γ-Polyglutamic acid (γ-PGA) produced by Bacillus amyloliquefaciens C06 promoting its colonization on fruit surface

International Journal of Food Microbiology 142 (2010) 190–197

Contents lists available at ScienceDirect

International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o

γ-Polyglutamic acid (γ-PGA) produced by Bacillus amyloliquefaciens C06 promoting its colonization on fruit surface Jun Liu a,b, Dan He a, Xiu-zhen Li b, Shengfeng Gao a, Huijun Wu a, Wenzhe Liu b, Xuewen Gao a,⁎, Ting Zhou b,⁎ a

Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agriculture, Nanjing 210095, People's Republic of China Guelph Food Research Centre, Agriculture and Agri-Food Canada, 93 Stone Road West, Guelph, Ontario, Canada N1G 5C9

b

a r t i c l e

i n f o

Article history: Received 17 April 2010 Received in revised form 17 June 2010 Accepted 26 June 2010 Keywords: Bacillus amyloliquefaciens C06 γ-Polyglutamic acid (PGA) Surface colonization Biofilm Surface adhesion Swarming motility

a b s t r a c t Bacillus amyloliquefaciens C06, an effective biological agent in controlling brown rot of stone fruit caused by Monilinia fructicola, was also found to produce extra-cellular mucilage and form mucoid colonies on semisolid surfaces. This study aimed to characterize the extra-cellular mucilage produced by B. amyloliquefaciens C06 using transposon mutagenesis and biochemical and physical analyses. The mucilage production in B. amyloliquefaciens C06 was demonstrated to be associated with ywsC gene expression and characterized to be of high molecular weight, consisted of only glutamic acid and linked with non-peptide bonds, thus identified as γ-polyglutamic acid (γ-PGA). Compared with wild type B. amyloliquefaciens C06, its mutants deficient in producing γ-PGA, e.g. M106 and C06ΔywsC showed less efficiency in biofilm formation, surface adhesion and swarming ability. It was also demonstrated that γ-PGA was not essential for C06 to form colony on semi-solid surfaces, but was able to improve its colony structure. In vivo evaluation showed that disruption of γ-PGA production in C06ΔywsC impaired its efficiency of colonizing apple surfaces. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Colonizing plant surface effectively and maintaining a mass of cells sufficiently have been demonstrated to be prerequisites for plant growth promotion rhizobacteria (PGPR) to initiate beneficial interactions with host plants (Chin-A-Woeng et al., 2000). Several unique properties of wild type Bacillus strains have been evolved to accommodate themselves to the environments. (1) Bacillus strains have the ability to attach to solid–liquid interfaces, which was found to be associated with the surface characteristics of Bacillus strains (Dwyer et al., 2004; Husmark and Ronner, 1990; Peng et al., 2001) and was considered to be the key factor of successfully colonizing the fruit and plant root surfaces. (2) Wild type Bacillus strains are able to transfer themselves from one niche to another by swarming and swimming motilities, to gain more surviving opportunities (Kearns and Losick, 2003). (3) Wild type Bacillus strains could form sessile, multi-cellular communities named biofilms or pellicles to fight against the adverse environments and the highly organized structures were bonded together by the extra-cellular matrix including polysaccharides, proteins, and nucleic acids.

⁎ Corresponding authors. Gao is to be contacted at Tel./fax: + 86 25 84395268. Zhou, Tel.: + 1 519 780 8036; fax: + 1 519 829 2600. E-mail addresses: [email protected] (X. Gao), [email protected] (T. Zhou). 0168-1605/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2010.06.023

Bacillus amyloliquefaciens C06, isolated from a mesophilic cheese starter, showed potential application in biological preservation of post-harvest fruit (Zhou et al., 2008). When applied with either bacterial cells or cell-free filtrate, strain C06 effectively controlled brown rot in peach caused by Monilinia fructicola. In the present work, the strain C06 was also found to be able to produce extra-cellular mucilage and form mucoid colony on semi-solid surfaces. The mucoid property involved in increasing activity in biofilm formation on mycorrhizal and nonmycorrhizal carrot roots (Bianciotto et al., 2001), and the abilities of Bacillus strains e.g. surface adhesion, swarming motilities are influenced by their extra-cellular compound composition as well. Thus, we assumed that the mucilage produced by C06, modifying the composition of its extra-cellular substances, may consequently improve the efficiency of C06 colonizing fruit surface. In this study, to characterize the mucilage produced by C06, a transposon mutagenesis library of B. amyloliquefaciens C06 was constructed and ywsC was found to be responsible for the mucilage synthesis. Biochemical and physical analyses demonstrated that the mucilage production in B. amyloliquefaciens C06 was associated with ywsC gene expression and the mucilage was of high molecular weight, consisted of only glutamic acid and linked with non-peptide linkages, thus confirmed to be γ-polyglutamic acid (γ-PGA). Disruption of γ-PGA production in B. amyloliquefaciens C06 impaired its abilities to form biofilms, adhere to air–liquid surface and transfer by swarming motility. In vivo evaluation using apples showed disruption of γ-PGA production in M106 impaired its efficiency of colonizing apple surface.

J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190–197

2. Materials and methods

191

Table 2 Oligo DNA primers used in this study.

2.1. Bacterial strains, plasmids, and media The Bacillus and E. coli strains used in this study are described in Table 1. E. coli DH5α was used as the host for all plasmids. The various plasmids and strains constructed or used in this study are also described in Table 1. Luria–Bertani medium (LB) (Bertani, 1951) was used for the growth of E. coli and Bacillus strains. The pathogenic fungi were maintained on potato dextrose agar (PDA) (Hitchins et al., 1998) plates. Pellicle and biofilm formation ability was assessed on MSgg medium (Mascher et al., 2007). When required, antibiotics were added to the growth medium to the final concentrations: ampicillin at 100 μg/ml, kanamycin at 5 μg/ml and erythromycin at 10 μg/ml. 2.2. Transformation, DNA manipulation and transposon mutagenesis of B. amyloliquefaciens C06

Name

Sequencea (5′-3′)a

oIPCR1 oIPCR2 oIPCR3 ywsC′-pMar-1 ywsC′-pMar-2R ywsC-3 S epsA′-pMar-1 epsA′-pMar-2R epsA-3 S tasA′-pMar-1 tasA′-pMar-2R tasA-3 S sinI′-pMar-1 sinI′-pMar-2R sinI-3 S EM-pMar BOX-A1R

GCTTGTAAATTCTATCATAATTG AGGGAATCATTTGAAGGTTGG GCATTTAATACTAGCGACGCC GGGGTACCGCAAGGGAAGCGTTATCAGGAA(Kpn I) AACTGCAGAAAGGCGGGCTACAAAACAGTCGG (Pst I) GTCAACCGTAACGAGGCTGA GGGGTACCAAACCGATTCAGAGATCATAACCAT(Kpn I) AACTGCAGAATACACAACCCCTAAAACAGGCAAGT(Pst I) TTCATAGACCGTGTCTGCTGA GGGGTACCCTGATGGCTTTGAATTTTACTGACT(Kpn I) AACTGCAGAATCGCATTGCCTTGGAACTTGTTTTG(Pst I) GAGAATTGAAGAGAAATCGC GGGGTACCATTTACGGTATGACTTCTGGCTG(Kpn I) AACTGCAGAATCACAATTAGATAAGGAATGGGT(Pst I) ATGAAAAATGCAAAAAATGGA GGTCTATTTCAATGGCAGTTACGA CTACGGCAAGGCGACGCTGACTGA

a

The isolation and manipulation of recombinant DNA were performed using standard techniques. E. coli and B. amyloliquefaciens were transformed as described by Sambrook et al. (Sambrook and Russell, 2001) and Spizizen (Spizizen, 1958), respectively. Transposon mutagenesis library was constructed using pMarA and pMarC, and southern blot was used to analyze the insertion copies of pMarA plasmids into the selected transposon mutants of C06 as described previously (Le Breton et al., 2006). All enzymes used in this study were purchased from TaKaRa Bio Inc. (Dalian, China). The specific primers used for the PCR are listed in Table 2. 2.3. Generation of B. amyloliquefaciens C06 mutants Take the procedure of constructing C06ΔywsC as an example. To construct plasmid pMar-ywsC′ used for disrupting ywsC operon in B. amyloliquefaciens C06, a 390 bp DNA fragment of ywsC gene was amplified by using ywsC′-pMar primers incorporated kpn I and pst I endonuclease target sequences respectively. The amplified fragment was cloned into pMarC in place of TnYLB-1. pMar-ywsC′ was transformed into C06 and plated on LB agar with erythromycin (10 μg/ml). Individual colonies were picked and grown overnight in LB medium at 37 °C, and then portions of each culture were plated on LB plus 10 μg/ml

Restriction sites in primers are underlined.

erythromycin and incubated at 50 °C overnight. Selected colonies were subjected to PCR test by using the ywsC′-pMar-3 S and EM-pMar to confirm the insertion of pMar-ywsC′ into C06 chromosomal. In the same way, C06ΔepsA, C06ΔtasA and C06ΔsinI were constructed.

2.4. Characterization of the extra-cellular mucilage produced by B. amyloliquefaciens C06 2.4.1. Molecular weight determination B. amyloliquefaciens C06, M106 and C06ΔywsC were inoculated into 35 ml medium E (Leonard et al., 1958) in 250 ml flask and aerobically incubated at 37 °C in a rotary shaker at 200 rpm for 48 h. The cell-free filtrates of B. amyloliquefaciens C06, M106 and C06ΔywsC were collected with 0.22 μm membrane filtration. The molecular mass of the mucilage were analyzed as described previously (Xu et al., 2005) by gel permeation chromatography (GPC) system, a Shodex 101 refractive-index with Shodex SB-806 M HQ HPSEC column. Two hundred millimolar Na2SO4 with pH adjusted to 4.0 with acetic acid was used as mobile phase at a flow rate of

Table 1 Bacterial strains and plasmids used in this study. Strain or plasmid

Relevant genotype or characteristicsa

Source or reference

Escherichia coli DH5α

F− Φ80dlacZ ΔM12 minirecA

Laboratory stock

B. amyloliquefaciens C06 C06-MA C06-MC M106 C06ΔywsC C06ΔepsA C06ΔtasA C06ΔsinI

Wild type C06 transformed with pMarA; Ermr, Kmr C06 transformed with pMarC; Ermr, Kmr Mutant of C06, ywsC::TnYLB-1; Kmr ywsC:: pMar-ywsC′; Ermr epsA:: pMar-epsA′; Ermr tasA:: pMar-tasA′; Ermr sinI:: pMar-sinI′; Ermr

Zhou et al. (2008) This study This study This study This study This study This study This study

Shuttle vector carrying TnYLB-1 transposon and mariner-Himar1 transpose; pUC replicon, thermosensitive replicon for gram-positive hosts; Kmr, Apr, Ermr Shuttle vector carrying TnYLB-1 transposon; pUC replicon, thermosensitive replicon for gram-positive hosts; Kmr, Apr, Ermr pMarC derivative carrying ywsC′ in place of TnYLB-1; Apr, Ermr pMarC derivative carrying epsA′ in place of TnYLB-1; Apr, Ermr pMarC derivative carrying tasA′ in place of TnYLB-1; Apr, Ermr pMarC derivative carrying sinI′ in place of TnYLB-1; Apr, Ermr

Le Breton et al. (2006)

Plasmids pMarA pMarC pMar-ywsC′ pMar-epsA′ pMar-tasA′ pMar-sinI′ a

Resistance marker: Apr, ampicillin resistance; Kmr, kanamycin resistance; Ermr, erythromycin.

Le Breton et al. (2006) This This This This

study study study study

192

J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190–197

1 ml/min. The column temperature was held at 35 °C. Dextrans (polysaccharides) standards (Shodex, Inc., U.S.A.) were used to construct a calibration curve, from which molecular weights of mucilage were calculated with no further correction. 2.4.2. UV scanning and amino acid analysis with paper chromatography Mucilage was separated by dialysis with molecular size of 300 KDa and the high molecular weight separation was collected and subjected to vacuum drying. To determine the absorption peak of the purified mucilage, 0.1 g/ml purified mucilage solution was then subjected to UV scanning with a Nanodrop ND-1000 UV–vis spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). To determine the amino acid composition of the mucilage, the purified mucilage was hydrolyzed with 6N HCl at 110 °C for 24 h in a sealed and evacuated tube and the amino acid compositions were determined by paper chromatography method as described previously (Waley, 1955). 2.5. In vitro evaluations of the effects of γ-PGA on biofilm formation, glass surface adhesion and swarming motility Three properties of Bacillus strains, surface adhesion, biofilm formation and swarming motility, were known to be involved in plant surface colonization and influenced by the bacterial extra-cellular compound compositions. These three properties of both B. amyloliquefaciens C06 and its mutants deficient in γ-PGA producing were tested. 2.5.1. Pellicle and colony formation assay For pellicle formation assay, bacteria strains were inoculated into a tube containing 2 ml LB liquid medium. The tubes were shaken at low speed (160 rpm) at 37 °C for 16 h, at which point 5 μl of each culture was used to inoculate 20 ml of MSgg in a beaker. These beakers were incubated without shaking at 37 °C, and after 3 and 5 days of incubation, their pellicles were analyzed by visual inspection respectively. 2.5.2. Glass surface adhesion assay The Bacillus vegetative cells for adhesion test were prepared as described previously (Ronner et al., 1990). Here, the glass surface was prepared for the interaction with Bacillus cells, for the smooth and negatively charged prosperities of its surface similar to the stone

fruit surface. Before each experiment, glasses were subjected to the following cleaning and disinfection protocol: 1, 15 min cleaning in 2% alkaline detergent RBS35 at 50 °C; 2, 5 min rinse with reverse osmosis water; 3, 20 min autoclaving at 121 °C; and 4, glass chips dried at 50 °C overnight. For the adhesion study, 5 ml Bacillus cell suspension with final concentration of 108 cfu/ml was added into 50 ml tubes containing 30 ml of PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4). The sterile glass chips were vertically placed inside these bottles. Adhesion was allowed to occur for 0.5, 1 and 1.5 h at 37 °C with shaking at 150 rpm. The chips were then removed with sterile forceps. To remove weakly adherent cells, chips were rinsed 3 times in 20 ml PBS for 1 min. After washing, each chip was transferred to a test tube containing 10 ml PBS; the attached bacterial cells were scraped from both sides of the chip surface with a 2×2 cm sterile Mira clot. The test tube along with the cut swab tip was stirred in a vortex mixer for 2 min to release the cells into the PBS and cells in PBS were then enumerated (Peng et al., 2001). Each experiment was performed at least twice and either two or three chips were used in each experiment. 2.5.3. Swarming motility assay The swarming expansion assay was performed according to published procedures (Kearns and Losick, 2003). Cells were grown to mid-log phase at 37 °C in LB broth and resuspended to the appropriate OD in PBS buffer. 0.3% and 0.7% minimal medium (MSgg) (Branda et al., 2001) agar was dried for 30 min in a laminar flow hood, centrally inoculated with 2 × 107 cells in 10 μl (standard conditions), dried for another 10 min and incubated at 37 °C. The morphology of swarming expansion was photographed at 6 h and 18 h respectively. Each experiment was performed at least twice and either two or three chips were used in each experiment. 2.6. In vivo assays of bacterial colonization on apple surface The apples were soaked in 10% household bleach (5% sodium hypochlorite) and 0.01% Tween 20 for 4 min and rinsed in reverse osmosis water for 4 min. Once the surface was dry, the disinfected apples were respectively immersed into culture suspensions of B. amyloliquefaciens C06-MA and C06ΔywsC with the final concentration of 1 × 107 cfu/ml and then placed on a plastic packing tray contained

Fig. 1. Colony morphology of B. amyloliquefaciens C06 and its mutants. Strains were grown in LB medium to mid-log phase with selection; 10 μl was spotted on MSgg plates (dried for 30 min in a laminar airflow) and incubated at 37 °C overnight without selection and then photographed. A, B. amyloliquefaciens C06; B, M106; C, C06ΔywsC; D, C06ΔepsA; E, C06ΔtasA; F, C06ΔsinI.

J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190–197

193

in a plastic box. The treated apples were incubated at 22 °C. After incubating for 1, 3 and 5 days, 1 cm2 apple skin was cut around equator of the apple and grinded with a motor. The grinded apple skin was suspended in 1 ml distilled water and vibrated for 1 min. The suspension (200 μl) was diluted to 10− 4, 10− 5 and 10− 6 and 100 μl diluted suspension was spread on LB agar plates with 10 μg/ml erythromycin respectively. After incubation at 37 °C overnight, the single colonies on the ager plates were counted. To confirm that the counted colonies were formed by C06 and its derivatives, 10 colonies from both treatment and control groups were randomly picked and subjected to BOX-PCR analysis using BOX-A1R primer (data not shown). Each experiment was repeated 3 times. 2.7. Statistical analysis The data were statistically analyzed using analysis of variance, followed by Fisher's least-significant-difference test (P = 0.05) using SPSS software (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Transposon mutagenesis screening Using kanamycin, 1000 TnYLB-1 transposon inserted mutants were selected after B. amyloliquefaciens C06 was transformed with transposon-carrying pMarA. Four of the mutants, designated M105, M106, M107 and M108 were found unable to form sticky colonies on LB plate and unable to secret mucoid substances in liquid medium under any conditions. Here, only M106 was presented in Fig. 1, for the colonies formed by the rest three mutants have the same morphologies as M106. Insertion copy analysis by Southern blot demonstrated that only M106 and M107 had single insertions (data not shown), so M106 and M107 were chosen for further investigation. To identify the insertion site of M106, inverse PCR was performed and a 758 bp DNA fragment was obtained. Sequence analysis revealed that this fragment had 98% homology with ywsC in B. amyloliquefaciens FZB42, a gene responsible for γ-polyglutamic acid synthesis in many Bacillus strains (Urushibata et al., 2002). 3.2. Characterization of the extra-cellular mucilage by chemical and physical analysis The cell-free filtrates of B. amyloliquefaciens C06 and its mutants deficient in producing the extra-cellular mucilage were analyzed with gel permeation chromatography. The chromatographic profiles of C06 showed a unique peak with the retention time from 11 to 18 min, which was not found in the profiles of M106 or C06ΔywsC (Fig. 2), thus the molecular weight of the extra-cellular mucilage from C06 was inferred to be 300–3000 KDa based on the calculation according to the retention time. The paper chromatography analysis revealed that the non-hydrolyzed mucilage solution didn't show any band by ninhydrin coloring, while only band of the hydrolyzed mucilage showed the same color and same drift mobility as band of the L-glutamic, indicating that the 6N HCl hydrolyzate of the purified extracellular mucilage was composed solely of glutamic acid (Fig. 3). Together with the result from UV scanning that the mucilage had an absorption peak at 227 nm (data not shown), the mucilage produced by B. amyloliquefaciens C06 was confirmed to be γ-poly glutamic acid (γ-PGA) (Birrer et al., 1994). 3.3. In vitro assessment of PGA's effects on surface colonization abilities of B. amyloliquefaciens C06 For biofilm formation, both C06 and M106 were able to form typical floating biofilms (pellicles) after incubation at 37 °C in MSgg medium for 3 days (Fig. 4A and B). However, the pellicle formed by C06 turned

Fig. 2. Gel permeation chromatography analysis of the mucilage from B. amyloliquefaciens C06. A. Chromatographic profiles of cell-free filtrates of B. amyloliquefaciens C06 and the mutants deficient in producing mucilage. 20 μl culture filtrates of B. amyloliquefaciens C06 and the mutants were analyzed gel permeation chromatography (GPC) system. Fifty millimolar NaCl aqueous solution–acetonitrile (4:1, v/v) was used as mobile phase at a flow rate of 0.7 ml/min.

to be more flexible and showed more resistance against shaking. On the fifth day of incubation, the structure of pellicle formed by M106 started to be dissolved and was easy to be broken up (Fig. 4D) while the one formed by C06 turned to be more stable and robust (Fig. 4C). Exopolysaccharides (EPS), TasA and γ-PGA are three major extracellular compounds known to be involved in biofilm formation in Bacillus strains. To determine their roles and correlations in colony formation on semi-solid surface, three mutants C06ΔepsA, C06ΔtasA and C06ΔsinI, deficient respectively in producing EPS, TasA and both, were constructed and their colony structures on semi-solid surfaces were evaluated together with B. amyloliquefaciens C06 and C06ΔywsC (Fig. 1A–F). The colonies formed by B. amyloliquefaciens C06 appeared to be the most structured and the colonies formed by C06ΔepsA, C06ΔtasA and C06ΔywsC were less structured than C06, while C06ΔsinI was unable to form structured colonies on semi-solid surface.

194

J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190–197

M106 more than 18 h to accomplish the coverage; and the colony formed by C06 extended in a non-branched way while M106 extended in a tendril way (Fig. 5). For surface adhesion, wild type B. amyloliquefaciens C06 also performed stronger adhesive activities than its mutant M106, and with the extension of adhesion period, the retrieved adhering cell numbers of both C06 and M106 increased steadily. The average numbers of adhering cells per cm2 for B. amyloliquefaciens C06 at 0.5, 1 and 1.5 h was 621, 2561 and 3107, respectively, and the average numbers for M106 were only 177, 729 and 1251, respectively (Fig. 6). 3.4. In vivo fruit surface colonization evaluation

Fig. 3. Paper chromatography analysis of the hydrolyzed mucilage. Lane 1, hydrolyzed mucilage solution; Lane 2, mucilage solution from B. amyloliquefaciens C06; Lane 3, L-glutamic acid solution.

The swarming motilities of C06 and M106 on MSgg medium with 0.3% and 0.7% agar were investigated. The expansion rate of M106 on 0.3% agar plate turned to be faster than on 0.7% agar plate, for after 18 h incubation, M306 covered nearly the whole surface of 0.3% agar plate while only 80% of surface of 0.7% agar plate. However, the expansion rate of wild type C06 showed no significant difference on 0.3% and 0.7% agar plates. C06 and M106 showed significant differences in both expansion rate and swarming patterns: the colony formed by C06 covered the whole surface of plate in 12 h while it took

Quantitative evaluation of bacterial adhesion to apple surface was investigated (Fig. 7). Average number of adherent cells after 1 day, 3 days and 5 days colonization on apple surface and standard deviations was shown in Fig. 7. B. amyloliquefaciens C06-MA was wild type C06 transformed with pMarA, which kept the ability of producing γ-PGA and was able to grow on LB agar plates with 10 μg/ ml erythromycin. As shown in Fig. 7, the difference between retrieved cell numbers of C06-MA and C06ΔywsC was significant. On the first day, the gap between numbers of bacterial cells from C06-MA (3 × 105 /cm2) and C06ΔywsC (8 × 104 /cm2) was nearly 4 times (P = 0.001). When the incubation time extended to 3 days, the average numbers of adherent cells of both C06-MA and C06ΔywsC decreased 2.6–2.8 times, to 1.1 × 105 and 2.8 × 104 /cm2 (P = 0.001), respectively. With prolonged incubation, the average adherent cells numbers increased to 2.3 × 105 /cm2 for C06-MA and to 7.2 × 104 /cm2 for C06ΔywsC (P = 0.002) on the fifth day, respectively. 4. Discussion B. amyloliquefaciens C06, isolated from cheese starter, showed significant control effect on peach brown rot caused by M. fructicola. The bacterial strain C06 was found to form highly structured colonies

Fig. 4. Pellicle morphology of B. amyloliquefaciens C06 and M106. 20 ml of liquid MSgg medium was inoculate with 50 μl of mid-log phase culture and incubated at 37 °C for 5 days. The morphology of biofilm was photographed against black ground. A1 and A2 were glasses inoculated with M106; B1 and B2 were glasses inoculated with B. amyloliquefaciens C06. A1 and B1 were photographed after incubating for 3 days and A2 and B2 were photographed after incubating for 5 days.

J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190–197

195

Fig. 5. Swarming motility test of B. amyloliquefaciens C06 and M106. C06 and M106 were centrally inoculated on MSgg medium with 0.3% and 0.7% agar. The plates were photographed against black ground at 6 and 18 h. A1 and B1 were 0.3% agar pates inoculated with M106; C1 and D1 were 0.7% agar plates inoculated with M106. A2 and B2 were 0.3% agar pates inoculated with B. amyloliquefaciens C06; C2 and D2 were 0.7% agar plates inoculated with B. amyloliquefaciens C06. A1, A2, C1 and C2 were photographed after incubation for 6 h, and B1, B2, D1 and D2 were photographed after incubation for 18 h.

on MSgg agar medium that were strikingly mucoid in their center (Fig. 1). In the present work, transposon mutagenesis library of C06 was constructed and ywsC gene was identified to be involved in synthesizing the extra-cellular mucilage. YwsC has been demonstrated to be involved in released γ-PGA production in many other Bacillus spp. strains (Candela and Fouet, 2006; Urushibata et al., 2002). Gel permeation chromatography analysis showed that the molecular weight of the mucilage of C06 was from 300 to 3000 KDa (Fig. 2), and the extra-cellular mucilage produced by B. amyloliquefaciens C06 was purified according to its molecular weight. UV scanning indicated that the purified mucilage did not contain significant amounts of protein or nucleic acid, as evidenced by the lack of absorbance at 280 and 254 nm. When the sample was processed according to previous paper chromatography method for determining glutamic acid (Waley, 1955), a single band was observed at the position corresponding to that of glutamic acid (Fig. 3). Taking the fact that γ-PGA is a polyanionic polymer that may consist of only D, only L or both glutamate enantiomers polymerized through amide linkage between α-amino and γ-carboxylic acid groups (Birrer et al., 1994; Shih and Van, 2001), the mucilage was confirmed to be γ-PGA. The process of a planktonic Bacillus cell attaching to fruit surface and forming stable biofilm was considered to be the precondition of exerting its biological functions. The colonization process of biological control Bacillus strains applied to fruit surface usually consists of three steps (Lemon et al., 2008): 1, Bacillus motile cells attach to the fruit surfaces by cell–surface interactions; 2, Bacillus cells transformed from motile cells to non-motile cells and started to form microcolonies; and 3, Bacillus cells expand in the form of colonies majorly depending on swarming motility. Here, we demonstrated that γ-PGA

could improve the abilities of Bacillus cells to attach smooth surface, form biofilm and colony and to swarm on semi-solid surface in vitro and enhance the apple surface colonization efficiency in vivo. In vitro, motile cells of wild type B. amyloliquefaciens C06 showed stronger ability to attach to glass surface than C06ΔywsC (Fig. 6). In vivo, C06-MA also performed more effectively than C06ΔywsC in apple surface attachment (Fig. 7), particularly on the first day of evaluation when most attached Bacillus cells were in form of motile cells (Branda et al., 2001). To rule out the possible influence of growth rate on the abilities of Bacillus strains adhering to the solid surfaces, two steps were carried out: 1, the growth rate curves of both wild type C06 and its mutant were measured and no significant differences were found between wild type and mutant strains; 2, before the Bacillus strains were treated, their growth stages were unified by measuring their OD values. It proved that increasing mucous activity of Bacillus surface could enhance surface adhesion of motile Bacillus cell. γ-PGA is a large, extra-cellular, anionic polymer and covered with a large quantity of cations, while in nature most of the surfaces including stone fruit surface, and glass surface are negatively charged. In this case, salt ions like Mg2+ or Ca2+ could act as an intermediary between two negatively charged surfaces (Mayer et al., 1999) and thus the salt-bridges may form between the negatively charged γ-PGA and the abiotic surface and again between γ-PGA and the cell surface, which consequently contributes to cell–surface interaction. Polysaccharides and TasA protein were characterized as two major extra-cellular matrixes contributing to the mechanical stability of the biofilm (Branda et al., 2005). γ-PGA was also found to be important during the biofilm process. The domestic B. subtilis 168 was converted from a non-biofilm producer to a biofilm producer by transferring the genetic determinants controlling γ-PGA formation from a wild strain

Fig. 6. Glass surface adhesion evaluation. Average numbers of adherent cells of B. amyloliquefaciens C06 and M106 after adhesion test are reported. The bar represents standard deviation of the mean. Different letters indicate significant differences between treatments according to LSD at P = 0.05.

Fig. 7. Fruit surface colonization evaluation. Average numbers and standard deviations of adherent cells of B. amyloliquefaciens C06-MA and C06ΔywsC on per cm2 of apple surface after incubated for 1 day, 3 days and 5 days are reported. Different letters indicate significant differences between treatments according to LSD at P = 0.05.

196

J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190–197

(Stanley and Lazazzera, 2005). However, deletion of ywsC, a gene encoding γ-PGA synthesis, in the wild B. subtilis RO-FF-1 did not lead to a marked decrease in surface-associated biofilm formation (Stanley and Lazazzera, 2005). To investigate the roles and correlations of three extra-cellular compounds in biofilm production, three mutants C06ΔepsA, C06ΔtasA and C06ΔsinI were constructed and evaluated for their colony structures on semi-solid surfaces together with the wild type B. amyloliquefaciens C06 and C06ΔywsC. The colonies formed by B. amyloliquefaciens C06 was highly delicate in structure while the colonies formed by the mutants were much less structured, especially the colony formed by C06ΔsinI, the mutant unable to produce EPS and TasA (Kearns et al., 2005), showed no structure at all (Fig. 1), inferring that γ-PGA could promote to form structured colony but was not essential in the process of colony formation. Swarming is a type of social motility, characterized by the rapid and coordinated migration of highly differentiated swarm cells on semi-solid surfaces (Fraser and Hughes, 1999; Harshey, 1994; Sharma and Anand, 2002). Swarming migration is preceded by a profound modification of cell morphology, where short planktonic cells differentiate into elongated and multi-flagellated swarm cells (Harshey, 2003). The swarming of Bacillus strains has been reported to be influenced by several elements, such as the presence of flagella (Ohgiwari et al., 1992; Senesi et al., 2004), the production of the lipopeptide surfactin and mycosubtilin (Julkowska et al., 2005; Kinsinger et al., 2003; Leclere et al., 2006), extra-cellular proteolytic activity (Connelly et al., 2004; Gupta and Rao, 2009) and extra-cellular potassium ion (Kinsinger et al., 2003). It was also identified that both swarming motility and γ-PGA synthesis were under the regulation of SwrAA (Osera et al., 2009). However, the role of γ-PGA in swarming motility was not investigated yet. In this study, γ-PGA was found to promote the swarming motility of B. amyloliquefaciens C06, not only enhancing the spreading rate, but also converting its swarming pattern from a successive dendritic way to nondendritic warming pattern (Fig. 5). In this case, γ-PGA might improve the swarming motility of B. amyloliquefaciens C06 in three ways: 1, the released extracellular γ-PGA presumably changed the physical characteristics of the surface terrain by absorbing water; 2, the mucous properties of γ-PGA helped Bacillus cells aggregated into a highly coordinated manner; and 3, γ-PGA may also help the Bacillus cells absorb nutrients critical for swarming motility from the environments e.g. potassium ion. The improved abilities of biofilm formation and swarming motilities may also explain why C06-MA showed stronger ability of apple surface colonization than C06ΔywsC on the third and fifth day. When nutrients availability from fruit surface turned to be harder than from the medium, the attached bacterial cells on fruit surface started to form biofilms (Branda et al., 2001; Stanley and Lazazzera, 2005) and extended their colonies mainly relying on swarming motility (Harshey, 2003). However, retrieved cell numbers of both C06-MA and C06ΔywsC decreased 2–3 times on the third day compared to the first day, probably as a result of natural selection of the adverse environment, and after the selection, the remaining cells started to expand by forming colonies and swarming motility, resulting in the increased adherent cell numbers on the fifth day. γ-PGA could enhance the colonization abilities of Bacillus cells from biofilm formation, surface adhesion and swarming motilities, implying that converting a non γ-PGA producing Bacillus strain into a γ-PGA producer can be a potential way to improve the biological control effectiveness of Bacillus strains with enhanced surface colonization abilities. Acknowledgements This research is funded by Agriculture and Agri-food Canada and also supported by grants from the National Natural Science Fund of China (30570041), the National 863 Program of China (2006AA10Z172), the Program of International Science and Technol-

ogy Cooperation (2009DFA32740), the Special Nonprofit Scientific Research Program, PR China (3-23), and the National Transgenic Major Program (2009ZX08009-055B). J. Liu received a graduate scholarship from the China Scholarship Council.

References Bertani, G., 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. Journal of Bacteriology 62, 293–300. Bianciotto, V., Andreotti, S., Balestrini, R., Bonfante, P., Perotto, S., 2001. Mucoid mutants of the biocontrol strain Pseudomonas fluorescens CHA0 show increased ability in biofilm formation on mycorrhizal and nonmycorrhizal carrot roots. Molecular Plant–Microbe Interactions 14, 255–260. Birrer, G.A., Cromwick, A.M., Gross, R.A., 1994. γ-Poly (glutamic acid) formation by Bacillus licheniformis 9945a: physiological and biochemical studies. International Journal of Biological Macromolecules 16, 265–275. Branda, S.S., Gonzalez-Pastor, J.E., Ben-Yehuda, S., Losick, R., Kolter, R., 2001. Fruiting body formation by Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America 98, 11621–11626. Branda, S.S., Vik, S., Friedman, L., Kolter, R., 2005. Biofilms: the matrix revisited. Trends in Microbiology 13, 20–26. Candela, T., Fouet, A., 2006. Poly-gamma-glutamate in bacteria. Molecular Microbiology 60, 1091–1098. Chin-A-Woeng, T., Bloemberg, G., Mulders, I., Dekkers, L., Lugtenberg, B., 2000. Root colonization by phenazine-1-carboxamide-producing bacterium Pseudomonas chlororaphis PCL1391 is essential for biocontrol of tomato foot and root rot. Molecular Plant–Microbe Interactions 13, 1340–1345. Connelly, M.B., Young, G.M., Sloma, A., 2004. Extracellular proteolytic activity plays a central role in swarming motility in Bacillus subtilis. Journal of Bacteriology 186, 4159–4167. Dwyer, K.G., Lamonica, J.M., Schumacher, J.A., Williams, L.E., Bishara, J., Lewandowski, A., Redkar, R., Patra, G., DelVecchio, V.G., 2004. Identification of Bacillus anthracis specific chromosomal sequences by suppressive subtractive hybridization. BMC Genomics 5, 15. Fraser, G.M., Hughes, C., 1999. Swarming motility. Current Opinion in Microbiology 2, 630–635. Gupta, M., Rao, K.K., 2009. Epr plays a key role in DegU-mediated swarming motility of Bacillus subtilis. FEMS Microbiology Letters 295, 187–194. Harshey, R.M., 1994. Bees aren't the only ones: swarming in gram-negative bacteria. Molecular Microbiology 13, 389–394. Harshey, R.M., 2003. Bacterial motility on a surface: many ways to a common goal. Annual Review of Microbiology 57, 249–273. Hitchins, A., Feng, P., Watkins, W., Rippey, S., Amaguana, L., 1998. Bacteriological Analytical Manual8th Edition. Food and Drug Administration, Washington, DC. Husmark, U., Ronner, U., 1990. Forces involved in adhesion of Bacillus cereus spores to solid surfaces under different environmental conditions. Journal of Applied Microbiology 69, 557–562. Julkowska, D., Obuchowski, M., Holland, I.B., Seror, S.J., 2005. Comparative analysis of the development of swarming communities of Bacillus subtilis 168 and a natural wild type: critical effects of surfactin and the composition of the medium. Journal of Bacteriology 187, 65–76. Kearns, D.B., Losick, R., 2003. Swarming motility in undomesticated Bacillus subtilis. Molecular Microbiology 49, 581–590. Kearns, D.B., Chu, F., Branda, S.S., Kolter, R., Losick, R., 2005. A master regulator for biofilm formation by Bacillus subtilis. Molecular Microbiology 55, 739–749. Kinsinger, R.F., Shirk, M.C., Fall, R., 2003. Rapid surface motility in Bacillus subtilis is dependent on extracellular surfactin and potassium ion. Journal of Bacteriology 185, 5627–5631. Le Breton, Y., Mohapatra, N.P., Haldenwang, W.G., 2006. In vivo random mutagenesis of Bacillus subtilis by use of TnYLB-1, a mariner-based transposon. Applied and Environmental Microbiology 72, 327–333. Leclere, V., Marti, R., Bechet, M., Fickers, P., Jacques, P., 2006. The lipopeptides mycosubtilin and surfactin enhance spreading of Bacillus subtilis strains by their surface-active properties. Archives of Microbiology 186, 475–483. Lemon, K.P., Earl, A.M., Vlamakis, H.C., Aguilar, C., Kolter, R., 2008. Biofilm development with an emphasis on Bacillus subtilis. Current Topics in Microbiology and Immunology 322, 1–16. Leonard, C.G., Housewright, R.D., Thorne, C.B., 1958. Effects of some metallic ions on glutamyl polypeptide synthesis by Bacillus subtilis. Journal of Bacteriology 76, 499–503. Mascher, T., Hachmann, A.B., Helmann, J.D., 2007. Regulatory overlap and functional redundancy among Bacillus subtilis extracytoplasmic function (ECF) σ-factors. Journal of Bacteriology 189, 6919–6927. Mayer, C., Moritz, R., Kirschner, C., Borchard, W., Maibaum, R., Wingender, J., Flemming, H.C., 1999. The role of intermolecular interactions: studies on model systems for bacterial biofilms. International Journal of Biological Macromolecules 26, 3–16. Ohgiwari, M., Matsushita, M., Matsuyama, T., 1992. Morphological changes in growth phenomena of bacterial colony patterns. Journal of the Physics Society Japan 61, 816–822. Osera, C., Amati, G., Calvio, C., Galizzi, A., 2009. SwrAA activates poly-γ-glutamate synthesis in addition to swarming in Bacillus subtilis. Microbiology 155, 2282–2287. Peng, J.S., Tsai, W.C., Chou, C.C., 2001. Surface characteristics of Bacillus cereus and its adhesion to stainless steel. International Journal of Food Microbiology 65, 105–111.

J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190–197 Ronner, U., Husmark, U., Henriksson, A., 1990. Adhesion of Bacillus spores in relation to hydrophobicity. Journal of Applied Microbiology 69, 550–556. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Senesi, S., Ghelardi, E., Celandroni, F., Salvetti, S., Parisio, E., Galizzi, A., 2004. Surfaceassociated flagellum formation and swarming differentiation in Bacillus subtilis are controlled by the ifm locus. Journal of Bacteriology 186, 1158–1164. Sharma, M., Anand, S., 2002. Swarming: a coordinated bacterial activity. Current Science 83, 707–715. Shih, I.L., Van, Y.T., 2001. The production of poly-(γ-glutamic acid) from microorganisms and its various applications. Bioresource Technology 79, 207–225. Spizizen, J., 1958. Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proceedings of the National Academy of Sciences of the United States of America 44, 1072–1078.

197

Stanley, N.R., Lazazzera, B.A., 2005. Defining the genetic differences between wild and domestic strains of Bacillus subtilis that affect poly-gamma-DL-glutamic acid production and biofilm formation. Molecular Microbiology 57, 1143–1158. Urushibata, Y., Tokuyama, S., Tahara, Y., 2002. Characterization of the Bacillus subtilis ywsC gene, involved in γ-polyglutamic acid production. Journal of Bacteriology 184, 337–343. Waley, S., 1955. The structure of bacterial polyglutamic acid. Journal of the Chemical Society 1955, 517–522. Xu, H., Jiang, M., Li, H., Lu, D., Ouyang, P., 2005. Efficient production of poly (γ-glutamic acid) by newly isolated Bacillus subtilis NX-2. Process Biochemistry 40, 519–523. Zhou, T., Schneider, K.E., Li, X.Z., 2008. Development of biocontrol agents from food microbial isolates for controlling post-harvest peach brown rot caused by Monilinia fructicola. International Journal of Food Microbiology 126, 180–185.