our results showed that PEMFs treatment significantly increased BMD in both the femur and L5 vertebral body of OVX rats, which is in agreement with some previous studies (7,8). In addition to BMD, bone microarchitecture is another factor commonly associated with bone quality. Previous studies showed that the trabecular bone microarchitecture (23) including size, number, shape, connectivity and orientation of trabecular correlates with bone strength, which is an important factor reflecting bone fragility and fracture risk (24). Therefore, we observed the effects of PEMFs treatment on trabecular bone
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling
279
Figure 3. mRNA expressions in bone marrow cells were assessed by RT-PCR. Data were expressed as mean SD. ap !0.05 vs. OVX group. bp !0.01 vs. sham group. cp !0.01 vs. OVX group.
microarchitecture and biomechanical properties in this study. There was apparent deterioration of trabecular bone architecture in OVX rats in the present study. However, PEMFs treatment could increase trabecular area, trabecular width, and trabecular number, by 77.50%, 17.38% and 51.06%, respectively, and reduced trabecular separation by 44.28% compared with the OVX group after 12-week interventions. In addition, our results showed that there were significant reductions in maximum load, and energy
to failure of the L5 in OVX rats. However, OVX-induced decreases in biomechanical properties were obviously inhibited by 12-week PEMFs exposure, which was consistent with the improvement of bone mass and positive changes of trabecular bone microarchitecture as seen on histomorphometrical examination. Wnt/b-catenin signaling pathway is conserved in various species from worms to mammals and plays important roles in various aspects of skeletal development. Wnt/b-catenin
280
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
signaling is initiated by binding of a Wnt family member to two receptor molecules, Frizzled proteins (FZD) and LRP5/6. This leads to stabilization of cytoplasmic b-catenin and then the accumulated b-catenin is translocated into the nucleus where it associates with the transcriptional factor T-cell factor (Tcf)/lymphoid enhancer factor (Lef), and thereby stimulates expression of Wnt/b-catenin target genes including c-myc, Runx2, and cyclin D1 (11,25e27). Activation of Wnt/b-catenin signaling pathway promotes proliferation and differentiation of osteoblast precursor cells and increases osteoblast activity, which favors the deposition of new bone and increases BMD (28,29). To explore the mechanism of PEMFs on bone at the molecular level, we explored several important components of Wnt/b-catenin signaling in response to PEMFs treatment. Evidences showed that Wnt1 and Wnt3a are capable of regulating osteoblast function, contributing to bone formation (11,27,30). In this study we found that mRNA expression of Wnt3a in bone marrow cells sharply increased after PEMFs exposure, whereas mRNA expression of Wnt1 was not detected throughout the experimental period in all three groups. LRP5, a critical co-receptor for Wnt signals, can induce a cascade of intracellular events and plays an important role in skeletal development and maintenance (27). In this study, expression of LRP5 increased after 12week PEMFs exposure. Dkk1 is a well-characterized Wnt antagonist active in many tissues (31). Dkk1 negatively regulates Wnt/b-catenin signaling by binding to and antagonizing the Wnt coreceptors Lrp5/6 (32). In this study, PEMFs reduced DKK1 mRNA expression after 12-week interventions. b-catenin is another key component of Wnt/ b-catenin signaling, and cytoplasmic b-catenin stability is essential for activation of Wnt/b-catenin signaling. In the presence of a Wnt signal, b-catenin can serve as a transcription cofactor for genes required for osteoblast differentiation (28,29). We also found that mRNA expression of b-catenin in the bone marrow cells of OVX rats were upregulated by the treatment of PEMFs. Axin2 is a master scaffolding protein originally identified as an intracellular inhibitor of Wnt/b-catenin signaling (33). On the other hand, Axin2 expression is directly induced by Wnt/b-catenin signaling and forms a negative feedback loop (34). However, we found that mRNA expression of Axin2 was not affected by PEMFs. This study showed that expressions of wnt3a, LRP5 and b-catenin were upregulated, whereas DKK1 downregulated after 12-week PEMFs exposure in OVX rats. This indicates that in addition to negative interaction with DKK1, PEMFs activates Wnt signaling by increasing endogenous Wnt3a, LRP5 and b-catenin expressions and subsequent canonical Wnt signaling. Dkk1 is a Wnt antagonist and negatively regulates Wnt/b-catenin signaling (31,32). In this study, PEMFs reduced DKK1 mRNA expression after 12-week PEMF interventions. We supposed PEMFs may activate and augment Wnt/b-catenin signaling through suppression of DKK1. Recently, Wnt/b-catenin signaling pathway has
been identified as one of the important signaling pathways regulating bone accrual and maintenance. It has been shown to be important for the regulation of osteoblastogenesis and osteoblast activity, eventually for controlling bone mass. In summary, activation of the signaling pathway leads to increase bone mass through a number of mechanisms including stem cell renewal, stimulation of preosteoblast replication, induction of osteoblastogenesis, and inhibition of osteoblast and osteocyte apoptosis, whereas suppression results in bone loss (11,35). Because the importance of Wnt/b-catenin signaling for controlling bone mass has already been well-established (11,28,29,35), our results are noteworthy but not surprising. In addition, we also showed the expression levels of a number of genes that represent known transcriptional targets of Wnt/b-catenin pathway (i.e., c-myc, Runx2) (26, 36). Evidence showed that c-myc is also a novel regulator of osteogenesis (37). Runx2 plays important roles in skeletal development and is required for osteoblast development from mesenchymal stem cells and terminal differentiation, and its expression is essential for normal bone formation (38). In this study we found that PEMFs increased the expressions of c-myc and Runx2. In summary, we clearly demonstrated that Wnt/b-catenin signaling members, Wnt3a, LRP5, b-catenin and target genes, c-myc, Runx2 were upregulated after 12-week PEMFs exposure with the exception of DKK1, a wnt antagonist whose expression was downregulated. Together these results suggest that Wnt/b-catenin signaling pathway is activated during PEMFs exposure by characterizing the expressions of a broad spectrum of Wnt/b-catenin molecules. Bone mass is tightly regulated by the balance between bone resorption and formation (22,39). Osteoblasts are the bone-forming cells that play an essential role in bone mass acquisition (40). Because the key role of Wnt/b-catenin signaling for osteoblastic differentiation and function is already well-established (11,28,29), real-time RT-PCR test presented evidence that PEMFs can preserve bone mass and maintain bone architecture and strength in OVX rats, at least partly, through increasing bone formation via activation of Wnt/b-catenin signaling pathway. However, Wnt/b-catenin signaling pathway may not be the only cascade activated by PEMFs, and other signaling pathways may possibly be stimulated. Bodamyali et al. found that PEMFs can induce osteogenesis through improving transcription of bone morphogenetic proteins 2 and 4 in rat osteoblasts in vitro (41). Evidence showed that many signaling cascades such as parathyroid hormone pathways (42) and insulin-like growth factor (43) are also associated with bone formation. The influence of PEMFs on other signaling pathways needs further investigation. This scenario is almost certainly only a partial explanation of one of the mechanisms by which PEMFs influence osteoblast activity to adjust bone mass and architecture.
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling
In fact, maintenance of bone mass is dependent on the balance between osteoblastic bone formation and osteoclastic bone resorption (22,39). Therefore, regulations of the recruitment, proliferation, differentiation and activation of osteoblasts and osteoclasts are essential for the maintenance of bone mass. Osteoclasts, the sole cell type responsible for bone resorption, play important roles in maintaining bone mass (44). In vitro studies showed that PEMFs can inhibit osteoclastogenesis (45), promote osteoclast apoptosis (46), and suppress bone resorption (47). Although the effects of PEMFs on osteoclast in vitro studies are available, further in vivo studies are required. In conclusion, PEMFs had positive effects on bone mass and trabecular bone microarchitecture and strength in OVX rats. Furthermore, PEMFs upregulated the expressions of Wnt3a, LRP5, b-catenin, c-myc and Runx2, while downregulating DKK1 in bone marrow cells of OVX rats. These results suggest that activation of Wnt/b-catenin signaling pathway plays an important role in these beneficial effects of PEMFs on OVX rats. However, loss of function or inhibition experiments need be performed to explore whether Wnt/b-catenin signaling pathway is not merely correlated but is indeed necessary for the positive effects. Although more work is needed to fully elucidate the role of PEMFs on Wnt/b-catenin signaling, these observations may be crucial in helping to understand the mechanisms of PEMFs in OVX-induced osteoporosis. Acknowledgments We thank the National Natural Science Fund of China (No. 81171865) for the financial support.
Conflict of Interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. References 1. National Institutes of Health. Osteoporosis prevention, diagnosis, and therapy. JAMA 2001;285:785e795. 2. Kanis JA. Diagnosis of osteoporosis and assessment of fracture risk. Lancet 2002;359:1929e1936. 3. Lewiecki EM. Current and emerging pharmacologic therapies for the management of postmenopausal osteoporosis. J Womens Health (Larchmont) 2009;18:1615e1626. 4. Gallacher SJ, Dixon T. Impact of treatments for postmenopausal osteoporosis (bisphosphonates, parathyroid hormone, strontium ranelate, and denosumab) on bone quality: a systematic review. Calcif Tissue Int 2010;87:469e484. 5. Garland DE, Adkins RH, Matsuno NN, et al. The effect of pulsed electromagnetic fields on osteoporosis at the knee in individuals with spinal cord injury. J Spinal Cord Med 1999;22:239e245. 6. Tabrah F, Hoffmeier M, Gilbert F Jr, et al. Bone density changes in osteoporosis-prone women exposed to pulsed electromagnetic fields (PEMFs). J Bone Miner Res 1990;5:437e442.
281
7. Chang K, Chang WH. Pulsed electromagnetic fields prevent osteoporosis in an ovariectomized female rat model: a prostaglandin E2associated process. Bioelectromagnetics 2003;24:189e198. 8. Jing D, Shen G, Huang J, et al. Circadian rhythm affects the preventive role of pulsed electromagnetic fields on ovariectomy-induced osteoporosis in rats. Bone 2010;46:487e495. 9. Lohmann CH, Schwartz Z, Liu Y, et al. Pulsed electromagnetic field stimulation of MG63 osteoblast-like cells affects differentiation and local factor production. J Orthop Res 2000;18:637e646. 10. De Mattei M, Caruso A, Traina GC, et al. Correlation between pulsed electromagnetic fields exposure time and cell proliferation increase in human osteosarcoma cell lines and human normal osteoblast cells in vitro. Bioelectromagnetics 1999;20:177e182. 11. Krishnan V, Bryant HU, Macdougald OA. Regulation of bone mass by Wnt signaling. J Clin Invest 2006;116:1202e1209. 12. Gregory LS, Kelly WL, Reid RC, et al. Inhibitors of cyclo-oxygenase2 and secretory phospholipase A2 preserve bone architecture following ovariectomy in adult rats. Bone 2006;39:134e142. 13. Parfitt AM, Drezner MK, Glorieux FH, et al. Bone histomorphometry: standardization of nomenclature, symbols, and units. Report of the ASBMR Histomorphometry Nomenclature Committee. J Bone Miner Res 1987;2:595e610. 14. Markov MS. Pulsed electromagnetic field therapy history, state of the art and future. Environmentalist 2007;27:465e475. 15. Yang YH, He CQ, Yang L, et al. Effects of different intensity pulsed electromagnetic fields on serum estradiol of ovariectomized rats. Sichuan Da Xue Xue Bao Yi Xue Ban 2008;39:256e258. 16. Huang L, Wang W, Xiao D, et al. Effect of pulsed electromagnetic fields of different treatment time on bone mineral density of femur in ovariectomized rats. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi 2008;22:548e550. 17. He C, Wang W, Xiao D, et al. Effect of pulsed electromagnetic fields of different frequencies on serum estradiol and bone calcium content of femur in ovariectomized rats. Chin J Rehab Med 2007;22:303e305. 18. Ke HZ, Chen HK, Simmons HA, et al. Comparative effects of droloxifene, tamoxifen, and estrogen on bone, serum cholesterol, and uterine histology in the ovariectomized rat model. Bone 1997;20: 31e39. 19. Swithers SE, McCurley M, Hamilton E, et al. Influence of ovarian hormones on development of ingestive responding to alterations in fatty acid oxidation in female rats. Horm Behav 2008;54:471e477. 20. Luo Q, Li SS, He C, et al. Pulse electromagnetic fields effects on serum E2 levels, chondrocyte apoptosis, and matrix metalloproteinase-13 expression in ovariectomized rats. Rheumatol Int 2009;29:927e935. 21. Han X, Xu Y, Wang J, et al. Effects of cod bone gelatin on bone metabolism and bone microarchitecture in ovariectomized rats. Bone 2009;44:942e947. 22. Henriksen K, Neutzsky-Wulff AV, Bonewald LF, et al. Local communication on and within bone controls bone remodeling. Bone 2009;44: 1026e1033. 23. Ulrich D, van Rietbergen B, Laib A, et al. The ability of threedimensional structural indices to reflect mechanical aspects of trabecular bone. Bone 1999;25:55e60. 24. Hernandez CJ, Keaveny TM. A biomechanical perspective on bone quality. Bone 2006;39:1173e1181. 25. Kikuchi A, Kishida S, Yamamoto H. Regulation of Wnt signaling by protein-protein interaction and post-translational modifications. Exp Mol Med 2006;38:1e10. 26. Gaur T, Lengner CJ, Hovhannisyan H, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 2005;280:33132e33140. 27. Monroe DG, McGee-Lawrence ME, Oursler MJ, et al. Update on Wnt signaling in bone cell biology and bone disease. Gene 2012;492: 1e18.
282
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
28. Bodine PV, Komm BS. Wnt signaling and osteoblastogenesis. Rev Endocr Metab Disord 2006;7:33e39. 29. Hartmann C. A Wnt canon orchestrating osteoblastogenesis. Trends Cell Biol 2006;16:151e158. 30. Boland GM, Perkins G, Hall DJ, et al. Wnt 3a promotes proliferation and suppresses osteogenic differentiation of adult human mesenchymal stem cells. J Cell Biochem 2004;93:1210e1230. 31. Pinzone JJ, Hall BM, Thudi NK, et al. The role of Dickkopf-1 in bone development, homeostasis, and disease. Blood 2009;113:517e525. 32. He X, Semenov M, Tamai K, et al. LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development 2004;131:1663e1677. 33. Kikuchi A. Roles of Axin in the Wnt signalling pathway. Cell Signal 1999;11:777e788. 34. Jho EH, Zhang T, Domon C, et al. Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol Cell Biol 2002;22:1172e1183. 35. Milat F, Ng KW. Is Wnt signalling the final common pathway leading to bone formation? Mol Cell Endocrinol 2009;310:52e62. 36. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509e1512. 37. Piek E, Sleumer LS, van Someren EP, et al. Osteo-transcriptomics of human mesenchymal stem cells: accelerated gene expression and osteoblast differentiation induced by vitamin D reveals c-MYC as an enhancer of BMP2-induced osteogenesis. Bone 2010;46:613e627. 38. Otto F, Thornell AP, Crompton T, et al. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 1997;89:765e771.
39. Martin T, Gooi JH, Sims NA. Molecular mechanisms in coupling of bone formation to resorption. Crit Rev Eukaryot Gene Expr 2009; 19:73e88. 40. Marie PJ. The molecular genetics of bone formation: implications for therapeutic interventions in bone disorders. Am J Pharmacogenomics 2001;1:175e187. 41. Bodamyali T, Bhatt B, Hughes FJ, et al. Pulsed electromagnetic fields simultaneously induce osteogenesis and upregulate transcription of bone morphogenetic proteins 2 and 4 in rat osteoblasts in vitro. Biochem Biophys Res Commun 1998;250:458e461. 42. Swarthout JT, D’Alonzo RC, Selvamurugan N, et al. Parathyroid hormone-dependent signaling pathways regulating genes in bone cells. Gene 2002;282:1e17. 43. Niu T, Rosen CJ. The insulin-like growth factor-I gene and osteoporosis: a critical appraisal. Gene 2005;361:38e56. 44. Suda T, Takahashi N, Martin TJ. Modulation of osteoclast differentiation. Endocr Rev 1992;13:66e80. 45. Chang K, Hong-Shong Chang W, Yu YH, et al. Pulsed electromagnetic field stimulation of bone marrow cells derived from ovariectomized rats affects osteoclast formation and local factor production. Bioelectromagnetics 2004;25:134e141. 46. Chang K, Chang WH, Tsai MT, et al. Pulsed electromagnetic fields accelerate apoptotic rate in osteoclasts. Connect Tissue Res 2006;47: 222e228. 47. Chang K, Chang WH, Huang S, et al. Pulsed electromagnetic fields stimulation affects osteoclast formation by modulation of osteoprotegerin, RANK ligand and macrophage colony-stimulating factor. J Orthop Res 2005;23:1308e1314.
ORIGINAL ARTICLE
Effects of Pulsed Electromagnetic Fields on Bone Mass and Wnt/b-Catenin Signaling Pathway in Ovariectomized Rats Jun Zhou, Hongchen He, Lin Yang, Shiju Chen, Hua Guo, Lu Xia, Huifang Liu, Yuxi Qin, Chuan Liu, Xiaofei Wei, Yujing Zhou, and Chengqi He Rehabilitation Key Laboratory of Sichuan Province, Department of Rehabilitation, West China Hospital, Sichuan University, Chengdu, Sichuan, People’s Republic of China Received for publication February 29, 2012; accepted May 23, 2012 (ARCMED-D-12-00116).
Background and Aims. The therapeutic effects of pulsed electromagnetic fields (PEMFs) on osteoporosis have been documented. However, the precise mechanisms by which PEMFs elicit these favorable biological responses are still not fully understood. This study aimed to systematically investigate the effects of PEMFs on bone mass and Wnt/ b-catenin signaling pathway in ovariectomized rats. Methods. Thirty 3-month-old female Sprague Dawley rats were randomly assigned to one of three groups: sham-operated control (sham), ovariectomy (OVX), and ovariectomy with PEMFs treatment (PEMFs). One week following ovariectomy surgery, rats in the PEMFs group were exposed to PEMFs for 40 min/day, 5 days/week, for 12 weeks. Results. After 12-week interventions, serum 17b-estradiol and bone-specific alkaline phosphatase levels increased in the PEMFs group. Bone mineral density of the femur and the fifth lumbar vertebral body also increased in the PEMFs group. Histomorphometrical studies showed that PEMFs improved trabecular area, trabecular width, and trabecular number by 77.50%, 17.38% and 51.06%, respectively, and reduced trabecular separation by 44.28% compared with the OVX group. Biomechanical studies showed that PEMFs increased maximum load and energy to failure in the fifth lumbar vertebral body. Quantitative real-time RT-PCR analysis showed that PEMFs increased the mRNA expressions of Wnt3a, low-density lipoprotein receptor-related protein 5(LRP5), b-catenin, c-myc and runt-related gene 2 (Runx2), and reduced dickkopf1 (DKK1) in ovariectomized rats. However, mRNA expression of Axin2 was not affected by PEMFs. Conclusions. PEMFs can prevent ovariectomy-induced bone loss and deterioration of bone microarchitecture and strength, at least partly, through activation of Wnt/b-catenin signaling pathway. Ó 2012 IMSS. Published by Elsevier Inc. Key Words: Osteoporosis, Ovariectomy, Pulsed electromagnetic fields, Wnt/b-catenin, Bone mass.
Introduction Osteoporosis (OP) is a chronic skeletal disease characterized by a systemic impairment of bone mass and microarchitecture resulting in fragility fractures (1,2). Current treatment of osteoporosis remains a great challenge in the medical
Address reprint requests to: Chengqi He, Rehabilitation Key Laboratory of Sichuan Province, Department of Rehabilitation, West China Hospital, Sichuan University, Chengdu, Sichuan, 610041 People’s Republic of China; Phone: þ86 28 85423819; FAX: þ86 28 85423652; E-mail: [email protected]
field. Pharmacological interventions can help prevent and treat osteoporosis, but such therapies are often accompanied by undesirable side effects (3,4). Safe and effective forms of physiotherapies including pulsed electromagnetic fields (PEMFs) have been suggested as promising alternatives to drug-based therapies. It has been reported that PEMFs can increase bone mineral density (BMD) in OP patients (5,6), prevent bone loss in ovariectomy-induced OP in vivo (7,8), and increase alkaline phosphatase, extracellular matrix production and osteoblastic proliferation, improving bone formation in vitro (9,10). Although the beneficial effects of PEMFs on osteoporosis are apparent, the precise
0188-4409/$ - see front matter. Copyright Ó 2012 IMSS. Published by Elsevier Inc. doi: 10.1016/j.arcmed.2012.06.002
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling
275
mechanisms by which PEMFs elicit these favorable biological responses are still not fully understood. Recently, Wnt/b-catenin signaling pathway was shown to play a critical role in maintenance of bone mass. Evidence has shown that activation of Wnt/b-catenin signaling pathway can increase bone mass through a number of mechanisms including stem cell renewal, stimulation of preosteoblast replication, induction of osteoblastogenesis, and inhibition of osteoblast and osteocyte apoptosis (11). Because the importance of Wnt/b-catenin signaling pathway for bone health is apparent, this information would be significant in understanding the effects of PEMFs therapy on Wnt/ b-catenin signaling pathway. According to our knowledge, however, little is known about the contribution of PEMFs to Wnt/b-catenin signaling in vivo. Therefore, the aim of the present study was to characterize the effects of PEMFs on bone mass and the activity of Wnt/b-catenin signaling in ovariectomized (OVX) rats. For this purpose we examined the effects of PEMFs on serum 17b-estradiol (E2) and bonespecific alkaline phosphatase (BALP), BMD, bone microarchitecture and biomechanical properties and further explored the mRNA expressions for several important components of Wnt/b-catenin signaling, Wnt1, Wnt3a, low-density lipoprotein receptor-related protein 5(LRP5), b-catenin, dickkopf1(DKK1), Axin2, c-myc and runtrelated gene 2(Runx2) in bone marrow cells of OVX rats.
xtmed Co., Ltd, Tianjin, China) with a frequency of 8 Hz and an intensity of 3.82 mT (Figure 1). At the same time, rats in the OVX and sham groups were exposed to placebo PEMFs (identical instrument as PEMFs group but without activating the on switch). All surgical and therapeutic procedures were approved by the ethics committee at Sichuan University.
Materials and Methods
Histopathological and Histomorphometrical Analysis
OVX Model and Treatments
Samples were obtained from the fourth lumbar (L4) vertebral body, fixed by immersion in buffered formalin for 72 h, then decalcified in 10% ethylenediaminetetraacetic acid (EDTA) for 4 weeks, dehydrated in a desiccator with
Thirty 3-month-old female Sprague Dawley rats weighing 261.5 10.7 g (purchased from the experimental animal center of West China Hospital, Sichuan University, China) were randomly divided into the following three groups (ten rats in each group) according to random digits tables: shamoperated control group (sham), ovariectomy group (OVX), and ovariectomy with PEMFs treatment group (PEMFs). Rats in each group were housed in cages at room temperature (20e26 C), 60e70% humidity, and under a 12/12 h light/dark cycle with free access to water and normal diet. After 1 week of acclimatization, all rats were subjected to either a sham surgery or bilateral ovariectomy as described previously (12). All rats were anesthetized with an i.p. injection of 10% chloraldurat. The sham surgery involved the exposure of the ovaries with extraction of the surrounding fatty tissue of bilateral ovaries, leaving the ovaries intact, whereas bilateral ovariectomy involved the full removal of both the left and right ovaries. After the procedure, penicillin was injected i.m. to each rat to prevent infection once daily for 3 days. One week following the surgery, rats (whole body) in the PEMFs group were exposed to PEMFs with free running during exposure for 40 min/day, 5 days/week, for 12 weeks. PEMFs were generated by the XT-2000B therapeutic stimulator (Tianjin
Biochemical Analysis of Serum After 12 weeks PEMFs exposure, all rats were killed by cervical dislocation. Blood samples were collected from all rats, centrifuged at 2,000 g for 20 min at 4 C and stored at 70 C. Serum E2 and BALP levels were detected using an enzyme-linked immunosorbent assay (ELISA) kit (Shanghai QaYee Biological Technology Co., Ltd, Shanghai, China) according to the protocols provided by the manufacturers. Bone Mineral Density Measurement To evaluate bone mass, BMD of the left femur and the fifth lumbar (L5) vertebrae body was measured using dual energy X-ray absorptiometry (DEXA; Lunar-DPX-IQ, Madison, WI). Samples were scanned using the small animal analysis protocol. After measuring BMD, the fifth lumbar vertebrae bodies were stored at 20 C until subsequent biomechanical examination.
Figure 1. Procedure for PEMF therapy. Two rats were in every cage and exposed at one time. PEMFs were generated by the XT-2000B therapeutic stimulator (Tianjin xtmed Co., Ltd, Tianjin, China) with a frequency of 8 Hz and an intensity of 3.82 mT. The waveform of PEMFs is square wave with pulse width 0.2 msec. (A color figure can be found in the online version of this article.)
276
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
graded ethanol, defatted in xylene, and embedded in paraffin. Five-mm-thick longitudinally oriented sections were cut, stained with hematoxylineeosin (HE) for histopathological analysis, and stained with Safranin-O/Fast green for histomorphometrical analysis. Bone histomorphometrical parameters were quantified using the ImagePro Plus 6.0 software (Media Cybernetics, Silver Spring, MD). Static parameters including the percentage of trabecular area (%Tb.Ar): (Tb.Ar/T.Ar,%); trabecular width (Tb.Wi): ([2000/1.199] [Tb.Ar/Tb.Pm], mm); trabecular number (Tb.N): ([1.199/2] [Tb.Pm/T.Ar], n/mm] and trabecular separation (Tb.Sp): ([2000/1.199] [T.Are Tb.Ar]/Tb.Pm, mm) were calculated and expressed according to previous studies (12,13). In this study, the region of interest for trabecular bone was an area (1 mm2) 0.5 mm below the growth plate of L4 vertebral body. Biomechanical Examination To evaluate the structural integrity of L5 vertebral body, biomechanical examination was conducted using the AGeIS (Shimadzu, Kyoto, Japan) biomechanical testing system. The samples were slowly thawed overnight and warmed to room temperature before mechanical testing. The compression examination was performed by applying load at a constant displacement rate of 2 mm/min until a fracture occurred. Data were plotted on a load-displacement curve to determine maximum load and energy to failure. Quantitative Real-time RT-PCR Measurements of Gene Expression Total RNA was extracted from the bone marrow cells obtained from the right femur and tibia using TrizolReagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Real-time RT-PCR was performed by applying a FTC-2000 Real-Time PCR machine (Funglyn, Toronto, Canada). The mRNA expressions of target genes in the bone marrow cells included Wnt1, Wnt3a, LRP5, b-catenin, DKK1, Axin2, c-myc and Runx2. b-actin was selected as an endogenous housekeeping gene. Primer sequences, the expected RT-PCR products and the accession number for the genes of interest and the housekeeping gene were as follows: NM_001105714 for Wnt1 (forward 5’-GGGGAGCAACCAAAGTCG-3’, reverse 5’-TGGAGGAGGCTATGTTCACG-3’, product length, 187 bp), XM_220546 for Wnt3a (forward 5’- GAGTCTCGTGGCTGGGTGGA -3’, reverse 5’-GGGCTCGCAGAAGTTAGG -3’, product length, 108 bp), NM_001106321 for LRP5 (forward 5’-GACATTTACTGGCCCAATGG-3’, reverse 5’-CTGCCCTCCA CCACCTTCT -3’, product length, 131 bp), NM_053357 for b-catenin (forward 5’-GGAAAGCAAGCTCATCATTCT-3’, reverse 5’-AGTGCCTGCATCCCACCA-3’, product length, 171 bp), NM_001106350 for DKK1 (forward 5’-TTTCCCTAAGTGACCGACAG-3’, reverse 5’-TGGGACCATTCTTCAGCA-3’, product length,
158 bp), NM_024355 for Axin2 (forward 5’-AGTGAGCGTCAGAGCAAGT-3’, reverse 5’-GTCCTGGGTAAATGGGTG -3’, product length, 168 bp), NM_012603 for c-myc (forward 5’-ACGGCGAGAACAGTTGAA-3’, reverse 5’-AGAAAGAA GATGGGAAGCA -3’, product length, 255 bp), NM_053470 for Runx2 (forward 5’-AGTAGCAAACCGAAACAC-3’, reverse 5’-GAAATAGGCATCAGACAAA-3’, product length, 174 bp), and NM_031144 for b-actin (forward 5’-GCCAACACAGTGCTGTCT-3’, reverse 5’-AGGAGCAATGATCTTGATCTT-3’, product length, 114 bp). Gene expression levels were normalized to the housekeeping gene b-actin. Statistical Analysis In order to limit bias, study results were evaluated by independent, blinded researchers. All data were presented as mean standard deviation (SD) for each group. Statistical comparisons with results of multiple groups were analyzed using one-way ANOVA followed by the Tukey’s post hoc test. Statistical comparisons were performed using SPSS v. 13.0 statistical software (Chicago, IL). Differences between groups were considered significant when p #0.05.
Results Body Weight There was no significant difference in body weight among the three groups at the beginning of the study ( p O0.05). A gradual increase in body weight of the rats of each group throughout the experiment was observed. At the end of the experiment, the body weight gain of each group was as follows: sham group—76.3 13.7 g, OVX group— 96.3 16.9 g, and PEMFs group—83.4 11.0 g. Body weight gain in the OVX group was significantly higher than in the sham group ( p !0.05). However, the body weight gain decreased in the PEMFs group, but without statistical difference from that in the OVX group ( p O0.05). Serum E2 and BALP Levels As shown in Table 1, OVX led to a significant decrease in serum E2 level ( p !0.01). However, after 12-week PEMFs interventions, serum E2 significantly increased in the PEMFs group as compared with the OVX group ( p !0.05). Serum BALP level in the OVX group was higher than in the sham operated group ( p !0.01). Furthermore, this increase in serum BALP level was significantly enhanced following PEMFs treatment as compared with the OVX group ( p !0.05). Bone Mineral Density Measurement BMD of the left femur and L5 vertebral body was measured using DEXA. BMD was reduced by 14.5% ( p !0.01) in
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling Table 1. Serum E2 and BALP levels
Biomechanical Examination
Group
E2 (pg/mL)
BALP (U/L)
Sham OVX PEMFs
42.70 10.70 24.50 7.35a 36.00 11.13b
90.59 9.43 106.11 9.28a 117.33 8.53b
PEMFs, pulsed electromagnetic fields. Data are expressed as mean SD. a p !0.01 vs. sham group. b p !0.05 vs. OVX group.
the femur of OVX rats (0.242 0.021 g/cm2) when compared with the sham-operated rats (0.283 0.020 g/ cm2). As expected, BMD values of the femur were elevated by 12.8% ( p !0.05) in the PEMFs group (0.273 0.024 g/ cm2) when compared with the OVX group. BMD was reduced by 34.9% ( p !0.01) in L5 vertebral body of OVX rats (0.121 0.024 g/cm2) when compared with the sham-operated rats (0.186 0.018 g/cm2). As expected, BMD values of L5 vertebral body were elevated by 29.8% ( p !0.05) in the PEMFs group (0.157 0.017g/cm2) when compared with the OVX group. Histomorphometrical and Histopathological Examination The static histomorphometric parameters in L4 vertebral body are shown in Table 2 and Figure 2Ae2C. OVX resulted in a significant decrease in Tb.Ar (46.54%) and Tb.N (44.38%) ( p !0.01, p !0.01, respectively) and a significant increase in Tb.Sp (þ119.53%) ( p !0.01) as compared with the sham group. However, PEMFs significantly increased Tb.Ar, Tb.Wi and Tb.N by 77.50%, 17.38% and 51.06%, respectively ( p !0.01, p !0.05, p !0.01, respectively) and reduced Tb.Sp by 44.28% ( p !0.01) as compared with the OVX group. The changes of histomorphometric parameters are further proven by histopathological examination. As shown in Figure 2De2F, there was apparent reduction of trabecular bone area, trabecular number and trabecular connection, and expanded marrow cavity in the OVX group compared to the sham group. However, PEMFs treatment could partially reverse these changes of OVX rats after 12-week PEMFs interventions. Table 2. Changes of static histomorphometric parameters in L4 vertebral body Group
Tb.Ar (%)
Tb.Wi (mm)
277
Tb.N (n/mm)
Tb.Sp (mm)
Sham 31.67 2.62 62.85 7.85 5.07 0.37 135.46 11.01 OVX 16.93 1.59a 60.42 7.69 2.82 0.29a 297.37 32.92a PEMFs 30.05 2.18b 70.92 6.53c 4.26 0.40b 165.69 17.54b PEMFs, pulsed electromagnetic fields; Tb.Ar, trabecular area; Tb.Wi, trabecular width; Tb.N, trabecular number; Tb.Sp, trabecular separation. Data are expressed as mean SD. a p !0.01 vs. sham group. b p !0.01 vs. OVX group. c p !0.05 vs. OVX group.
As shown in Table 3, maximum load and energy to failure in L5 vertebral body of the OVX rats were significantly lower than those of the sham-operated rats ( p !0.01, p !0.01, respectively). However, after 12-week PEMFs interventions, maximum load and energy to failure in L5 vertebral body significantly increased ( p !0.01, p !0.05, respectively) compared to the OVX group. mRNA Expressions The mRNA expressions were estimated using real-time RTPCR. As shown in Figure 3, PEMFs treatment significantly increased the expressions of the mRNAs of Wnt3a, LRP5, b-catenin, c-myc and Runx2 ( p !0.05, p !0.01, p !0.01, p !0.05, p !0.01, respectively) and significantly reduced DKK1 ( p !0.01) as compared with the OVX group. There was no significant difference in Axin2 mRNA expression among the three groups. Interestingly, among the genes studied, mRNA expression of Wnt1 was not detected throughout the experimental period in all three groups.
Discussion During the past three decades, evidence has shown that PEMFs, as an alternative noninvasive method, presented satisfying clinic therapeutic effects on osteoporosis (5,6). Several experimental studies have demonstrated that PEMFs stimulation could prevent bone loss and microarchitecture deterioration in OVX rats (7,8). However, the potential mechanisms responsible for the effects of PEMFs on preservation of bone mass are not well understood. In this study we systematically evaluated the effects of 12-week PEMFs exposure on bone loss in OVX rats. The findings clearly demonstrated that PEMFs could increase serum E2 and BALP levels, preserve bone mass, inhibit deterioration of trabecular bone microarchitecture and strength, and activate Wnt/b-catenin signaling in OVX rats. This is actually the first paper to report the effects of PEMFs on Wnt/b-catenin signaling pathway in OVX rats. Studies showed that there were obvious biological windows of stimulus parameters of PEMFs therapy on various diseases. The biological window could be identified by intensity, frequency, or their combinations (14). In our previous studies (15e17), we explored the effects of PEMFs with different parameters on OVX rats. These parameters include different frequencies: 2 Hz, 8 Hz, 16 Hz; different intensity of magnetism: 0.77 mT, 3.82 mT, 9.87 mT; different exposure time: 20 min, 40 min, 60 min. From results of these studies mentioned above, we found the proper stimulus parameters for treating OVXinduced osteoporosis in rats: field frequency of 8 Hz, intensity of magnetism of 3.82 mT for 40 min/day. The reason for selecting this particular specification in the present
278
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
Figure 2. Histomorphometrical and histopathological analysis of L4 vertebral body. The L4 vertebral body was stained with Safranin-O/Fast green. (A) Sham group. (B) OVX group. (C) PEMFs group at 40 magnification. The L4 vertebral body was stained with hematoxylin and eosin (H&E). (D) Sham group. (E) OVX group. (F) PEMF group. 100 magnification. (A color figure can be found in the online version of this article.)
study was that it had been investigated by our research group for a long experimental period and proven to be effective in prevention of osteoporosis (15e17). Our previous studies (15e17) also showed that the effects of PEMFs exposure with 30 consective days were demonstrated to be satisfactory in the treatment of OVX-induced osteoporosis. Chang et al. (7) also found trabecular bone mass of OVX rats after PEMFs stimulation for 30 days was restored to levels of age-matched intact rats. Jing et al. (8) found PEMFs exposure for 12 weeks presented efficacy in prevention against OVX-induced bone loss and deterioration of trabecular bone architecture. From the results of the studies mentioned above, PEMFs exposure for 12 consecutive weeks seemed to be sufficient. Our results showed that OVX led to increase in body weight of rats, which was consistent with several previous Table 3. Biomechanical parameters for L5 vertebral body Group
Maximum load (N )
Energy to failure (J )
OVX Sham PEMFs
317.57 14.86a 407.56 25.07 360.47 16.94b
0.026 0.002a 0.050 0.003 0.037 0.011c
PEMFs, pulsed electromagnetic fields. Data are expressed as mean SD. a p !0.01 vs. sham group. b p !0.01 vs. OVX group. c p !0.05 vs. OVX group.
studies (8,18). The significant increase of body weight in OVX rats was regarded as one piece of evidence of successful ovariectomy because estrogen deficiency had a direct influence on energy metabolism (19). In this study we found serum E2 level significantly decreased in OVX rats. However, PEMFs interventions increased E2 levels in OVX rats, a finding that supported our preliminary study suggesting that PEMFs have systemic effects on estrogen metabolism in OVX rats (20). We also found that the PEMF-treated rats had increased serum BALP (an indicator of osteoblast activity) (21), suggesting that PEMFs improved new bone formation. Normal bone homeostasis is the result of cross-talk between the anabolic axis (bone-forming osteoblasts) and catabolic axis (bone-resorbing osteoclasts). A disruption of this tightly regulated relationship leads to imbalanced bone turnover, which ultimately results in diseases of the skeleton (22). Our results showed that PEMFs treatment significantly increased BMD in both the femur and L5 vertebral body of OVX rats, which is in agreement with some previous studies (7,8). In addition to BMD, bone microarchitecture is another factor commonly associated with bone quality. Previous studies showed that the trabecular bone microarchitecture (23) including size, number, shape, connectivity and orientation of trabecular correlates with bone strength, which is an important factor reflecting bone fragility and fracture risk (24). Therefore, we observed the effects of PEMFs treatment on trabecular bone
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling
279
Figure 3. mRNA expressions in bone marrow cells were assessed by RT-PCR. Data were expressed as mean SD. ap !0.05 vs. OVX group. bp !0.01 vs. sham group. cp !0.01 vs. OVX group.
microarchitecture and biomechanical properties in this study. There was apparent deterioration of trabecular bone architecture in OVX rats in the present study. However, PEMFs treatment could increase trabecular area, trabecular width, and trabecular number, by 77.50%, 17.38% and 51.06%, respectively, and reduced trabecular separation by 44.28% compared with the OVX group after 12-week interventions. In addition, our results showed that there were significant reductions in maximum load, and energy
to failure of the L5 in OVX rats. However, OVX-induced decreases in biomechanical properties were obviously inhibited by 12-week PEMFs exposure, which was consistent with the improvement of bone mass and positive changes of trabecular bone microarchitecture as seen on histomorphometrical examination. Wnt/b-catenin signaling pathway is conserved in various species from worms to mammals and plays important roles in various aspects of skeletal development. Wnt/b-catenin
280
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
signaling is initiated by binding of a Wnt family member to two receptor molecules, Frizzled proteins (FZD) and LRP5/6. This leads to stabilization of cytoplasmic b-catenin and then the accumulated b-catenin is translocated into the nucleus where it associates with the transcriptional factor T-cell factor (Tcf)/lymphoid enhancer factor (Lef), and thereby stimulates expression of Wnt/b-catenin target genes including c-myc, Runx2, and cyclin D1 (11,25e27). Activation of Wnt/b-catenin signaling pathway promotes proliferation and differentiation of osteoblast precursor cells and increases osteoblast activity, which favors the deposition of new bone and increases BMD (28,29). To explore the mechanism of PEMFs on bone at the molecular level, we explored several important components of Wnt/b-catenin signaling in response to PEMFs treatment. Evidences showed that Wnt1 and Wnt3a are capable of regulating osteoblast function, contributing to bone formation (11,27,30). In this study we found that mRNA expression of Wnt3a in bone marrow cells sharply increased after PEMFs exposure, whereas mRNA expression of Wnt1 was not detected throughout the experimental period in all three groups. LRP5, a critical co-receptor for Wnt signals, can induce a cascade of intracellular events and plays an important role in skeletal development and maintenance (27). In this study, expression of LRP5 increased after 12week PEMFs exposure. Dkk1 is a well-characterized Wnt antagonist active in many tissues (31). Dkk1 negatively regulates Wnt/b-catenin signaling by binding to and antagonizing the Wnt coreceptors Lrp5/6 (32). In this study, PEMFs reduced DKK1 mRNA expression after 12-week interventions. b-catenin is another key component of Wnt/ b-catenin signaling, and cytoplasmic b-catenin stability is essential for activation of Wnt/b-catenin signaling. In the presence of a Wnt signal, b-catenin can serve as a transcription cofactor for genes required for osteoblast differentiation (28,29). We also found that mRNA expression of b-catenin in the bone marrow cells of OVX rats were upregulated by the treatment of PEMFs. Axin2 is a master scaffolding protein originally identified as an intracellular inhibitor of Wnt/b-catenin signaling (33). On the other hand, Axin2 expression is directly induced by Wnt/b-catenin signaling and forms a negative feedback loop (34). However, we found that mRNA expression of Axin2 was not affected by PEMFs. This study showed that expressions of wnt3a, LRP5 and b-catenin were upregulated, whereas DKK1 downregulated after 12-week PEMFs exposure in OVX rats. This indicates that in addition to negative interaction with DKK1, PEMFs activates Wnt signaling by increasing endogenous Wnt3a, LRP5 and b-catenin expressions and subsequent canonical Wnt signaling. Dkk1 is a Wnt antagonist and negatively regulates Wnt/b-catenin signaling (31,32). In this study, PEMFs reduced DKK1 mRNA expression after 12-week PEMF interventions. We supposed PEMFs may activate and augment Wnt/b-catenin signaling through suppression of DKK1. Recently, Wnt/b-catenin signaling pathway has
been identified as one of the important signaling pathways regulating bone accrual and maintenance. It has been shown to be important for the regulation of osteoblastogenesis and osteoblast activity, eventually for controlling bone mass. In summary, activation of the signaling pathway leads to increase bone mass through a number of mechanisms including stem cell renewal, stimulation of preosteoblast replication, induction of osteoblastogenesis, and inhibition of osteoblast and osteocyte apoptosis, whereas suppression results in bone loss (11,35). Because the importance of Wnt/b-catenin signaling for controlling bone mass has already been well-established (11,28,29,35), our results are noteworthy but not surprising. In addition, we also showed the expression levels of a number of genes that represent known transcriptional targets of Wnt/b-catenin pathway (i.e., c-myc, Runx2) (26, 36). Evidence showed that c-myc is also a novel regulator of osteogenesis (37). Runx2 plays important roles in skeletal development and is required for osteoblast development from mesenchymal stem cells and terminal differentiation, and its expression is essential for normal bone formation (38). In this study we found that PEMFs increased the expressions of c-myc and Runx2. In summary, we clearly demonstrated that Wnt/b-catenin signaling members, Wnt3a, LRP5, b-catenin and target genes, c-myc, Runx2 were upregulated after 12-week PEMFs exposure with the exception of DKK1, a wnt antagonist whose expression was downregulated. Together these results suggest that Wnt/b-catenin signaling pathway is activated during PEMFs exposure by characterizing the expressions of a broad spectrum of Wnt/b-catenin molecules. Bone mass is tightly regulated by the balance between bone resorption and formation (22,39). Osteoblasts are the bone-forming cells that play an essential role in bone mass acquisition (40). Because the key role of Wnt/b-catenin signaling for osteoblastic differentiation and function is already well-established (11,28,29), real-time RT-PCR test presented evidence that PEMFs can preserve bone mass and maintain bone architecture and strength in OVX rats, at least partly, through increasing bone formation via activation of Wnt/b-catenin signaling pathway. However, Wnt/b-catenin signaling pathway may not be the only cascade activated by PEMFs, and other signaling pathways may possibly be stimulated. Bodamyali et al. found that PEMFs can induce osteogenesis through improving transcription of bone morphogenetic proteins 2 and 4 in rat osteoblasts in vitro (41). Evidence showed that many signaling cascades such as parathyroid hormone pathways (42) and insulin-like growth factor (43) are also associated with bone formation. The influence of PEMFs on other signaling pathways needs further investigation. This scenario is almost certainly only a partial explanation of one of the mechanisms by which PEMFs influence osteoblast activity to adjust bone mass and architecture.
Pulsed Electromagnetic Fields Activate Wnt/b-Catenin Signaling
In fact, maintenance of bone mass is dependent on the balance between osteoblastic bone formation and osteoclastic bone resorption (22,39). Therefore, regulations of the recruitment, proliferation, differentiation and activation of osteoblasts and osteoclasts are essential for the maintenance of bone mass. Osteoclasts, the sole cell type responsible for bone resorption, play important roles in maintaining bone mass (44). In vitro studies showed that PEMFs can inhibit osteoclastogenesis (45), promote osteoclast apoptosis (46), and suppress bone resorption (47). Although the effects of PEMFs on osteoclast in vitro studies are available, further in vivo studies are required. In conclusion, PEMFs had positive effects on bone mass and trabecular bone microarchitecture and strength in OVX rats. Furthermore, PEMFs upregulated the expressions of Wnt3a, LRP5, b-catenin, c-myc and Runx2, while downregulating DKK1 in bone marrow cells of OVX rats. These results suggest that activation of Wnt/b-catenin signaling pathway plays an important role in these beneficial effects of PEMFs on OVX rats. However, loss of function or inhibition experiments need be performed to explore whether Wnt/b-catenin signaling pathway is not merely correlated but is indeed necessary for the positive effects. Although more work is needed to fully elucidate the role of PEMFs on Wnt/b-catenin signaling, these observations may be crucial in helping to understand the mechanisms of PEMFs in OVX-induced osteoporosis. Acknowledgments We thank the National Natural Science Fund of China (No. 81171865) for the financial support.
Conflict of Interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. References 1. National Institutes of Health. Osteoporosis prevention, diagnosis, and therapy. JAMA 2001;285:785e795. 2. Kanis JA. Diagnosis of osteoporosis and assessment of fracture risk. Lancet 2002;359:1929e1936. 3. Lewiecki EM. Current and emerging pharmacologic therapies for the management of postmenopausal osteoporosis. J Womens Health (Larchmont) 2009;18:1615e1626. 4. Gallacher SJ, Dixon T. Impact of treatments for postmenopausal osteoporosis (bisphosphonates, parathyroid hormone, strontium ranelate, and denosumab) on bone quality: a systematic review. Calcif Tissue Int 2010;87:469e484. 5. Garland DE, Adkins RH, Matsuno NN, et al. The effect of pulsed electromagnetic fields on osteoporosis at the knee in individuals with spinal cord injury. J Spinal Cord Med 1999;22:239e245. 6. Tabrah F, Hoffmeier M, Gilbert F Jr, et al. Bone density changes in osteoporosis-prone women exposed to pulsed electromagnetic fields (PEMFs). J Bone Miner Res 1990;5:437e442.
281
7. Chang K, Chang WH. Pulsed electromagnetic fields prevent osteoporosis in an ovariectomized female rat model: a prostaglandin E2associated process. Bioelectromagnetics 2003;24:189e198. 8. Jing D, Shen G, Huang J, et al. Circadian rhythm affects the preventive role of pulsed electromagnetic fields on ovariectomy-induced osteoporosis in rats. Bone 2010;46:487e495. 9. Lohmann CH, Schwartz Z, Liu Y, et al. Pulsed electromagnetic field stimulation of MG63 osteoblast-like cells affects differentiation and local factor production. J Orthop Res 2000;18:637e646. 10. De Mattei M, Caruso A, Traina GC, et al. Correlation between pulsed electromagnetic fields exposure time and cell proliferation increase in human osteosarcoma cell lines and human normal osteoblast cells in vitro. Bioelectromagnetics 1999;20:177e182. 11. Krishnan V, Bryant HU, Macdougald OA. Regulation of bone mass by Wnt signaling. J Clin Invest 2006;116:1202e1209. 12. Gregory LS, Kelly WL, Reid RC, et al. Inhibitors of cyclo-oxygenase2 and secretory phospholipase A2 preserve bone architecture following ovariectomy in adult rats. Bone 2006;39:134e142. 13. Parfitt AM, Drezner MK, Glorieux FH, et al. Bone histomorphometry: standardization of nomenclature, symbols, and units. Report of the ASBMR Histomorphometry Nomenclature Committee. J Bone Miner Res 1987;2:595e610. 14. Markov MS. Pulsed electromagnetic field therapy history, state of the art and future. Environmentalist 2007;27:465e475. 15. Yang YH, He CQ, Yang L, et al. Effects of different intensity pulsed electromagnetic fields on serum estradiol of ovariectomized rats. Sichuan Da Xue Xue Bao Yi Xue Ban 2008;39:256e258. 16. Huang L, Wang W, Xiao D, et al. Effect of pulsed electromagnetic fields of different treatment time on bone mineral density of femur in ovariectomized rats. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi 2008;22:548e550. 17. He C, Wang W, Xiao D, et al. Effect of pulsed electromagnetic fields of different frequencies on serum estradiol and bone calcium content of femur in ovariectomized rats. Chin J Rehab Med 2007;22:303e305. 18. Ke HZ, Chen HK, Simmons HA, et al. Comparative effects of droloxifene, tamoxifen, and estrogen on bone, serum cholesterol, and uterine histology in the ovariectomized rat model. Bone 1997;20: 31e39. 19. Swithers SE, McCurley M, Hamilton E, et al. Influence of ovarian hormones on development of ingestive responding to alterations in fatty acid oxidation in female rats. Horm Behav 2008;54:471e477. 20. Luo Q, Li SS, He C, et al. Pulse electromagnetic fields effects on serum E2 levels, chondrocyte apoptosis, and matrix metalloproteinase-13 expression in ovariectomized rats. Rheumatol Int 2009;29:927e935. 21. Han X, Xu Y, Wang J, et al. Effects of cod bone gelatin on bone metabolism and bone microarchitecture in ovariectomized rats. Bone 2009;44:942e947. 22. Henriksen K, Neutzsky-Wulff AV, Bonewald LF, et al. Local communication on and within bone controls bone remodeling. Bone 2009;44: 1026e1033. 23. Ulrich D, van Rietbergen B, Laib A, et al. The ability of threedimensional structural indices to reflect mechanical aspects of trabecular bone. Bone 1999;25:55e60. 24. Hernandez CJ, Keaveny TM. A biomechanical perspective on bone quality. Bone 2006;39:1173e1181. 25. Kikuchi A, Kishida S, Yamamoto H. Regulation of Wnt signaling by protein-protein interaction and post-translational modifications. Exp Mol Med 2006;38:1e10. 26. Gaur T, Lengner CJ, Hovhannisyan H, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 2005;280:33132e33140. 27. Monroe DG, McGee-Lawrence ME, Oursler MJ, et al. Update on Wnt signaling in bone cell biology and bone disease. Gene 2012;492: 1e18.
282
Zhou et al./ Archives of Medical Research 43 (2012) 274e282
28. Bodine PV, Komm BS. Wnt signaling and osteoblastogenesis. Rev Endocr Metab Disord 2006;7:33e39. 29. Hartmann C. A Wnt canon orchestrating osteoblastogenesis. Trends Cell Biol 2006;16:151e158. 30. Boland GM, Perkins G, Hall DJ, et al. Wnt 3a promotes proliferation and suppresses osteogenic differentiation of adult human mesenchymal stem cells. J Cell Biochem 2004;93:1210e1230. 31. Pinzone JJ, Hall BM, Thudi NK, et al. The role of Dickkopf-1 in bone development, homeostasis, and disease. Blood 2009;113:517e525. 32. He X, Semenov M, Tamai K, et al. LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development 2004;131:1663e1677. 33. Kikuchi A. Roles of Axin in the Wnt signalling pathway. Cell Signal 1999;11:777e788. 34. Jho EH, Zhang T, Domon C, et al. Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol Cell Biol 2002;22:1172e1183. 35. Milat F, Ng KW. Is Wnt signalling the final common pathway leading to bone formation? Mol Cell Endocrinol 2009;310:52e62. 36. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509e1512. 37. Piek E, Sleumer LS, van Someren EP, et al. Osteo-transcriptomics of human mesenchymal stem cells: accelerated gene expression and osteoblast differentiation induced by vitamin D reveals c-MYC as an enhancer of BMP2-induced osteogenesis. Bone 2010;46:613e627. 38. Otto F, Thornell AP, Crompton T, et al. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 1997;89:765e771.
39. Martin T, Gooi JH, Sims NA. Molecular mechanisms in coupling of bone formation to resorption. Crit Rev Eukaryot Gene Expr 2009; 19:73e88. 40. Marie PJ. The molecular genetics of bone formation: implications for therapeutic interventions in bone disorders. Am J Pharmacogenomics 2001;1:175e187. 41. Bodamyali T, Bhatt B, Hughes FJ, et al. Pulsed electromagnetic fields simultaneously induce osteogenesis and upregulate transcription of bone morphogenetic proteins 2 and 4 in rat osteoblasts in vitro. Biochem Biophys Res Commun 1998;250:458e461. 42. Swarthout JT, D’Alonzo RC, Selvamurugan N, et al. Parathyroid hormone-dependent signaling pathways regulating genes in bone cells. Gene 2002;282:1e17. 43. Niu T, Rosen CJ. The insulin-like growth factor-I gene and osteoporosis: a critical appraisal. Gene 2005;361:38e56. 44. Suda T, Takahashi N, Martin TJ. Modulation of osteoclast differentiation. Endocr Rev 1992;13:66e80. 45. Chang K, Hong-Shong Chang W, Yu YH, et al. Pulsed electromagnetic field stimulation of bone marrow cells derived from ovariectomized rats affects osteoclast formation and local factor production. Bioelectromagnetics 2004;25:134e141. 46. Chang K, Chang WH, Tsai MT, et al. Pulsed electromagnetic fields accelerate apoptotic rate in osteoclasts. Connect Tissue Res 2006;47: 222e228. 47. Chang K, Chang WH, Huang S, et al. Pulsed electromagnetic fields stimulation affects osteoclast formation by modulation of osteoprotegerin, RANK ligand and macrophage colony-stimulating factor. J Orthop Res 2005;23:1308e1314.