− mice

Available online at www.sciencedirect.com

Immunology Letters 113 (2007) 83–89

P2X currents in peritoneal macrophages of wild type and P2X4−/− mice Bert Brˆone ∗ , Diederik Moechars, Roger Marrannes, Marc Mercken, Theo Meert Gobal Preclinical Development, Johnson and Johnson Pharmaceutical Research and Development, Turnhoutseweg 30, B2340 Beerse, Belgium Received 5 June 2007; received in revised form 19 July 2007; accepted 27 July 2007 Available online 22 August 2007

Abstract In this study the ATP-induced (P2X) currents in isolated peritoneal macrophages of wild type (WT) and P2X4 knockout (P2X4 −/− ) mice were studied by means of whole-cell patch clamp in order to (1) survey the P2X currents of native macrophages and (2) to investigate the expression of P2X4 -like currents in the WT versus P2X4 −/− mice. Three types of currents were observed in the isolated macrophages: (1) in ∼10% of both WT and P2X4 −/− macrophages a fast activating and inactivating P2X1-like current was recorded with low concentrations (0.1–1 ␮M) of ATP; (2) 85% of wild type and 100% of P2X4 −/− macrophages exhibited a non-desensitizing P2X7 -like current activated at high concentrations of ATP (10 mM). The identity of the P2X7 current was confirmed using the specific blocker A-740003; (3) 88.6% of the WT but none of the P2X4 −/− macrophages showed a small P2X4 -like current that desensitized slowly upon ATP application at intermediate concentrations (3–300 ␮M). Several observations indicated that the slowly desensitizing current in WT macrophages was P2X4 . The EC50 value of 5.3 ␮M ATP was as expected for P2X4 and the current induced by 3–300 ␮M ATP was absent in P2X4 −/− mice. Upon application of 3 ␮M ivermectin, a P2X4 -selective modulator, the amplitude of this current was increased and the desensitization was inhibited in WT cells. In addition, this current was facilitated by 10 ␮M Zn2+ but inhibited by Cu2+ (in contrast to P2X2 ). We conclude that the P2X4 and P2X7 currents are functionally expressed in recruited peritoneal macrophages of WT mice and that the P2X4 -like current is absent in P2X4 −/− mice. © 2007 Elsevier B.V. All rights reserved. Keywords: Patch clamp; P2X4 ; P2X7 ; Knockout; Macrophage

1. Introduction Macrophages are part of the first line of defense against pathogenic infections. Extracellular nucleotides have various effects on these cells such as increased elimination of infecting pathogens [1], IL-1␤ release [2,3], superoxide production [4] and attenuated pinocytosis [5]. Intracellular Ca2+ signaling in immune cells is an important regulatory mechanism implicated in cytoskeleton reorganization, gene expression and gating of various K+ channels [6–9]. In macrophages extracellular ATP causes a rise in intracellular Ca2+ concentration due to the activation of purinergic receptors. Part of this activation depends on G-protein coupled P2Y receptors and is mainly dependent on intracellular Ca2+ stores, whereas part of it requires extracellular Ca2+ entering the cell through the P2X receptors. P2X receptors are ligand gated cation channels activated by extracellular ATP. Three P2X subunits are assembled into homomers or

∗

Corresponding author. Tel.: +32 14 602496; fax: +32 14 606121. E-mail address: [email protected] (B. Brˆone).

0165-2478/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.imlet.2007.07.015

heteromers [10]. P2X1/5 , P2X2/6 , and P2X4/6 heteromeric channels were only shown in heterologous expression systems but never in native cells. Early studies on mouse J774 cells, a macrophage cell line, showed that high concentrations of ATP caused a cation flux, IL-1␤ secretion and membrane permeabilization due to the activation of P2X7 receptors [11]. Recent work has elucidated that the IL-1␤ secretion and pore formation requires pannexin hemichannels interacting with P2X7 [12,13]. The P2X7 currents have been functionally studied in several macrophage related cells of human and murine origin such as cell lines, monocyte derived dendritic cells, and microglial cells (for review see Ref. [14]). Lower concentrations of ATP on the other hand were first thought to increase the Ca2+ level in macrophages via P2Y receptors [15,16]. Gradually evidence emerged showing the presence of P2X4 channels in addition to the P2Y receptors in macrophages and related cells. P2X4 is now taken as a marker for activated macrophages and microglia [17–20]. However, most studies on P2X4 and P2X7 were done in macrophage cell lines or related cells, e.g. mouse J774 macrophages, murine RAW264.7

84

B. Brˆone et al. / Immunology Letters 113 (2007) 83–89

cells, NR8383 derived from rat alveolar macrophages, monocyte derived dendritic cells and microglia [14,18,21–24]. Recently mRNA of P2X4 was found to be expressed together with P2X1 and P2X7 mRNA in resident peritoneal macrophages of mice [25]. To our knowledge however, a direct P2X4 and/or P2X7 current measurement has never been shown in native macrophages before. Therefore we setup a study to investigate P2X4 and P2X7 currents in isolated macrophages of wild type and P2X4 −/− knockout mice. 2. Materials and methods 2.1. Animals Animals used for pharmacologic studies were individually housed and kept under 12:12 h light/dark cycle (lights on at 6:00 a.m.) in a temperature- and humidity-controlled room with food and water ad libitum. All experiments were conducted in a light room during the light phase of the light/dark cycle. Experiments were approved by the animal care and user committee of Johnson & Johnson Pharmaceutical Research and Development. 2.2. Generation of P2X4 −/− mouse P2X4 −/− knockout mice were developed in collaboration with Deltagen Inc. A genomic fragment of about 7.3 kb, including the second coding exon of the P2X4 protein, was isolated from a mouse genomic library and subcloned into the BamHI site of the pBluescript II SK(−) vector. A 13-bp fragment corresponding to a segment of the protein-coding region was replaced by an IRES-lacZ reporter and neomycin (G418) resistance cassette (IRES-lacZ-neo; Fig. 1). This mutation was designed to produce a loss-of-function mutation by deletion of amino acids 67–71, as well as insertion of the 6.9-kb reporter/resistance cassette. The IRES-lacZ-neo cassette was flanked by 5.0 kb of mouse genomic DNA at its 5 aspect and 2.3 kb of mouse genomic DNA at its 3 aspect. The targeting vector was linearized and electroporated into 129P2/OlaHsd mouse embryonic stem (ES) cells. ES cells were selected for G418 resistance and colonies carrying the homologously integrated IRES-lacZ-neo DNA were identified by PCR amplification with neo-specific primers paired with primers located outside the targeting homology arms on both the 5 and 3 sides. Colonies that gave rise to the correct size PCR product were confirmed by Southern blot analysis using a probe adjacent to the 5 region of homology. The presence of a single IRES-lacZ-neo cassette was confirmed by Southern blot analysis with a neo gene fragment as a probe. Male chimeric mice were generated by injection of the targeted ES cells into C57Bl/6 blastocysts. Chimeric mice were bred with C57Bl/6 mice to produce F1 heterozygotes (P2X4 +/− ). Germline transmission was confirmed by PCR analysis. Primers 5 CTCCTCTGTGTCAGGTCGACTTTAC3 and 5 GAGCTGGGACCACATAGTCGGCCAC3 amplified a 199 bp band from the wild type allele while primers 5 GAGCTGGGACCACATAGTCGGCCAC3 and 5 GGGCCAGCTCATTCCTCCCACTCAT3 amplified a

Fig. 1. Targeted disruption of the P2X4 gene. (A) Structure of the wild type locus, targeting vector and recombinant locus. Boxes represent the known exons, in white and gray indicated are the non-coding and coding regions. A targeting construct was generated by replacing part of the coding region of exon2 by the IRES-LacZ-Neo reporter/selection cassette and interrupting the open reading frame. (B) The wild type and targeted allele give a 199 and 317 bp PCR product, respectively and identify P2X4 +/+ (lane 1), P2X4 +/− (lane 3) and P2X4 −/− (lane 2) animals. (C) Expression of the P2X4 transcript in macrophage was absent in the P2X4 −/− mouse as determined by quantitative RT-PCR. Values expressed are relative expression levels after normalization to ␤-actin.

317 bp band from the knockout allele. F1 heterozygous males and females were mated to produce the F2 wild type (P2X4 +/+ ) and homozygous (P2X4 −/− ) mutant animals used in this study. 2.3. Measurement of gene expression Quantitative RT-PCR analysis was used to show expression or absence of the P2X4 transcript. Total RNA was isolated from isolated macrophages using Trizol (Invitrogen; Carlsbad, CA) and first strand cDNA synthesis was performed on 0.5 ␮g total RNA with random hexamer primers and SuperscriptII RT (Invitrogen; Carlsbad, CA). Quantitative PCR was performed on a ABIPrism 7700 cycler (Applied Biosystems; Foster City, CA) with a Taqman PCR kit. Serial dilutions of cDNA were used to generate standard curves of threshold cycles versus the logarithms of concentration for ␤-actin and P2X4 . A linear regression line calculated from the standard curves allowed the determination of transcript levels in RNA samples from mice. For P2X4 a predesigned primer-probe pair (Mm00501791 m1) was ordered from Applied Biosystems. For ␤-actin the following primerprobe pairs was used: • Forward primer: 5 CATCTTGGCCTCACTGTCCAC3 . • Reverse primer: 5 GGGCCGGACTCATCGTACT3 . • Probe: 5 TGCTTGCTGATCCACATCTGCTGGA3 [5 ]FAM [3 ]TAMRA.

B. Brˆone et al. / Immunology Letters 113 (2007) 83–89

2.4. Cells and culture 1321 N1 astrocytoma cells (ECACC, Salisbury, UK) were stably transfected with rP2X4 and maintained under standard sterile cell culture conditions. The culture medium for the astrocytomas was DMEM (Invitrogen, Merelbeke, Belgium) supplemented with 0.5 g/l geneticin (Gibco), 14.6 g/l l-glutamine (200 mM; Invitrogen), 5 g/l penicillin/streptomycin (5 × 10−6 IU/l, Invitrogen), 5.5 g/l pyruvic acid (Invitrogen) and 10% foetal calf serum (Hyclone, Logan UT, USA). For patch clamp experiments the cells were resuspended in culture medium without geneticin and seeded in Nunclon Petri dishes (35 mm, Nunc, Roskilde, Denmark) at 30,000 cells/ml and incubated in a humidified incubator at 37 ◦ C with 5% CO2 for at least 24 h. Peritoneal macrophages of wild type and P2X4 −/− mice were isolated as previously described [26]. Mice were injected intraperitoneally with 500 ␮l BBLTM Fluid thioglycollate medium (Becton Dickinson, Erenbodegem, Belgium). At least 3 days after injection the elicited peritoneal cells were harvested by peritoneal lavage with ice cold, Ca2+ - and Mg2+ -free PBS (Invitrogen). Residential peritoneal cells were similarly isolated from the peritonea of untreated mice. Peritoneal cells were washed with PBS after a first centrifugation step (200 × g for 5 min) and resuspended in culture medium without geniticin after a second centrifugation step. The cells were plated at 50,000 per 35 mm Petri dish (Nunc) and after a 30 min rest, the non-adherent cells were removed by washing the Petri dishes with medium to enrich the cultures with macrophages. Only cells with a central sphere surrounded with a disk-shaped outgrowth were considered as macrophages and used in the electrophysiological experiments. 2.5. Electrophysiology Whole cell patch clamp recordings [27] were made at room temperature with an EPC10 amplifier (HEKA electronik, Lambrecht, Germany). Gigaseals were obtained and the series resistance was compensated for 90% after rupturing the membrane patch. The membrane potential was clamped at −60 mV throughout the experiment if not stated otherwise. Fast solution changes were done by means of a Warner SF77B fast step superfusion system (Warner Instruments LLC, Hamden, CT, USA). Currents were sampled at 1 kHz and filtered at 333 Hz. Data acquisition and analysis were done with Pulse + Pulsefit (HEKA electronik, Lambrecht, Germany), Igor Pro [28] (Wavemetrics Inc., Lake Oswego, OR, USA), Prism and Instat Demo version (Graphpad Software Inc., San Diego, CA, USA; free at www.graphpad.com) software. Data were shown as mean ± standard error to the mean.

85

lacZ-neo and disruption of the open reading frame (Fig. 1A). Correct targeting in ES cells was confirmed by Southern analysis (results not shown) and loss of the wild type P2X4 allele was confirmed by PCR analysis (Fig. 1B). Expression of the P2X4 transcript was absent in P2X4 −/− embryos (Fig. 1C). The P2X4 −/− mice showed a normal viability and fertility. 3.2. ATP-activated currents Three types of purinergic currents were recorded in recruited macrophages isolated from WT and P2X4 −/− mice. These currents could be distinguished on the basis of their current kinetics and pharmacology. First, a P2X1 -like current with fast activating and inactivating kinetics (within 1 s) was recorded upon activation with low concentrations of ATP (0.1–1 ␮M) in 10.2% and 11.1% of WT and P2X4 −/− macrophages, respectively (nWT = 49, nP2X4 −/− = 36; Fig. 2A). The current amplitude was in the range of nanoamperes and the current disappeared in subsequent ATP applications. Due to the rare occurrence and the strong tachyfylaxis of this P2X1 -like current we did not characterize it in detail. Second, upon ATP application at intermediate concentrations (1–300 ␮M) 88.6% of the wild type cells (n = 53) showed a small P2X4 -like current (tens of picoamperes; Fig. 2B). In the P2X4 −/− cells (n = 28) no current was seen at these intermediate ATP concentrations. The P2X4 -like current in wild type macrophages desensitized slowly during the ATP application and the desensitization was more pronounced at higher ATP concentrations. A pharmacological characterization of the P2X4 -like current will be described in detail in Section 4.3. Third, 85% of wild type (n = 40) and 100% of P2X4 −/− macrophages (n = 18) exhibited a maintained P2X7 -like current activated at high concentrations of ATP (10 mM) and this current was several nanoamperes in amplitude. The first ATP application evoked a non-desensitizing current (not shown) but in subsequent stimulations the current showed an apparent partial desensitization (Fig. 2C), which was not seen in recombinant P2X7 currents (expressed in 1321 N1 cells, data not shown). In order to confirm that this maintained current was P2X7 , we examined the effect of the P2X7 -specific blocker A-740003 (N-(1-{[(cyanoimino)(5-quinolinylamino)methyl]amino}-2,2dimethylpropyl)-2-(3,4-dimethoxyphenyl)acetamide [29]) on currents in macrophages evoked by 10 mM ATP. Ten micromolars A-74003 significantly decreased the sustained ATP-activated current to 6.4 ± 1.5% after 2 min (n = 6, p < 0.001, one-sample t-test with 100% as a reference, see inset Fig. 2C) and the effect was partially reversible upon washout during 6 min. 3.3. Identifications of P2X4

3. Results 3.1. Generation of the P2X4 −/− mouse The P2X4 mouse gene contains 12 coding exons. Homologous recombination resulted in deletion of part of the coding region of the second coding exon, with insertion of the IRES-

Several observations indicated that the slowly desensitizing current activated at intermediate concentrations in the wild type macrophages was P2X4 . Although this P2X4 -like current in these cells is 100 times smaller in amplitude compared to the other types of ATP-activated currents (Fig. 2), it can be clearly separated from these other currents. The concentration response

86

B. Brˆone et al. / Immunology Letters 113 (2007) 83–89

Fig. 3. Concentration response curve of ATP on P2X4 currents. Currents were activated with increasing concentrations of ATP during 1 s, with intervals of 1 min. The current amplitudes were normalized for each cell to the highest response and the mean value ± S.E.M. for each concentration was calculated for 8 cells. The data points were fitted with a Hill equation: EC50 = 5.4 ± 1.8 ␮M ATP and Hill coefficient = −0.8.

Fig. 2. P2X currents in macrophages. (A) At 1 ␮M ATP a fast activating and inactivating P2X1 -like current was measured in a macrophage. (B) In the concentration range of 1–300 ␮M ATP a small P2X4 -like current was measured in wild type but not in P2X4 −/− macrophages. Currents were measured every minute and the ATP application was kept short (1 s) to reduce tachyfylaxis. (C) When ATP was applied to the cells at a concentration of 10 mM a maintained current was measured during 20 s. The holding potential in this experiment was −30 mV to reduce excessive Ca2+ influx. Ten micromolars A-740003 blocked the inward current almost completely after 2 min, and this effect was partially reversible upon washout. In the inset the mean amplitude of the peak currents normalized to the control value is shown for 6 cells. The current amplitude was reduced to 6.4 ± 1.5% by addition of A-740003 (*p < 0.001, one-sample t-test; for these measurements the holding potential was −60 mV).

curve of ATP for P2X4 -like currents showed an EC50 value of 5.3 ± 1.8 ␮M as would be expected for P2X4 currents whereas the EC50 of ATP for P2X7 is much larger [10,30] (Fig. 3). Moreover, the slowly desensitizing kinetics are comparable to those of recombinant P2X4 channels expressed in heterologous

cell systems [14]. In addition, extracellular application of the P2X4 -selective modulator ivermectin (IVM; 3 ␮M) significantly increased the current amplitude to 270 ± 35% (Fig. 4; n = 5, p is 0.0087, Student’s t-test). IVM also decreased the deactivation of the current evoked with 10 ␮M ATP and increased the current amplitude after washout of ATP from 25 ± 9% to 255 ± 54% (Fig. 4; n = 5, p is 0.018, Student’s t-test). The effect of divalent cations on the current induced at 10 ␮M ATP provides an additional argument that this current is a P2X4 current (Fig. 5). Application of 10 ␮M Zn2+ to an ATP-activated cell (10 ␮M) increased the inward current and an additional small increase in current amplitude was seen after washout of Zn2+ (Fig. 5A). We repeated this experiment on a 1321 N1 astrocytoma cell line stably expressing the rat P2X4 channel. On comparison with the P2X4 -current of mouse macrophages, rat P2X4 currents showed very similar current kinetics upon ATP and Zn2+ application while the amplitude was 100 times larger (Fig. 5D). The same experimental protocol was used to check whether extracellular Cu2+ affected the P2X4 current. Indeed, in both mouse macrophages and recombinant rP2X4 10 ␮M Cu2+ induced a clear block of the ATP-evoked current and this block was reversible upon washout of Cu2+ (Fig. 5B and E). Fig. 5C and F shows the mean, normalized currents in the control, “Cu2+ or Zn2+ ” and washout phase of the previous experiments. Although both the native P2X4 current in macrophages (n = 5) and the expressed rP2X4 currents (n = 6) desensitized during the 6 s of ATP application, zinc clearly increased and copper decreased the current amplitudes. Due to the effect of current desensitization on these data (the Cu2+ or Zn2+ effects were respectively overestimated and underestimated when compared with the control value), statistical analysis was not done. 4. Discussion We found that at least three different types of purinergic currents were functionally expressed in native, peritoneal

B. Brˆone et al. / Immunology Letters 113 (2007) 83–89

87

Fig. 4. Effect of ivermectin. (A) Three micromolars IVM increased the amplitude and slowed down the desensitization of the current activated by 10 ␮M ATP in wild type macrophages (1 min IVM exposure). P2X4 −/− macrophages did not show a P2X4 current before or after IVM application. (B) IVM significantly increased the peak current and the current after washout of ATP. The inward current was measured at the end of each segment (see arrows), and normalized to the control value of the ATP response for each cell. The mean ± S.E.M. of the normalized values for 5 cells are plotted in panel (B) and the fill pattern of the bars corresponds to that of the arrows in panel (A). An asterix indicates a significant difference (p values were respectively 0.0087 and 0.018 for peak and washout currents, n = 5, Student’s t-test). WT = wild type, KO = knockout, C = control, IVM = 1 min ivermectin, Wash = current after washout.

macrophages isolated in primary cultures: P2X1 -like, P2X4 and P2X7 currents. This seems to be a common pattern of expression for macrophages of various species [7,25]. However, one study showed mRNA and protein of additional P2X channels in macrophages [22] while another did not find evidence for functional P2X channels other than P2X4 in a macrophage cell line [21]. In the present study the three P2X currents in peritoneal macrophages were discerned on the basis of their ATP-sensitivity, pharmacology and current kinetics by means of the patch clamp technique.

4.1. P2X1 -like current In approximately 10% of both wild type and P2X4 −/− macrophages an inward current with fast activating and inactivating kinetics was recorded upon ATP application. Taking into account the kinetics of this purinergic current and its ATP sensitivity (activated from sub-micromolar concentrations) we cannot discriminate between a P2X1 or P2X3 current [10]. The identity of this current was hard to substantiate due to the infrequent occurrence, combined with the extreme tachyfylaxis: the

Fig. 5. Effect of divalent cations on the P2X4 current. The effect of 10 ␮M copper and zinc on the ATP-activated currents in recruited macrophages (panels A, B and C) was compared with the effect on recombinant rat P2X4 currents expressed in 1321 N1 astrocytoma cells (panels D, E and F). (A) Representative current traces of wild type (WT) and P2X4 −/− macrophages where 10 ␮M Zn2+ was applied for 2 s in the presence of 10 ␮M ATP. (B) A similar experiment was performed with 10 ␮M Cu2+ on the purinergic current in WT macrophages. (C) The mean effect is shown for WT (n = 5) and P2X4 −/− (n = 6) macrophages. The mean current amplitudes were measured in the control ATP period, the period where Cu2+ or Zn2+ was added and after washout of Cu2+ or Zn2+ , and this at the moment indicated by the circles in panels (A) and (B). The currents were normalized to the control value. Panels (D), (E) and (F) show the same experiments and analysis on rP2X4 in 1321 N1 cells (n = 6).

88

B. Brˆone et al. / Immunology Letters 113 (2007) 83–89

current completely vanished on the second ATP stimulation with a 1 min interval. Since del Rey et al. [25] found P2X1 mRNA but not P2X3 mRNA in isolated peritoneal macrophages of mice we assume that this ATP-evoked current with fast kinetics is P2X1 . However, results of an earlier study showing P2X3 mRNA and proteins in mouse spleen macrophages [22] raise doubts about this hypothesis. 4.2. P2X7 current The expression of P2X7 channels on the RNA and protein level is extensively described in several hematopoietic cells [14,22,31]. Furthermore, fluorescent measurements showed P2X7 activity in macrophage cell lines [24]. In the present study we show electrophysiological evidence for the functional expression of P2X7 channels in native macrophages of mice. The low ATP sensitivity (>1 mM needed for activation) and the sustained current behavior are P2X7 -specific characteristics. The identity of this current was confirmed by blocking it with the P2X7 -specific blocker A-740003 [29]. Some properties of the P2X7 current differed from those of recombinant P2X7 channels expressed in heterologous systems [14]. Recombinant P2X7 does not show desensitization when expressed in 1321 N1 cells (data not shown). In the native mouse macrophages of this study a clear desensitization is seen starting from the second application of 10 mM ATP. One reason for the desensitization might be the presence of Ca2+ -activated K+ channels that are activated due to Ca2+ influx during the prolonged ATP application (20 s) [4]. A different phosphorylation state of the cells might have some influence too [32]. Nevertheless it is obvious that P2X7 is expressed to a great extend in mouse macrophages. 4.3. P2X4 current Although the P2X4 current in the peritoneal macrophages displayed a small amplitude, it was clearly identified as P2X4 on the basis of the following characteristics: first, it was activated at intermediate ATP concentrations (3–300 ␮M) with an EC50 value of 5.3 ␮M. This ATP sensitivity is as expected for P2X4 [10,30]. Second, the P2X4 current desensitized partly within a second of ATP application whereby the speed of desensitization was intermediate between the P2X1 and P2X7 currents. The slow kinetics and the ATP potency might not only represent a P2X4 current but also P2X2 currents. However, the current induced in the ATP concentration range of 3–300 ␮M was absent in macrophages of P2X4 −/− mice (Fig. 4) ruling out a P2X2 involvement. Third, the P2X4 current was increased by Zn2+ and blocked by Cu2+ . The positive modulation of the P2X4 current by Zn2+ has been extensively described in previous papers [33–35]. The copper-induced block on the other hand is described by Coddou et al. [35] but was not seen by Xiong et al. [33], although in both cases the rat P2X4 was expressed in a Xenopus laevis oocyte system. Because of these contradicting results we performed the same “Cu2+ ” experiment on native mouse macrophage P2X4 currents and on rat P2X4 expressed in HEK cells. These experiments resulted in a very similar current block and confirmed the

Coddou experiments [34,35]. At least, the copper induced block does not support the possibility that this is a P2X2 current since Cu2+ increases the P2X2 current amplitude [33]. Fourth, the P2X4 selective agonist ivermectin [36] increased the amplitude and inhibited the deactivation of the P2X4 current in peritoneal macrophages. Fifth, in P2X4 −/− knock out mice the current showing the previous characteristics was completely abolished. Finally, from our experiments we cannot exclude the possibility that the ATP-activated current (between 3 and 300 ␮M) in WT macrophages was partly carried by P2X4/6 heteromer channels. P2X6 channels expressed in heterologous systems do not produce any measurable currents [37,38] suggesting that the P2X6 channels might be expressed in macrophages of P2X4 −/− knockout mice without showing any current. One way to discriminate between P2X4 and P2X4/6 currents is the effect of reactive Blue 2, because preapplication of reactive Blue 2 (10 ␮M) should increase the amplitude of the homomeric P2X4 current. However, this effect could not be discerned from the experiments due to the small signal to noise level of the current (data not shown). Altogether, we were able to dissect the small P2X4 current from the total of ATP-evoked currents in recruited peritoneal macrophages. 4.4. Concluding remarks In this study we have shown for the first time functionally active P2X4 and P2X7 currents in native macrophages. One of the most striking differences between both currents is, besides their known ATP-sensitivities and kinetics, the 100-fold difference in current amplitude. Low concentrations of ATP evoke a small P2X4 -driven current while larger ATP concentrations induce a large P2X7 -driven current. The difference in amplitude seems to reflect a different role for P2X7 and P2X4 , each in their concentration range of ATP. P2X7 has principally been demonstrated to engage pro-inflammatory signaling pathways in immune cells, particularly the activation of caspase-1 containing inflammasome [39]. P2X7 in macrophages is involved in ATP-evoked processing of pro-IL-1␤ and membrane permeabilization [11,3]. Like in microglia [17], a role in the activation of macrophages might be suggested for P2X4 . However, the small and transient increase in intracellular Ca2+ induced by P2X4 stimulation might be overshadowed by the Ca2+ release induced by stimulation of the G-protein coupled P2Y2 receptors in macrophages that shows a similar ATP sensitivity [25]. Earlier studies with P2X4 −/− mice showed an impaired control of vascular tone and an altered hippocampal synaptic potentiation but an immunologic effect of P2X4 remains to be revealed [40,41]. Acknowledgments We would like to acknowledge Erik De Prins, Marc Vandermeeren, Guy Daneels and Ilse Goris for their technical support, Sandra Leo and Ria Biermans for the intraperitoneal injections, Roel Straetemans for advise on statistics. This work is partially supported by the IWT grant P00008281R.

B. Brˆone et al. / Immunology Letters 113 (2007) 83–89

References [1] Coutinho-Silva R, Perfettini JL, Persechini PM, Dautry-Varsat A, Ojcius DM. Modulation of P2Z/P2X7 receptor activity in macrophages infected with Chlamydia psittaci. Am J Physiol Cell Physiol 2001;280(1):C81–9. [2] Perregaux DG, McNiff P, Laliberte R, Conklyn M, Gabel CA. ATP acts as an agonist to promote stimulus-induced secretion of IL-1{beta} and IL-18 in human blood. J Immunol 2000;165(8):4615–23. [3] Solle M, Labasi J, Perregaux DG, Stam E, Petrushova N, Koller BH, et al. Altered cytokine production in mice lacking P2X7 receptors. J Biol Chem 2001;276(1):125–32. [4] Schmid-Antomarchi H, Schmid-Alliana A, Romey G, Ventura MA, Breittmayer V, Millet MA, et al. Extracellular ATP and UTP control the generation of reactive oxygen intermediates in human macrophages through the opening of a charybdotoxin-sensitive Ca2+ -dependent K+ channel. J Immunol 1997;159(12):6209–15. [5] Cohn ZA, Parks E. The regulation of pinocytosis in mouse macrophages. IV. The immunological induction of pinocytic vesicles, secondary lysosomes, and hydrolytic enzymes. J Exp Med 1967;125(6):1091–104. [6] Gallo EM, Cante-Barrett K, Crabtree GR. Lymphocyte calcium signaling from membrane to nucleus. Nat Immunol 2006;7(1):25–32. [7] Hanley PJ, Musset B, Renigunta V, Limberg SH, Dalpke AH, Sus R, et al. Extracellular ATP induces oscillations of intracellular Ca2+ and membrane potential and promotes transcription of IL-6 in macrophages. Proc Natl Acad Sci USA 2004;101(25):9479–84. [8] Kaufmann A, Musset B, Limberg SH, Renigunta V, Sus R, Dalpke AH, et al. “Host tissue damage” signal ATP promotes non-directional migration and negatively regulates toll-like receptor signaling in human monocytes. J Biol Chem 2005;280(37):32459–67. [9] Marteau F, Communi D, Boeynaems JM, Suarez GN. Involvement of multiple P2Y receptors and signaling pathways in the action of adenine nucleotides diphosphates on human monocyte-derived dendritic cells. J Leukoc Biol 2004;76(4):796–803. [10] Gever J, Cockayne D, Dillon M, Burnstock G, Ford A. Pharmacology of P2X channels. Pfl¨ugers Archiv Eur J Physiol 2006;452(5):513–37. [11] Steinberg TH, Silverstein SC. Extracellular ATP4− promotes cation fluxes in the J774 mouse macrophage cell line. J Biol Chem 1987;262(7):3118–22. [12] Pelegrin P, Surprenant A. Pannexin-1 mediates large pore formation and interleukin-1beta release by the ATP-gated P2X7 receptor. EMBO J 2006;25(21):5071–82. [13] Pelegrin P, Surprenant A. Pannexin-1 couples to maitotoxin- and nigericininduced interleukin-1beta release through a dye uptake-independent pathway. J Biol Chem 2007;282(4):2386–94. [14] North RA. Molecular physiology of P2X receptors. Physiol Rev 2002;82(4):1013–67. [15] Greenberg S, Di Virgilio F, Steinberg TH, Silverstein SC. Extracellular nucleotides mediate Ca2+ fluxes in J774 macrophages by two distinct mechanisms. J Biol Chem 1988;263(21):10337–43. [16] Chen BC, Lin WW. Pyrimidinoceptor potentiation of macrophage PGE2 release involved in the induction of nitric oxide synthase. Br J Pharmacol 2000;130(4):777–86. [17] Tsuda M, Shigemoto-Mogami Y, Koizumi S, Mizokoshi A, Kohsaka S, Salter MW, et al. P2X4 receptors induced in spinal microglia gate tactile allodynia after nerve injury. Nature 2003;424(6950):778–83. [18] Guo LH, Trautmann K, Schluesener HJ. Expression of P2X4 receptor by lesional activated microglia during formalin-induced inflammatory pain. J Neuroimmunol 2005;163(1/2):120–7. [19] Zhang Z, Artelt M, Burnet M, Trautmann K, Schluesener HJ. Early infiltration of CD8+ macrophages/microglia to lesions of rat traumatic brain injury. Neuroscience 2006;141(2):637–44. [20] Beiter T, Artelt MR, Trautmann K, Schluesener HJ. Experimental autoimmune neuritis induces differential microglia activation in the rat spinal cord. J Neuroimmunol 2005;160(1/2):25–31. [21] Bowler JW, Jayne Bailey R, Alan North R, Surprenant A. P2X4 , P2Y1 and P2Y2 receptors on rat alveolar macrophages. Br J Pharmacol 2003;140(3):567–75.

89

[22] Coutinho-Silva R, Stahl L, Cheung KK, de Campos NE, de Oliveira SC, Ojcius DM, et al. P2X and P2Y purinergic receptors on human intestinal epithelial carcinoma cells: effects of extracellular nucleotides on apoptosis and cell proliferation. Am J Physiol Gastrointest Liver Physiol 2005;288(5):G1024–35. [23] Berchtold S, Ogilvie AL, Bogdan C, Muhl-Zurbes P, Ogilvie A, Schuler G, et al. Human monocyte derived dendritic cells express functional P2X and P2Y receptors as well as ecto-nucleotidases. FEBS Lett 1999;458(3):424–8. [24] Moore SF, Mackenzie AB. Murine macrophage P2X7 receptors support rapid prothrombotic responses. Cell Signal 2007;19(4):855–66. [25] del Rey A, Renigunta V, Dalpke AH, Leipziger J, Matos JE, Robaye B, et al. Knock-out mice reveal the contributions of P2Y and P2X receptors to nucleotide-induced Ca2+ signaling in macrophages. J Biol Chem 2006;281(46):35147–55. [26] Hodge-Dufour J, Noble PW, Horton MR, Bao C, Wysoka M, Burdick MD, et al. Induction of IL-12 and chemokines by hyaluronan requires adhesiondependent priming of resident but not elicited macrophages. J Immunol 1997;159(5):2492–500. [27] Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 1981;391(2):85– 100. [28] Marrannes R, De Prins E. Computer programs to facilitate the estimation of time-dependent drug effects on ion channels. Comput Methods Programs Biomed 2004;74(2):167–81. [29] Honore P, Donnelly-Roberts D, Namovic MT, Hsieh G, Zhu CZ, Mikusa JP, et al. A-740003 [N-(1-{[(cyanoimino)(5-quinolinylamino)methyl]amino}2,2-dimethylpropyl)-2-(3,4-dimethoxyphenyl)acetamide], a novel and selective P2X7 receptor antagonist, dose-dependently reduces neuropathic pain in the rat. J Pharmacol Exp Ther 2006;319(3):1376–85. [30] Jacobson KA, Jarvis MF, Williams M. Purine and pyrimidine (P2) receptors as drug targets. J Med Chem 2002;45(19):4057–93. [31] Fortes FS, Pecora IL, Persechini PM, Hurtado S, Costa V, Coutinho-Silva R, et al. Modulation of intercellular communication in macrophages: possible interactions between GAP junctions and P2 receptors. J Cell Sci 2004;117(Pt 20):4717–26. [32] Kim M, Jiang LH, Wilson HL, North RA, Surprenant A. Proteomic and functional evidence for a P2X7 receptor signalling complex. EMBO J 2001;20(22):6347–58. [33] Xiong K, Peoples RW, Montgomery JP, Chiang Y, Stewart RR, Weight FF, et al. Differential modulation by copper and zinc of P2X2 and P2X4 receptor function. J Neurophysiol 1999;81(5):2088–94. [34] Coddou C, Lorca RA, Acuna-Castillo C, Grauso M, Rassendren F, Huidobro-Toro JP. Heavy metals modulate the activity of the purinergic P2X4 receptor. Toxicol Appl Pharmacol 2005;202(2):121–31. [35] Coddou C, Morales B, Huidobro-Toro JP. Neuromodulator role of zinc and copper during prolonged ATP applications to P2X4 purinoceptors. Eur J Pharmacol 2003;472(1/2):49–56. [36] Priel A, Silberberg SD. Mechanism of ivermectin facilitation of human P2X4 receptor channels. J Gen Physiol 2004;123(3):281–93. [37] Le KT, Babinski K, Seguela P. Central P2X4 and P2X6 channel subunits coassemble into a novel heteromeric ATP receptor. J Neurosci 1998;18(18):7152–9. [38] Soto F, Garcia-Guzman M, Karschin C, Stuhmer W. Cloning and tissue distribution of a novel P2X receptor from rat brain. Biochem Biophys Res Commun 1996;223(2):456–60. [39] Mackenzie A, Wilson HL, Kiss-Toth E, Dower SK, North RA, Surprenant A. Rapid secretion of interleukin-1beta by microvesicle shedding. Immunity 2001;15(5):825–35. [40] Sim JA, Chaumont S, Jo J, Ulmann L, Young MT, Cho K, et al. Altered hippocampal synaptic potentiation in P2X4 knock-out mice. J Neurosci 2006;26(35):9006–9. [41] Yamamoto K, Sokabe T, Matsumoto T, Yoshimura K, Shibata M, Ohura N, et al. Impaired flow-dependent control of vascular tone and remodeling in P2X4 -deficient mice. Nat Med 2006;12(1):133–7.