- Email: [email protected]
[16] Analyzing protein-protein interactions using two-hybrid system
[161
TWO-HYBRIDSYSTEM
[16]
Analyzing Protein-Protein Interactions Two-Hybrid System
241
Using
By PAUL L. BARTEL and STANLEY FIELDS Introduction Protein-protein interactions play a critical role in most biological processes. For example, the identification of interactions between viral oncoproteins and cellular tumor suppressor proteins, between components of signal transduction pathways, and between proteins involved in the regulation of the cell cycle has greatly increased our understanding of cellular function. In addition, studies defining domains of proteins [e.g., SH2 and SH3 domains, retinoblastoma (Rb) pocket] that are responsible for specific interactions have contributed significantly to unraveling the mechanisms of tumorigenesis. The two-hybrid system is a yeast-based genetic assay for detecting protein-protein interactions in vivo. It can be used to establish interactions between two known proteins or to search genomic or cDNA libraries for proteins that interact with a target protein. For this latter application, the gene encoding the protein that interacts with a target protein is immediately available on a plasmid, which is not the case for many biochemical methods to detect interacting proteins. The two-hybrid system has also been used to define the protein domains that mediate an interaction and to identify specific residues that are involved in a protein-protein interaction. We will briefly discuss the basis for this method and then present the protocols that are necessary to use this system. Principle of Method The two-hybrid system 1,2 exploits the two domain nature of many sitespecific eukaryotic transcription factors to detect interactions between two different hybrid proteins. These factors consist of a site-specific DNAbinding domain which is distinct from a domain that is responsible for transcriptional activation. 3,4 Two key results in the development of this t S. Fields a n d O.-K. Song, Nature (London) 340, 245 (1989). 2 C.-T. C h i e n , P. L. B a r t e l , R. Sternglanz, a n d S. Fields, Proc. NatL Acad. Sci. U.S.A. 88, 9578 (1991). 3 L. K e e g a n , G. Gill, a n d M. P t a s h n e , Science 231, 699 (1986). 4 I. A. H o p e a n d K. Struhl, Cell (Cambridge, Mass.) 46, 885 (1986).
METHODS IN ENZYMOLOGY. VOU 254
Copyright © 1995 by Academic Press. lnc. All rights of reproduction in any form reserved.
242
MOLECULARCLONES
[ 161
A Protein ] DNA-bindi domain rromoter
B
Reporter gene
~Activation Protein Y ~ domain
Promoter
I
Reporter gene
C
vromoter
Heporter gene
Fio. 1. The two-hybrid system. (A) A hybrid consisting of a DNA-binding domain fused to a protein X is unable to activate transcription of a reporter gene because it lacks a transcriptional activation domain. (B) A hybrid consisting of an activation domain fused to a protein Y fails to localize to the reporter gene. (C) If both hybrids are expressed in the same cell and proteins X and Y interact, the activation domain is anchored to the binding site and the reporter gene is expressed.
system were the demonstration that a hybrid protein containing domains from two different transcription factors can activate transcription 5 and the demonstration that the two domains need not be covalently attached to each other to function. 6'7 In the two-hybrid system, two fusion proteins must be generated. One is a fusion between the DNA-binding domain of a transcription factor and a test protein "X." The other is a fusion between the activation domain of a transcription factor and a test protein "Y." Plasmids encoding these fusions are introduced together into a yeast strain that contains one or more reporter genes with upstream binding sites for the DNA-binding domain present in the first hybrid. As illustrated in Fig. 1, the expression of either the hybrid of the DNA-binding domain with protein X or the hybrid of the activation domain with protein Y fails to 5 R. Brent and M. Ptashne, Cell (Cambridge, Mass.) 43, 729 (1985). J. Ma and M. Ptashne, Cell (Cambridge, Mass.) 55, 443 (1988). 7 j. McKnight, T. Kristie, and B. Roizman, Proc. Natl. Acad. Sci. U.S.A. 84, 7061 (1987).
[ 16]
TWO-HYBRIDSYSTEM
243
activate transcription of a reporter gene. However, if protein X and protein Y interact, the transcriptional activator is anchored to the binding site and leads to the expression of the reporter gene. The two-hybrid system has been used to detect interactions among proteins produced by prokaryotic organisms such as Escherichia coli and by a wide range of eukaryotes including yeast, plants, and mammals. In addition, the protein interactions successfully detected by this system include those found normally in a variety of subcellular locations, including the nucleus, cytoplasm, and mitochondria, associated with membranes and extracellular. This system has been applied to the study of a variety of cellular processes, such as cell cycle progression, signal transduction, and oncogenesis. More specifically, interactions of oncoproteins in this system include ras and raf, 8-1° p53 and SV40 large T antigen, tl Rb and large T antigen, ~2 myc and max, 13 and p53 with itself. H Materials a n d M e t h o d s In theory, site-specific DNA-binding domains and transcriptional activation domains from many different transcription factors should work in the two-hybrid system. In practice, however, the most commonly used DNAbinding domains are from the yeast Saccharomyces cerevisiae transcription factor Gal4p and the E. coli repressor lexA. The most commonly used activation domains are from Gal4p and the herpes simplex virus VP16 protein. Most of our experience has been with the Gal4p DNA-binding and activation domains and this bias will be reflected in the remainder of this chapter. Reporter genes can encode any function detectable in S. cerevisiae, but generally encode the yeast His3p or Leu2p or E. coli fi-galaetosidase. Vectors
Several laboratories have constructed vectors for use with the twohybrid system. These plasmids have a number of features in common. The bacterial ori and bla sequences are included for maintenance and selection L. V. Aelst, M. Barr, S. Marcus, A. Polverino, and M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993). '~A. B. Vojtek, S. M. Hollenberg, and J. A. Cooper, Cell (Cambridge, Mass.) 74, 205 (1993), "~X.-F. Zhang, J. Settleman, J. M. Kyriakis,E. Takeuchi-Suzuki,S. J. Elledge, M. S. Marshall, J. T. Bruder, U. R. Rapp, and J. Avruch, Nature (London) 364, 308 (1993). i1 K. Iwabuchi, B. Li, P. L. Bartel, and S. Fields, Oncogene 8, 1693 (1993). ~2T. Durfee, K. Becherer, R.-L. Chen, S. H. Yeh, Y. Yang, A. E. Kilburn, W. H. Lee, and S. J. Elledge, Genes Dev. 7, 555 (1993). i~ A. S. Zervos, J. Gyuris, and R. Brent, Cell (Cambridge, Mass.) 72, 223 (1993).
244
MOLECULARCLONES
[ 161
in E. coli, and yeast 2~ or CEN and ARS sequences are included to maintain the plasmids in yeast at high or low copy number, respectively. A yeast nutritional marker gene such as HIS3, TRP1, LEU2, or URA3 is present to allow for selection of the plasmid in an appropriate yeast strain. The gene encoding either the DNA-binding or activation domain hybrid is under the regulation of a yeast promoter, usually derived from the ADH1 gene, and is followed by unique restriction sites to allow for the creation of in-frame fusions. The Gal4p DNA-binding domain contains a nuclear localization sequence, and the large T antigen nuclear localization sequence has been engineered into many of the Gal4p activation domain vectors. These sequences localize the hybrid proteins to the yeast nucleus for activation of the reporter gene. Some of the vectors that have been developed for the two-hybrid system are listed in Table I, 14-21 and maps of commonly used DNA-binding domain vectors are provided in Fig. 2 and of activation domain vectors in Fig. 3.
Yeast Reporter Strains Reporter strains that are compatible with either a Gal4p-based system or a lexA-based system are available. Strains used for the Gal4p system are deleted for the GAL4 and GAL80 genes. Yeast reporter strains are auxotrophs for certain amino acids such that the nutritional markers present on the two-hybrid system vectors can complement these deficiencies. In this way, transformants of the reporter strain can be selected on media lacking the appropriate amino acids. Reporter strains also carry one or more reporter gene constructs. Most strains contain a lacZ reporter gene that is under the control of either Gal4p- or lexA-binding sites. This allows for the screening of colonies that express interacting hybrid proteins because they produce/3-galactosidase. In addition, strains may carry a nutritional reporter gene, such as HIS3 or LEU2, that is under the control of Gal4por lexA-binding sites. These strains will be mutant for the chromosomal 14j. Ma and M. Ptashne, Cell (Cambridge, Mass.) 51, 113 (1987). 15 p. L. Bartel, C.-T. Chien, R. Sternglanz, and S. Fields, in "Cellular Interactions in Development: A Practical Approach" (D. A. Hartley, ed.), p. 153. Oxford University Press, Oxford, 1993. 16j. W. Harper, G. R. Adami, N. Wei, K. Keyomarsi, and S. J. Elledge, Cell (Cambridge, Mass.) 51, 805 (1993). 17 p. M. Chevray and D. Nathans, Proc. Natl. Acad. Sci. U.S.A. 89, 5789 (1992). 1~E. Golemis and R. Brent, personal communication (1993). 19 G. J. Hannon, D. Demetrick, and D. Beach, Genes Dev. 7, 2378 (1993). 2oj. Luban, K. L. Bossolt, E. K. Franke, G. V. Kalpana, and S. P. Goff, Cell (Cambridge, Mass.) 73, 1067 (1993). 21 S. Dalton and R. Treisman, Cell (Cambridge, Mass.) 68, 597 (1992).
[ 161
TWO-HYBRID SYSTEM
245
TABLE I VECTORS FOR Two-HYBRID SYSTEM Plasmid
Domain
Restriction sites
Marker
Refs.
HIS3 TRP1 TRP1 TRP1. CYH2 LEU2 TRPI HIS3
14 15 12 16 17 15 13, 18
LEU2 LEU2 LEU2 LEU2 LEU2 TRPI TRPI LEU2 URA3
2 15 19 12 20 17 13, 18 9 21
DNA-binding domain vectors
pMA424 pGBT9 pASI pAS2 pCP62 pBTMII6 lex(1-202)PL
GAL4 GAL4 GAL4 GAL4 GAL4 lexA lexA
bd bd bd bd bd
EcoRI, SmaI, BamHI, SalI, Pstl EcoRI, Smal, BamHI, SalI, Pstl NdeI, NcoI, Sill, Smal, BamHI NdeI, NcoI, Sill, Sinai, BamHI SalI, PstI, Sinai, SpeI, XbaI, NotI, SaclI EcoRI, SmaI, BamHI, SalI, Pstl EcoRI, Sinai, BamHI, Sail, Pstl Activation domain vectors
pGAD.F pGAD424 pGAD.GH pACT pGADNOT pPC86 pJG4-5 pVPI6 pSD.10
GAL4 GAL4 GAL4 GAL4 GAL4 GAL4 B42 VPI6 VP16
ad ad ad ad ad ad
BamHI EcoRI, Smal, BamHl, SalI, PstI, Bglll SpeI, BamHI, Smal, EcoRI, SalI, XhoI EcoRI, BamHI, Xhol, BgllI BamHI, NotI, SalI SalI, Sinai, EcoRI, BglII, SpeI, Notl EcoRI, XhoI BamHI, NotI EcoRI, BstXI, Xhol
copy of the nutritional gene that is used as a reporter gene. When these reporter strains are transformed with plasmids and plated onto media that lack the appropriate nutrient, only those transformants that express interacting hybrid proteins, and therefore activate the nutritional reporter gene, will survive. This system for selecting transformants that express interacting hybrid proteins is especially useful when searching an activation domain library for interacting proteins. Two different HIS3 reporter constructs are available for use with the Gal4p system. The plasmid pBM149922 contains the G A L l upstream activating sequence (UAS), the HIS3 minimal promoter, and the HIS3 coding sequence. Because the HIS3 promoter results in a low level of His3p expression in the absence of any two-hybrid interaction, the competitive inhibitor 3-amino-l,2,4-triazole (3-AT) must be included in the media to allow for histidine selection. The other vector is pGH119'23 which contains the G A L l UAS, the G A L l minimal promoter, and the HIS3 coding sequence. This reporter gene does not require the 22 j. Flick and M. Johnston, Mol. Cell BioL 10, 4757 (1990). 23 p. Bartel and S. Fields, unpublished (1993).
EcoRI
BamHI
Pstl
GAATTCCC(~GGGATCCGTCGACCTGCAGCC Sinai
Sail
H l n d ~ n d l l l
EcoRI BamHI PsII GAATTC CCGGGGATCCGTCGACCTGCAGCC
Hindfll ~
Smal
Sail
Ec°RV~ii~
Sphl
~
/T
I/;,,,,. S,h,...., J
I~-
" .4r'J4~""
;;a.
'-
~,~o,,,r
,,,,,.'W "x-' -'--
\
Aatll
~
pBTM116 5.5 kb
Pvull
od
FIG. 2. Maps of DNA-binding domain vectors for the two-hybrid system. Plasmids pGBT9,15 pBTMll6,15 pmS2,16 and lex(1-202)PL 13 are shown. Important features include the ADH1 promoter which drives transcription of either the GAL4 DNA-binding domain (GAL4 bd) or the E. coli lexA (lexA) gene and the ADH1 terminator (ADH1 term.) Also included are a yeast origin of replication (2/z), an E. coli origin of replication (ori), an E. coli selectable marker for ampicillin resistance (amp), the yeast selectable markers TRP1 or HIS3, and the 246
Snl GAG GCC CCG GGG ~ ATC CGT CGAC CAT ATG G~C ATG Ndel Ncol Sinai Sag
EeoRI BamHI Psll GAA TTC CCG GGG ATC CGT CGA CCT GCA GCC Smal Sail
Hindlll~ ~If~
ph
Sph~
~
~,HtnIIIdl
gene conferring cycloheximide sensitivity in yeast (CYH2). The restriction sites diagramed directly above each map are suitable for the insertion of heterologous genes. The nucleotide sequences are arranged in codons continuing in the same reading frame as the upstream DNA-binding domain. 247
. Spel
Sinai
EcoRI
CTA GAA CTA GTG GAT CCC CCG GGC TC-CAGe AAT TCG ATA T(~ BamHI Pstl EcoRV Hlndlll , Sail Apal A AGC TTA TCG ATA CCG TCG ACC TCG AGG GGG GGC CCG GTA Clal Xhol
I
Sphl /
j Hlndlll
pGAD.GH 7.2 kb
I J---~u. fl
T ~ . ~ m H I CC
Notl
pVP16
I
FIG. 3. Maps of activation domain vectors for the two-hybrid system. Plasmids pGAD.GH, 19 pACT, 12 pVP16, 9 and pJG4-513 are shown. Important features include the A D H 1 promoter 248
BalII BamHI GAG ATC TGG AAT TCG GAT C ~ G EcoRI Xhol
.....
13o111 ATC T
te'm.
\
/EooRV
EcoRI/Xholh-tindlll H
i
n
d
~
BarnHl/XbaI/Sail/NotI/Psti
Psll
Aatll~
~Xbill 'EcoRV
which drives transcription of the GAL4 activation domain (GAL4 ad), the 1342-activating sequence from E. coli (B42 activator), or the herpesvirus VP16 gene (VP16) and the A D H I terminator ( A D H I term.) Also included are a yeast origin of replication (2/x), an E. coli origin of replication (ori), an E. coil selectable marker for ampicillin resistance (amp), and the yeast selectable markers LEU2 or TRP1. The restriction sites diagramed directly above each map are suitable for the insertion of heterologous genes. The nucleotide sequences are arranged in codons continuing in the same reading frame as the upstream activation domain.
250
MOLECULARCLONES
[ 16]
presence of 3-AT. A description of some reporter strains is provided in Table II. 24-26
Construction of Hybrid Genes Construction of hybrid genes requires that in-frame fusions of the genes of interest be made to the D N A encoding the DNA-binding domain or activation domain. This can be performed using standard molecular biology techniques. 27'28Sometimes a fusion gene can be generated easily if compatible restriction sites exist in the test gene and the vector. If not, the gene fragment can be generated by polymerase chain reaction (PCR) with useful restriction sites incorporated into the primers. Alternatively, a restriction site can be changed into a different site or put into a different reading frame by incorporation of a short adapter oligonucleotide into a plasmid carrying one of the test genes. Constructions can be verified by restriction or D N A sequence analysis. Useful sequencing primers for Gal4p-based vectors are 5'-TCA TCG G A A G A G A G T AG-3', which corresponds to amino acid residues 132-137 of the Gal4p DNA-binding domain and 5'-TAC CAC TAC A A T G G A TG-3', which corresponds to amino acid residues 858-863 of the Gal4p activation domain. For sequencing lexA fusions, the primer 5'-CTT CGT CAG CAG A G C TTC-3', which corresponds to amino acid residues 181186 of lexA, can be used. The Gal4p activation domain primer is also useful for sequencing inserts of plasmids isolated from two-hybrid library searches.
Transformation of Yeast Plasmids can be introduced into yeast by electroporation, transformation of spheroplasts, or transformation of chemically treated cells. We use a modification of the lithium acetate method developed by I t o 29 and improved by Schiestl and Gietz 3° and Hill 31 for transformation of reporter strains with two-hybrid system plasmids. Yeast ceils are grown in rich media, treated with lithium acetate, and incubated in the presence of plasmid DNA. 24 G. Gill and M. Ptashne, Cell (Cambridge, Mass.) 51, 121 (1987). z5 p. Bartel, C.-T. Chien, R. Sternglanz, and S. Fields, BioTechniques 14, 920 (1993). 26 G. Hannon, H. Feilotter, and D. Beach, personal communication (1993), 27 j. Sambrook, E. F. Fritsch, and T. Maniatis, eds., "Molecular Cloning: A Laboratory Manual," 2nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, NY, 1989. 28 F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, eds., "Current Protocols in Molecular Biology." Greene Publishing Associates and Wiley (Interscience), New York, 1990. ~9 H. Ito, Y. Fukuda, K. Murata, and A. Kimura, J. Bacteriol. 153, 163 (1983). 3o R. H. Schiestl, P. Manivasakam, R. A. Woods, and R. D. Gietz, Methods 5, 79 (1993). 31 j. E. Hill, A. M. Myers, T. J. Koerner, and A. Tzagoloff, Yeast 2, 163 (1986).
[ 16]
TWO-HYBRID SYSTEM
251
TABLE II REPORTER STRAINS FOR Two-HYBRID SYSTEM
Strain
Genotype
GGYI::17I
MATch, ura3, leu2, his3, tyr, Agal4, Agal80, URA3::GALI-IacZ MA Tee, Agal4, Agal80, URA3::GAL1lacZ, ITs2-80, his3-200, trpl-63, leu2, ade2-101 MA Ta, ura3-52, his3-200, ade2-101, ITs2-801, trpl-901, leu2-3, 112, can r, ga14-542, ga180-538, URA3::GALIlacZ MA Ta, ura3-52, his3-200, ade2-101, ITs2-801, trp l-901, leu2-3, 112, can r, gal4-542, ga180-538, URA3::GaI4 binding sites-CYCl-lacZ MATa, leu2-3, 112, ura3-52, trpl-901, his3-200, ade2-101, gal4A, gal8OA, URA3::GALI-lacZ, L YS2::GAL1HIS3 MA Ta, leu2-3, 112, ura3-52, trpl-901, his3-200, ade2-101, gal4A, galSOA, URA3::GALI-IacZ, L YS2::GALIHIS3, cyh r MA Ta, ura3-52, his3-200, ade2-101, ITS2-801, trp l-901, leu2-3, 112, can r, gal4-542, ga180-538, URA3::GaI4 binding sites-CYCl-lacZ, L YS2::GA L1-H1S3 MATa, ade2, trpl-901, leu2-3, 112, his3-200, Agal4, Agal80, URA3::lexAop-lacZ MA Ta, trpl, leu2, his3, L YS2::lexAoplacZ MA Ta, trpl, ura3, his3, LEU2::pLexAop6-LEU2
PCY2
Y526
Y527
Y153
YI90
Hf7c
CYTI0-5d
L40 EGY48
Reporter genes
Markers
Refs.
GALI-lacZ
his3, leu2
24
GALI-IacZ
his3, trpl, leu2
17
GALI-lacZ
his3, leu2, trpl
25
GAL-CYCI-IacZ
his3, leu2, trpl
25
GALI-lacZ GALl-HIS3
trpl, leu2
12
GALI-lacZ GALl-HIS3
trpl. leu2
16
GAL-CYCI-IacZ GA L I-HIS3
his3, leu2, trpl
26
lexAop-lacZ
his3, leu2, trpl
15
lexAop-lacZ
his3, trpl, leu2
9
lexAop-LEU2
trpl, leu2, ura3
13
The cells are then plated onto a minimal media that lacks the appropriate nutrients for plasmid selection and, if appropriate, reporter gene expression. The recipes for standard yeast media can be obtained from other sources 2s'32 and are not included here. 32 C. Guthrie and G. R. Fink, "Guide to Yeast Genetics and Molecular Biology." Academic Press, San Diego, CA, 1991.
252
MOLECULARCLONES
[ 16]
Protocol
1. Inoculate 50 ml YEPD with yeast cells from a freshly grown culture. Incubate at 30 ° with shaking overnight. 2. Dilute the cells into 300 ml YEPD to give a final OD600 of 0.2. Incubate at 30 ° with shaking for 3 to 4 more hours. The culture should have an OD600 of about 0.5. 3. Pellet the cells by centrifugation (4000g, 5 rain, room temperature) 4. Resuspend the cells in 10 ml sterile H20. 5. Pellet the cells by centrifugation (6000g, 5 rain, room temperature) 6. Resuspend the cells in 1.5 ml TE/lithium acetate [10 mM Tris-C1, 1 mM EDTA, 100 m M CzH302Li made fresh from stocks of 100 mM Tris-Cl (pH 7.5), 10 mM EDTA, and 1 M CzH3OzLi (adjusted to pH 7.5 with dilute acetic acid)]. 7. Prepare the plasmid DNAs in a 1.5-ml microcentrifuge tube. Add 1-5~g of each plasmid and 100 ~g of single-stranded carrier D N A to each tube. The carrier DNA is prepared by dissolving D N A (salmon sperm or calf thymus) in H20, sonicating to reduce its viscosity, extracting with phenol/ chloroform [50% phenol (equilibrated to pH 8.0), 50% v/v chloroform] and then chloroform, and precipitating with ethanol. The carrier D N A is resuspended in TE [10 mM Tris-C1 (pH 8.0), 1 mM EDTA] at a concentration of 10 mg/ml and is denatured in a boiling water bath for 30 rain, then is chilled on ice. Aliquots can be stored frozen until they are needed. 8. Add 200 ~1 cell suspension to each tube of plasmid DNA. 9. Add 600 ~1 polyethylene glycol (PEG)/TE/lithium acetate [40% PEG, 10 mM Tris-C1, 1 mM EDTA, 100 mM C2H3OzLi made fresh from stocks of 50% PEG 3340, 100 mM Tris-C1 (pH 7.5), 10 mM EDTA, and 1 M C2H302Li (adjusted to pH 7.5 with dilute acetic acid)] to each tube. Mix gently. 10. Incubate at 30 ° for 30 min. 11. Add 90 bd fresh dimethyl sulfoxide (DMSO). Heat shock at 42 ° for 15 min. 12. Pellet the cells by centrifuging for 10 sec at high speed in a microcentrifuge. 13. Resuspend the pellet in 1 ml TE. Plate 100 ~1 of the cell suspension onto the appropriate selective media. Transformation of a reporter strain with a single plasmid yields 104 to 105 transformants/b~g plasmid DNA. If two plasmids are introduced simultaneously, the transformation frequency may drop by a factor of 10. Instead of introducing two plasmids simultaneously, some workers prefer to first transform with the plasmid expressing the hybrid of the DNAbinding domain with the target protein. The transformed strain is then
[ 16]
rWO-HVBalD SYSTEM
253
grown in selective media, and transformed with the activation domain plasmid. This method works well unless expression of the DNA-binding domain hybrid is detrimental to the reporter strain, in which case expression of this hybrid is often lost before the second transformation. For these hybrids, simultaneous transformation with the activation domain vector is necessary. Assaying .for Reporter Gene Expression After the transformants have grown into colonies, which usually takes 2 to 3 days in the absence of any selection for reporter gene expression, they must be tested for expression of a reporter gene. If the reporter gene encodes a protein, such as His3p or Leu2p, required for the synthesis of an amino acid, the colonies may grow slowly and take up to 10 days until they are visible. In either case, the most common reporter for the twohybrid system is the lacZ gene, because/3-galactosidase assays are simple, rapid, and easily quantified. The filter assay presented below is a sensitive method to test whether colonies on a plate express/3-galactosidaseY It is a useful method to assay transformants carrying defined hybrid proteins, usually on the third day after transformation. It is also used as a secondary screen of the rare positives that arise in a two-hybrid library search. Protocol 1. Prepare Z buffer [16.1 g/liter NazHPO4-7H20, 5.5 g/liter Nail2_ PO4" H20, 0.75 g/liter KC1, 0.246 g/liter MgSO4"7H20, 2.7 ml/liter 2-mercaptoethanol (add this fresh)] with 5-bromo-4-chloro-3-indolyl-/3-Dgalactopyranoside (X-Gal). To each 100 ml of Z buffer, add 1.67 ml of X-Gal stock (20 mg/ml X-Gal in N, N-dimethylformamide). 2. Add an aliquot of the Z buffer containing X-Gal to a clean petri dish. Use 1.8 ml for a 100-mm dish and 5 ml for a 150-ram dish. Layer a clean paper filter disc onto the buffer, taking care to avoid air bubbles. We use 75- or 125-ram-diameter VWR grade 413 filters, although other paper filters will also work. 3. Layer a sterile paper or nitrocellulose filter onto the plate of transformants, taking care to avoid air bubbles. Allow the filter to wet completely. 4. Remove the filter from the plate and place it in a pool of liquid nitrogen such that the colonies face up. Let the filter freeze for 5-10 sec. ~3L. Breeden and K. Nasmyth,Cold Spring Harbor Symp. Quant. BioL 50, 643 (1985).
254
MOLECULARCLONES
[ 161
5. Remove the filter from the liquid nitrogen and allow it to thaw completely at room temperature. 6. Layer the thawed filter, with the colonies facing up, onto the previously prepared filter that is soaked with Z buffer containing X-Gal. Take care to avoid air bubbles. 7. Incubate the filters at 30°. Strong positives may appear blue in as short as 30 rain whereas weaker positives may take overnight or longer to turn blue. The level of/3-galactosidase expression in yeast transformants can be quantified using one of two different colorimetric assays. The first uses the inexpensive substrate O-nitrophenyl-/3-o-galactopyranoside (ONPG), 34 and the second uses chlorophenol red-fl-o-galactopyranoside (CPRG) (see, for example, Iwabuchi et al.lt), which results in greater sensitivity. Prepare cultures for these assays by picking colonies to liquid selective media and incubating them at 30° on a roller or shaker.
Protocol 1. Grows cells in selective media to an OD600 of 0.5 to 1. 2. Pellet 0.1 to 1.5 ml of cells (depending on the expected enzyme activity) in a microcentrifuge tube. Resuspend the pellet in 0.8 ml Z buffer (see protocol for filter assay). 3. Add 50/xl CHC13 and 50/zl 0.1% (w/v) sodium dodecyl sulfate (SDS). Vortex the sample for 30 sec. 4. Add 0.16 ml of an ONPG stock solution [4 mg/ml in 100 mM phosphate buffer (pH 7.0)]. Mix well. 5. Incubate at 30° for a few minutes to 2 hr (depending on how rapidly the color changes). Quench the reaction by adding 0.4 ml of 1 M Na2CO3. 6. Spin the sample at high speed in a microeentrifuge for 10 min. 7. Measure the OD420 of the supernatant. Use a reaction mixture without added cells as a blank. 8. The/3-galactosidase activity can be calculated as OD420
Units of/3-galactosidase activity --- Vt(OD600) where V is the volume of culture used in milliliters and t is the reaction time in minutes. 34j. H. Miller, "Experiments in Molecular Genetics." Cold Spring Harbor Lab., Cold Spring Harbor, NY, 1972.
[ 16]
TWO-HYBRIDSYSTEM
255
Many interactions in the two-hybrid system result in a low level of fl-galactosidase expression not detected with ONPG as a substrate. For these cases, use C P R G as a substrate.
Protocol 1. Grow cells in selective media to an 0D600 of 0.5 to 1. 2. Pellet 0.1 to 5 ml of cells (depending on the expected enzyme activity) and resuspend in HEPES buffer (prepare 100 m M N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, 154 m M NaC1, 1% bovine serum albumin, adjust this solution to pH 7.2 with HC1, and add DL-aspartic acid, hemimagnesium salt to 2 raM, and Tween 20 to 0.05%) to a final volume of 765/xl. 3. Add 55/xl CHC13 and 55/xl of 0.1% (w/v) SDS to each tube. Vortex for 1 rain. 4. Add 125 tzl of a 40 m M stock (prepared in H20) of CPRG. 5. Mix the contents of the tube well and incubate at 37 °. 6. After a 20-min to 2-hr incubation (depending on how rapidly the color changes), stop the reaction with the addition of 10 txl of 100 m M ZnC12 to each tube. Mix the contents of the tube thoroughly. 7. Spin the tube at high speed in a microcentrifuge for 10 min. 8. Measure the 0D574 of the supernatant. Use a reaction mixture without added cells as a blank. 9. The/3-galactosidase activity can be calculated as Units of B-galactosidase activity =
1000 )< OD574 Vt(OD600) '
where V is the volume of culture used in milliliters and t is the reaction time in minutes.
Screening Libraries for Interacting Proteins One of the most useful applications of the two-hybrid system is to detect, from a large number of hybrids encoded by a genomic or cDNA library, proteins that interact with a protein of interest. In this application, a protein of interest expressed as a fusion protein containing a DNAbinding domain and total genomic or eDNA expressed as fusion proteins with an activation domain are cotransformed into a reporter strain. The rare transformants that express the reporter gene(s) are identified, and the activation domain plasmids from these positives are analyzed. The initial step in a two-hybrid search is to analyze the hybrid consisting of the target protein with the DNA-binding domain. Assay the DNAbinding domain hybrid alone for transcription of the reporter gene; there
256
MOLECULARCLONES
[ 161
must be no activity for this hybrid to be used in a two-hybrid search. If it does activate transcription, a search can be performed with a portion of the target protein that does not result in transcriptional activation (e.g., Iwabuchi et al.it). In addition, test whether the DNA-binding domain hybrid is expressed; if an antibody is available, check for production of the DNAbinding domain hybrid by Western analysis. If possible, check whether the target protein retains its activity in yeast. One critical assay is to determine whether the target protein can interact with a known protein partner in a two-hybrid assay if such a partner is available. If the target protein is known to complement a defect in yeast, the DNA-binding domain hybrid can be assayed for this property. The activation domain library is prepared by ligating the desired genomic D N A or cDNA to an activation domain vector. Table III provides a list of activation libraries that have been described in the literature. If the desired library is not available, it can be constructed using protocols found elsewhere. 27,28 Two-hybrid searches can be conducted as screens, by assaying for transformants that express the lacZ reporter gene, but are most often conducted using strains that allow for the selection of transformants that carry interacting hybrid proteins. These strains are cotransformed with the DNAbinding domain hybrid and the activation domain library, plating on media that select for the presence of both vectors and the expression of the reporter gene. Only those transformants that can activate the reporter gene will grow on the plate. In addition, the surviving transformants can be screened for those that express the lacZ reporter gene. By using a strain that carries two reporter genes with dissimilar promoters, many false-positives can be eliminated quickly (see "Identification of False Positive Proteins"). TABLE III ACTIVATIONDOMAINLIBRARIES Vector pPC86 pACT pJG4-5 pGADNOT pVP16 pGAD.F pPC86 pSD.10 pGAD.GH
DNA source
Ref.
Rat olfactory epithelium cDNA Epstein-Barr virus-transformed human peripheral lymphocyte cDNA HeLa cell cDNA HL-60 (human leukocyte) cell cDNA Mouse embryo (9.5 and 10.5 day) cDNA Saccharomyces cerevisiae genomic DNA Mouse embryo (14.5 day) cDNA HeLa cell cDNA HeLa cell cDNA
41 12 13 20 9 2 17 21 19
[ 161
TWO-HYBRIDSYSTEM
257
Introduction of the DNA-binding domain hybrid and the activation domain library into the reporter strain can be performed as a scaled-up version of the transformation procedure 29-3~ described previously, and outlined below.
Protocol 1. Grow the reporter strain (either with or without the plasmid encoding the DNA-binding domain hybrid) in 300 ml YEPD to an OD600 of about 0.5. 2. Pellet the cells by centrifugation (4000g, 5 min, room temperature). 3. Resuspend the cells in 10 ml sterile H20. 4. Pellet the cells by centrifugation (6000g, 5 min, room temperature). 5. Resuspend the cells in 1.5 ml TE/lithium acetate. 6. Prepare the plasmid DNAs in a 15-ml culture tube. Add 100 tzg of each plasmid (or only the activation domain plasmid if the strain already carries the plasmid encoding the DNA-binding domain hybrid) and 2 mg of single-stranded carrier DNA to the tube. 7. Add 2 ml cell suspension to the tube of plasmid DNA. 8. Add 6 ml PEG/TE/lithium acetate to the tube. Mix gently. 9. Incubate at 30° for 30 min. 10. Add 0.8 ml fresh DMSO. Heat shock at 42° for 15 min. 11. Pellet the cells by centrifuging for 2 min at half speed in a tabletop centrifuge. 12. Resuspend the pellet in 10 ml TE. Plate 300/~1 of the cell suspension onto 150-ram plates containing the appropriate selective media. If the transformation mix is plated onto media that select both for the two-hybrid plasmids and for reporter gene expression, be sure to also plate an aliquot onto media that select only for the presence of the DNA-binding and activation domain plasmids. This procedure will allow the total number of transformants to be calculated. The plates should be incubated at 30° until colonies appear, at which point expression of/3-galactosidase is assayed. Transformants positive both for growth and/3-galactosidase activity are picked either directly from the filter or from the corresponding colony on the original plate, and transferred to fresh media.
Recovery of Plasmids from Yeast After positive colonies have been purified, the activation domain plasmids should be recovered for further analysis. Since preparations of plasmid DNA from yeast are of poor quality and yield and are not useful for
258
MOLECULARCLONES
[ 161
restriction or sequence analysis, these plasmids are introduced into E. coliY A rapid procedure for preparing yeast plasmid DNA for introduction into E. coli is presented below. Protocol
1. Using a toothpick, transfer cells from a colony to 50/zl lysis solution [2% Triton X-100, 1% SDS, 100 mM NaC1, 10 mM Tris-C1 (pH 8.0), and 1 mM EDTA]. 2. Add 50/zl phenol/chloroform [50% phenol (equilibrated to pH 8.0), 50% chloroform] and ca. 0.1 g acid-washed glass beads (212-300/~m). 3. Vortex for 2 min. 4. Spin at high speed in a microcentrifuge for 5 min. 5. Transfer the supernatant to a clean tube and ethanol precipitate the DNA. Wash with 70% (v/v) ethanol and dry the pellet. 6. Resuspend the pellet in 10/xl H20. Use 1/~1 to transform electrocompetent E. coli. We usually obtain 100-1000 E. coli transformants when using this procedure. A similar but more rapid procedure has also been described? 6 If the activation domain plasmid carries the LEU2 gene, it is helpful to introduce the yeast DNA into a bacterial strain [such as MH4 (araD139 A(lac)X74 galU galK hsr- hsm + strA leuB-)] 37 that carries a leuB mutation because the LEU2 gene complements this mutation and allows the strain to grow on minimal media lacking leucine. Plasmid DNA can be prepared from the E. coli transformants by standard m e t h o d s . 27'28 Before being used for other analyses, recovered plasmids should be introduced into the reporter strain along with the plasmid expressing the target protein hybrid to confirm that the desired plasmid has been isolated. Often, multiple activation domain plasmids are introduced into individual cells during the transformation procedure, although only one of them is responsible for reporter gene activation. Maintaining selection for reporter gene (e.g., HIS3) activity on the positive yeast colonies while purifying them can increase the proportion of the plasmids being the desired ones, making these plasmids easier to isolate. Identification of False-Positive Proteins
A positive signal may be obtained from a library search even though the target protein and the protein encoded by the activation domain plasmid 35 C. S. Hoffman and F. Winston, Gene 57, 267 (1987). 36 p. Kaiser and B. Auer, BioTechniques 14, 552 (1993). 37 M. N. Hall, L. Hereford, and I. Herskowitz, Cell (Cambridge, Mass.) 36, 1057 (1984).
[ 16]
TWO-HYBRIDSYSTEM
259
do not interact with one anotherY Although some of these false-positive proteins activate transcription in the absence of a DNA-binding domain hybrid, many require the presence of a DNA-binding domain hybrid. False positives are eliminated by verifying that reporter gene expression is specific for the presence of the target protein hybrid and is not generated in the presence of other nonrelated DNA-binding domain hybrids. In addition. strains that carry two reporter genes with dissimilar promoters that both contain binding sites for the same DNA-binding domain can help eliminate many false positives. 25 Select only the putative positive clones that activate transcription of both reporter genes in the presence of the target protein hybrid. Strains such as Y15312 and H f 7 c 26 contain such reporter genes. Positives that meet the criterion of specificity are best confirmed using a biochemical assay for interaction. An additional genetic selection was developed to rapidly eliminate the DNA-binding domain vector from the reporter strain, leaving only the library plasmid present in the positive transformant. 16 The DNA-binding domain vector pAS2 (see Table I, Fig. 2) carries the CYH2 gene which confers cycloheximide sensitivity to a resistant yeast strain such as Y190 (see Table II). Growth of positive transformants on cycloheximide-containing media selects for the loss of this plasmid. Plasmids encoding various DNAbinding domain hybrids can be introduced into the resulting strain by a mating procedure to test whether or not the positive signal is due to a specific interaction with the target protein. Troubleshooting Sometimes interactions that occur normally in vivo are not detected when tested in the two-hybrid system. For example, if high level expression of one of the fusion proteins is toxic to the reporter strain, transformants will be unable to grow. Sometimes truncation of the toxic protein will alleviate its detrimental effect, yet still allow the interaction to occur or, alternatively, the hybrid could be expressed using a conditional promoter. Other reasons for not obtaining a signal include hybrid proteins that are not stably expressed in yeast, DNA-binding or activation domains that occlude the site of interaction, failure of the hybrid proteins to fold properly in yeast, or failure of the hybrid proteins to enter the nucleus. Different hybrid constructions might help, but in some cases there may be no way to detect an interaction using this system. A more common problem occurs when the protein fused to the DNAbinding domain activates transcription by itself. This activation is more likely to occur if the protein is a transcription factor but other proteins that are not involved in transcription may also activate transcription. In a
260
MOLECULARCLONES
[ 161
test involving two defined proteins, the two proteins can be switched to the opposite vectors such that the activating protein is fused to the activation domain instead of the DNA-binding domain. It may also be possible to delete the activation domain of the target protein. Less frequently an activation domain hybrid will activate transcription in the absence of a DNAbinding domain hybrid.
Mapping Domains Involved in Protein-Protein Interactions The two-hybrid system can be used to define interacting domains by assaying protein fragments for their ability to bind to a target protein or by screening large numbers of mutants to identify residues involved in a protein-protein interaction.3s DNA fragments encoding portions of an interacting protein can be generated by restriction enzyme digestion, Bal31 deletion, or by PCR and these can be cloned into the appropriate twohybrid vector. The ability of fragments encoded by each clone to interact with another hybrid can then be quickly assayed. For identifying specific residues that are involved in an interaction, a library of hybrid proteins containing point mutations is screened for mutants that have lost their ability to interact with the protein partner, as indicated below.
Protocol
1. Using PCR under suboptimal conditions,39 generate mutant fragments of the gene encoding all or part of one member of an interacting pair. 2. Clone these fragments into the appropriate vector to create a library of mutant hybrid proteins. Pool the bacterial colonies and prepare plasmid DNA. 3. Transform this library and the plasmid expressing a hybrid of the protein partner into a yeast reporter strain. Select for transformants that receive both plasmids. 4. Perform a filter assay for/3-galactosidase expression and identify colonies that are white or lighter blue than the unmutagenized control. These may represent mutants that have lost all or some of their ability to bind the protein partner. 5. Test these colonies with reduced/3-galactosidase activity for expression of the mutant hybrid protein by Western blot analysis. 38B. Li and S. Fields, FASEB J. 7, 957 (1993). 39D. W. Leung,E. Chen, and D. V. Goeddel, Technique 1, 11 (1989).
[ 16]
TWO-HYBRIDSYSTEM
261
6. For hybrid proteins that are full-length and stably expressed, isolate the plasmid encoding the mutant protein and determine the D N A sequence in the region that has been mutagenized.
Isolation of DNA-Binding Proteins In addition to identifying protein-protein interactions, many of the reagents that are used to perform two-hybrid system library searches can be used for the identification of proteins that bind to specific DNA sequences. 4°'41 The target D N A sequence of the putative binding protein is placed upstream of a reporter gene which is then integrated into yeast to create a new reporter strain. An activation domain library is introduced into the reporter strain and the transformants are then assayed for expression of the reporter gene. Hybrid proteins that bind to the test sequence are able to activate transcription of the reporter gene. The sequence of the DNAbinding protein is then obtained from the activation domain plasmid using methods discussed previously. Vectors for constructing yeast reporter genes include pRS315HIS, 4~ p601 42 and pTH1, 23 which carry HIS3 reporter genes. It is helpful to create, in parallel, a second strain carrying the same reporter gene with a mutated target sequence so that putative positive clones can be tested immediately to determine whether their binding is specific to the target D N A sequence. Included below is a brief protocol for screening activation domain libraries for site-specific DNA-binding proteins. Protocol
l. Construct a plasmid containing the target D N A sequence upstream of a reporter gene such as HIS3 or lacZ (or make both constructions). 2. Integrate the reporter gene(s) construct in an appropriately marked yeast strain. Verify that the vector has been integrated correctly by Southern blot analysis. Alternatively, transform a replicating plasmid to create the reporter strain and maintain selection for the reporter plasmid. 3. Check to ensure that the reporter strain does not express the reporter gene(s) constitutively. 4. Introduce the appropriate activation domain library into the reporter strain. Select for transformants that express the reporter gene(s). 4o j. j. Li and I. Herskowitz, Science 262, 1870 (1993). 4~ M. M. Wang and R. R. Reed, Nature (London) 364, 121 (1993). 4_~C. Alexandre, D. A. Grueneberg, and M. Z. Gilman, Methods 5, 147 (1993).
262
MOLECULARCLONES
[ 161
5. Isolate DNA from the yeast and electroporate into E. coli to isolate the activation domain plasmid. 6. Determine the sequence of the insert in the plasmid. Other Applications Other potential applications of the two-hybrid system include using it to screen for compounds that disrupt a protein-protein interaction, screening for peptides that bind to a target protein, and generating a "protein linkage map" that describes all the detectable protein-protein interactions in a cell. These applications are discussed briefly below. Compounds could be screened for their ability to inhibit a proteinprotein interaction by establishing a reporter system in which a readily detected protein, such as luciferase, is produced as a result of a two-hybrid interaction. This system could be yeast based or it could be a mammalian cell line. 43 The ceils are then treated with each member of a library of compounds, and assays are performed to detect compounds that reduce the amount of reporter transcription. As a control, a parallel line carrying two hybrid proteins, which are unrelated to the target proteins and result in similar reporter gene expression, is also treated with each compound. This control eliminates from further study compounds that bind to the DNA-binding or activation domain, that are generally deleterious for transcription, or that are toxic to the cells. The two-hybrid system is capable of detecting the interaction of a protein with a small peptide. An example of this interaction is that between the Rb protein and a peptide derived from the Simian virus 40 large T antigen. 44,45 With Rb fused to the Gal4p DNA-binding domain and the T antigen peptide fused to the Gal4p activation domain, only a L e u - X - C y s X-Glu sequence present in the T antigen peptide is required for reporter gene expression. Screening an activation domain library that consists of synthetic oligonucleotides encoding 16 amino acid residue-long peptides resulted in the identification of several peptides containing the L e u - X Cys-X-Glu motif.45 The two-hybrid system might also be used to identify large numbers of interacting proteins by preparing libraries in both the DNA-binding and activation domain vectors and screening them against one another. The plasmids encoding the DNA-binding and activation domain library fusions 43C. V. Dang, J. Barrett, M. Villa-Garcia,L. M. S. Resar, G. J. Kato,and E. R. Fearon,Mol. Cell. Biol. 11, 954 (1991). T. Durfee, B. Gorovits, C. Hensey,and W.-H. Lee, submittedfor publication. 45M. Yang, Z. Wu, and S. Fields,Nucleic Acids Res., in press.
[17]
GENE TRAP RETROVIRUSES
263
could be isolated and a short sequence of each insert would be obtained. Each pair of sequences from a positive serves as a tag for a protein-protein interaction. This screening should result in the identification of networks of interacting proteins to create a so-called protein linkage map. This information would identify new protein-protein interactions and would help place novel proteins into some cellular pathway. Acknowledgments We thank Gaff Mandel for comments on the manuscript and for sharing unpublished data, Erica Golemis and Stan Hollenberg for plasmid maps, Bin Li and Kuniyoshi lwabuchi for the CPRG assay protocol, and Judy Nimmo for assistance with the manuscript.
[ 17] By GEOFFREY
Retrovirus
Gene Traps
G . HICKS, ER-GANG SHI, JIN CHEN, MICHAEL ROSHON,
D O U G W1LLIAMSON, CHRISTINA SCHERER,
and H.
E A R L RULEY
Introduction The study of mammalian cells and animals has been hampered by the lack of efficient genetic systems as are commonly available for lower organisms. Despite improved molecular methods, genes responsible for organismal phenotypes are still difficult to clone. Moreover, relatively few mutant alleles are available for study, particularly those that are recessive or affect embryonic development. To help identify mammalian genes responsible for recessive phenotypes, several types of gene trap retroviruses have been developed for use as insertional mutagens. The viruses permit direct selection of cell clones in which expressed genes have been disrupted as a result of virus integration. The U3 gene traps contain coding sequences for a selectable marker inserted into the U3 region of the long terminal repeat (LTR). Provirus integration positions the 5' copy only 30 nucleotides from the flanking cellular DNA (Fig. 1A), and selection for U3 gene expression generates cell clones in which the proviruses have inserted in or near exons of transcriptionally active genes. 1-4 The splicing-activated gene traps (Fig. 1B) contain a selectable t H. von Melchner and H. E. Ruley, J. Virol. 63, 3227 (1989). 2 H. von Melchner, J. DeGregori, H. Rayburn, C. Friedel, S. Reddy, and H. E. Ruley. Genes Dev. 6, 919 (1992). 3 S. Reddy, J. DeGregori, H. von Melchner, and H. E. Ruley, J. Virol. 65, 1507 (1991). W. Chang, C. Hubbard, C. Friedel, and H. E. Ruley, Virology 193, 737 (1993).
METHODS IN ENZYMOLOGY,VOL.254
Copyright(c: 1995by AcademicPress,Inc. All rightsof reproductionin any formreserved.
TWO-HYBRIDSYSTEM
[16]
Analyzing Protein-Protein Interactions Two-Hybrid System
241
Using
By PAUL L. BARTEL and STANLEY FIELDS Introduction Protein-protein interactions play a critical role in most biological processes. For example, the identification of interactions between viral oncoproteins and cellular tumor suppressor proteins, between components of signal transduction pathways, and between proteins involved in the regulation of the cell cycle has greatly increased our understanding of cellular function. In addition, studies defining domains of proteins [e.g., SH2 and SH3 domains, retinoblastoma (Rb) pocket] that are responsible for specific interactions have contributed significantly to unraveling the mechanisms of tumorigenesis. The two-hybrid system is a yeast-based genetic assay for detecting protein-protein interactions in vivo. It can be used to establish interactions between two known proteins or to search genomic or cDNA libraries for proteins that interact with a target protein. For this latter application, the gene encoding the protein that interacts with a target protein is immediately available on a plasmid, which is not the case for many biochemical methods to detect interacting proteins. The two-hybrid system has also been used to define the protein domains that mediate an interaction and to identify specific residues that are involved in a protein-protein interaction. We will briefly discuss the basis for this method and then present the protocols that are necessary to use this system. Principle of Method The two-hybrid system 1,2 exploits the two domain nature of many sitespecific eukaryotic transcription factors to detect interactions between two different hybrid proteins. These factors consist of a site-specific DNAbinding domain which is distinct from a domain that is responsible for transcriptional activation. 3,4 Two key results in the development of this t S. Fields a n d O.-K. Song, Nature (London) 340, 245 (1989). 2 C.-T. C h i e n , P. L. B a r t e l , R. Sternglanz, a n d S. Fields, Proc. NatL Acad. Sci. U.S.A. 88, 9578 (1991). 3 L. K e e g a n , G. Gill, a n d M. P t a s h n e , Science 231, 699 (1986). 4 I. A. H o p e a n d K. Struhl, Cell (Cambridge, Mass.) 46, 885 (1986).
METHODS IN ENZYMOLOGY. VOU 254
Copyright © 1995 by Academic Press. lnc. All rights of reproduction in any form reserved.
242
MOLECULARCLONES
[ 161
A Protein ] DNA-bindi domain rromoter
B
Reporter gene
~Activation Protein Y ~ domain
Promoter
I
Reporter gene
C
vromoter
Heporter gene
Fio. 1. The two-hybrid system. (A) A hybrid consisting of a DNA-binding domain fused to a protein X is unable to activate transcription of a reporter gene because it lacks a transcriptional activation domain. (B) A hybrid consisting of an activation domain fused to a protein Y fails to localize to the reporter gene. (C) If both hybrids are expressed in the same cell and proteins X and Y interact, the activation domain is anchored to the binding site and the reporter gene is expressed.
system were the demonstration that a hybrid protein containing domains from two different transcription factors can activate transcription 5 and the demonstration that the two domains need not be covalently attached to each other to function. 6'7 In the two-hybrid system, two fusion proteins must be generated. One is a fusion between the DNA-binding domain of a transcription factor and a test protein "X." The other is a fusion between the activation domain of a transcription factor and a test protein "Y." Plasmids encoding these fusions are introduced together into a yeast strain that contains one or more reporter genes with upstream binding sites for the DNA-binding domain present in the first hybrid. As illustrated in Fig. 1, the expression of either the hybrid of the DNA-binding domain with protein X or the hybrid of the activation domain with protein Y fails to 5 R. Brent and M. Ptashne, Cell (Cambridge, Mass.) 43, 729 (1985). J. Ma and M. Ptashne, Cell (Cambridge, Mass.) 55, 443 (1988). 7 j. McKnight, T. Kristie, and B. Roizman, Proc. Natl. Acad. Sci. U.S.A. 84, 7061 (1987).
[ 16]
TWO-HYBRIDSYSTEM
243
activate transcription of a reporter gene. However, if protein X and protein Y interact, the transcriptional activator is anchored to the binding site and leads to the expression of the reporter gene. The two-hybrid system has been used to detect interactions among proteins produced by prokaryotic organisms such as Escherichia coli and by a wide range of eukaryotes including yeast, plants, and mammals. In addition, the protein interactions successfully detected by this system include those found normally in a variety of subcellular locations, including the nucleus, cytoplasm, and mitochondria, associated with membranes and extracellular. This system has been applied to the study of a variety of cellular processes, such as cell cycle progression, signal transduction, and oncogenesis. More specifically, interactions of oncoproteins in this system include ras and raf, 8-1° p53 and SV40 large T antigen, tl Rb and large T antigen, ~2 myc and max, 13 and p53 with itself. H Materials a n d M e t h o d s In theory, site-specific DNA-binding domains and transcriptional activation domains from many different transcription factors should work in the two-hybrid system. In practice, however, the most commonly used DNAbinding domains are from the yeast Saccharomyces cerevisiae transcription factor Gal4p and the E. coli repressor lexA. The most commonly used activation domains are from Gal4p and the herpes simplex virus VP16 protein. Most of our experience has been with the Gal4p DNA-binding and activation domains and this bias will be reflected in the remainder of this chapter. Reporter genes can encode any function detectable in S. cerevisiae, but generally encode the yeast His3p or Leu2p or E. coli fi-galaetosidase. Vectors
Several laboratories have constructed vectors for use with the twohybrid system. These plasmids have a number of features in common. The bacterial ori and bla sequences are included for maintenance and selection L. V. Aelst, M. Barr, S. Marcus, A. Polverino, and M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993). '~A. B. Vojtek, S. M. Hollenberg, and J. A. Cooper, Cell (Cambridge, Mass.) 74, 205 (1993), "~X.-F. Zhang, J. Settleman, J. M. Kyriakis,E. Takeuchi-Suzuki,S. J. Elledge, M. S. Marshall, J. T. Bruder, U. R. Rapp, and J. Avruch, Nature (London) 364, 308 (1993). i1 K. Iwabuchi, B. Li, P. L. Bartel, and S. Fields, Oncogene 8, 1693 (1993). ~2T. Durfee, K. Becherer, R.-L. Chen, S. H. Yeh, Y. Yang, A. E. Kilburn, W. H. Lee, and S. J. Elledge, Genes Dev. 7, 555 (1993). i~ A. S. Zervos, J. Gyuris, and R. Brent, Cell (Cambridge, Mass.) 72, 223 (1993).
244
MOLECULARCLONES
[ 161
in E. coli, and yeast 2~ or CEN and ARS sequences are included to maintain the plasmids in yeast at high or low copy number, respectively. A yeast nutritional marker gene such as HIS3, TRP1, LEU2, or URA3 is present to allow for selection of the plasmid in an appropriate yeast strain. The gene encoding either the DNA-binding or activation domain hybrid is under the regulation of a yeast promoter, usually derived from the ADH1 gene, and is followed by unique restriction sites to allow for the creation of in-frame fusions. The Gal4p DNA-binding domain contains a nuclear localization sequence, and the large T antigen nuclear localization sequence has been engineered into many of the Gal4p activation domain vectors. These sequences localize the hybrid proteins to the yeast nucleus for activation of the reporter gene. Some of the vectors that have been developed for the two-hybrid system are listed in Table I, 14-21 and maps of commonly used DNA-binding domain vectors are provided in Fig. 2 and of activation domain vectors in Fig. 3.
Yeast Reporter Strains Reporter strains that are compatible with either a Gal4p-based system or a lexA-based system are available. Strains used for the Gal4p system are deleted for the GAL4 and GAL80 genes. Yeast reporter strains are auxotrophs for certain amino acids such that the nutritional markers present on the two-hybrid system vectors can complement these deficiencies. In this way, transformants of the reporter strain can be selected on media lacking the appropriate amino acids. Reporter strains also carry one or more reporter gene constructs. Most strains contain a lacZ reporter gene that is under the control of either Gal4p- or lexA-binding sites. This allows for the screening of colonies that express interacting hybrid proteins because they produce/3-galactosidase. In addition, strains may carry a nutritional reporter gene, such as HIS3 or LEU2, that is under the control of Gal4por lexA-binding sites. These strains will be mutant for the chromosomal 14j. Ma and M. Ptashne, Cell (Cambridge, Mass.) 51, 113 (1987). 15 p. L. Bartel, C.-T. Chien, R. Sternglanz, and S. Fields, in "Cellular Interactions in Development: A Practical Approach" (D. A. Hartley, ed.), p. 153. Oxford University Press, Oxford, 1993. 16j. W. Harper, G. R. Adami, N. Wei, K. Keyomarsi, and S. J. Elledge, Cell (Cambridge, Mass.) 51, 805 (1993). 17 p. M. Chevray and D. Nathans, Proc. Natl. Acad. Sci. U.S.A. 89, 5789 (1992). 1~E. Golemis and R. Brent, personal communication (1993). 19 G. J. Hannon, D. Demetrick, and D. Beach, Genes Dev. 7, 2378 (1993). 2oj. Luban, K. L. Bossolt, E. K. Franke, G. V. Kalpana, and S. P. Goff, Cell (Cambridge, Mass.) 73, 1067 (1993). 21 S. Dalton and R. Treisman, Cell (Cambridge, Mass.) 68, 597 (1992).
[ 161
TWO-HYBRID SYSTEM
245
TABLE I VECTORS FOR Two-HYBRID SYSTEM Plasmid
Domain
Restriction sites
Marker
Refs.
HIS3 TRP1 TRP1 TRP1. CYH2 LEU2 TRPI HIS3
14 15 12 16 17 15 13, 18
LEU2 LEU2 LEU2 LEU2 LEU2 TRPI TRPI LEU2 URA3
2 15 19 12 20 17 13, 18 9 21
DNA-binding domain vectors
pMA424 pGBT9 pASI pAS2 pCP62 pBTMII6 lex(1-202)PL
GAL4 GAL4 GAL4 GAL4 GAL4 lexA lexA
bd bd bd bd bd
EcoRI, SmaI, BamHI, SalI, Pstl EcoRI, Smal, BamHI, SalI, Pstl NdeI, NcoI, Sill, Smal, BamHI NdeI, NcoI, Sill, Sinai, BamHI SalI, PstI, Sinai, SpeI, XbaI, NotI, SaclI EcoRI, SmaI, BamHI, SalI, Pstl EcoRI, Sinai, BamHI, Sail, Pstl Activation domain vectors
pGAD.F pGAD424 pGAD.GH pACT pGADNOT pPC86 pJG4-5 pVPI6 pSD.10
GAL4 GAL4 GAL4 GAL4 GAL4 GAL4 B42 VPI6 VP16
ad ad ad ad ad ad
BamHI EcoRI, Smal, BamHl, SalI, PstI, Bglll SpeI, BamHI, Smal, EcoRI, SalI, XhoI EcoRI, BamHI, Xhol, BgllI BamHI, NotI, SalI SalI, Sinai, EcoRI, BglII, SpeI, Notl EcoRI, XhoI BamHI, NotI EcoRI, BstXI, Xhol
copy of the nutritional gene that is used as a reporter gene. When these reporter strains are transformed with plasmids and plated onto media that lack the appropriate nutrient, only those transformants that express interacting hybrid proteins, and therefore activate the nutritional reporter gene, will survive. This system for selecting transformants that express interacting hybrid proteins is especially useful when searching an activation domain library for interacting proteins. Two different HIS3 reporter constructs are available for use with the Gal4p system. The plasmid pBM149922 contains the G A L l upstream activating sequence (UAS), the HIS3 minimal promoter, and the HIS3 coding sequence. Because the HIS3 promoter results in a low level of His3p expression in the absence of any two-hybrid interaction, the competitive inhibitor 3-amino-l,2,4-triazole (3-AT) must be included in the media to allow for histidine selection. The other vector is pGH119'23 which contains the G A L l UAS, the G A L l minimal promoter, and the HIS3 coding sequence. This reporter gene does not require the 22 j. Flick and M. Johnston, Mol. Cell BioL 10, 4757 (1990). 23 p. Bartel and S. Fields, unpublished (1993).
EcoRI
BamHI
Pstl
GAATTCCC(~GGGATCCGTCGACCTGCAGCC Sinai
Sail
H l n d ~ n d l l l
EcoRI BamHI PsII GAATTC CCGGGGATCCGTCGACCTGCAGCC
Hindfll ~
Smal
Sail
Ec°RV~ii~
Sphl
~
/T
I/;,,,,. S,h,...., J
I~-
" .4r'J4~""
;;a.
'-
~,~o,,,r
,,,,,.'W "x-' -'--
\
Aatll
~
pBTM116 5.5 kb
Pvull
od
FIG. 2. Maps of DNA-binding domain vectors for the two-hybrid system. Plasmids pGBT9,15 pBTMll6,15 pmS2,16 and lex(1-202)PL 13 are shown. Important features include the ADH1 promoter which drives transcription of either the GAL4 DNA-binding domain (GAL4 bd) or the E. coli lexA (lexA) gene and the ADH1 terminator (ADH1 term.) Also included are a yeast origin of replication (2/z), an E. coli origin of replication (ori), an E. coli selectable marker for ampicillin resistance (amp), the yeast selectable markers TRP1 or HIS3, and the 246
Snl GAG GCC CCG GGG ~ ATC CGT CGAC CAT ATG G~C ATG Ndel Ncol Sinai Sag
EeoRI BamHI Psll GAA TTC CCG GGG ATC CGT CGA CCT GCA GCC Smal Sail
Hindlll~ ~If~
ph
Sph~
~
~,HtnIIIdl
gene conferring cycloheximide sensitivity in yeast (CYH2). The restriction sites diagramed directly above each map are suitable for the insertion of heterologous genes. The nucleotide sequences are arranged in codons continuing in the same reading frame as the upstream DNA-binding domain. 247
. Spel
Sinai
EcoRI
CTA GAA CTA GTG GAT CCC CCG GGC TC-CAGe AAT TCG ATA T(~ BamHI Pstl EcoRV Hlndlll , Sail Apal A AGC TTA TCG ATA CCG TCG ACC TCG AGG GGG GGC CCG GTA Clal Xhol
I
Sphl /
j Hlndlll
pGAD.GH 7.2 kb
I J---~u. fl
T ~ . ~ m H I CC
Notl
pVP16
I
FIG. 3. Maps of activation domain vectors for the two-hybrid system. Plasmids pGAD.GH, 19 pACT, 12 pVP16, 9 and pJG4-513 are shown. Important features include the A D H 1 promoter 248
BalII BamHI GAG ATC TGG AAT TCG GAT C ~ G EcoRI Xhol
.....
13o111 ATC T
te'm.
\
/EooRV
EcoRI/Xholh-tindlll H
i
n
d
~
BarnHl/XbaI/Sail/NotI/Psti
Psll
Aatll~
~Xbill 'EcoRV
which drives transcription of the GAL4 activation domain (GAL4 ad), the 1342-activating sequence from E. coli (B42 activator), or the herpesvirus VP16 gene (VP16) and the A D H I terminator ( A D H I term.) Also included are a yeast origin of replication (2/x), an E. coli origin of replication (ori), an E. coil selectable marker for ampicillin resistance (amp), and the yeast selectable markers LEU2 or TRP1. The restriction sites diagramed directly above each map are suitable for the insertion of heterologous genes. The nucleotide sequences are arranged in codons continuing in the same reading frame as the upstream activation domain.
250
MOLECULARCLONES
[ 16]
presence of 3-AT. A description of some reporter strains is provided in Table II. 24-26
Construction of Hybrid Genes Construction of hybrid genes requires that in-frame fusions of the genes of interest be made to the D N A encoding the DNA-binding domain or activation domain. This can be performed using standard molecular biology techniques. 27'28Sometimes a fusion gene can be generated easily if compatible restriction sites exist in the test gene and the vector. If not, the gene fragment can be generated by polymerase chain reaction (PCR) with useful restriction sites incorporated into the primers. Alternatively, a restriction site can be changed into a different site or put into a different reading frame by incorporation of a short adapter oligonucleotide into a plasmid carrying one of the test genes. Constructions can be verified by restriction or D N A sequence analysis. Useful sequencing primers for Gal4p-based vectors are 5'-TCA TCG G A A G A G A G T AG-3', which corresponds to amino acid residues 132-137 of the Gal4p DNA-binding domain and 5'-TAC CAC TAC A A T G G A TG-3', which corresponds to amino acid residues 858-863 of the Gal4p activation domain. For sequencing lexA fusions, the primer 5'-CTT CGT CAG CAG A G C TTC-3', which corresponds to amino acid residues 181186 of lexA, can be used. The Gal4p activation domain primer is also useful for sequencing inserts of plasmids isolated from two-hybrid library searches.
Transformation of Yeast Plasmids can be introduced into yeast by electroporation, transformation of spheroplasts, or transformation of chemically treated cells. We use a modification of the lithium acetate method developed by I t o 29 and improved by Schiestl and Gietz 3° and Hill 31 for transformation of reporter strains with two-hybrid system plasmids. Yeast ceils are grown in rich media, treated with lithium acetate, and incubated in the presence of plasmid DNA. 24 G. Gill and M. Ptashne, Cell (Cambridge, Mass.) 51, 121 (1987). z5 p. Bartel, C.-T. Chien, R. Sternglanz, and S. Fields, BioTechniques 14, 920 (1993). 26 G. Hannon, H. Feilotter, and D. Beach, personal communication (1993), 27 j. Sambrook, E. F. Fritsch, and T. Maniatis, eds., "Molecular Cloning: A Laboratory Manual," 2nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, NY, 1989. 28 F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, eds., "Current Protocols in Molecular Biology." Greene Publishing Associates and Wiley (Interscience), New York, 1990. ~9 H. Ito, Y. Fukuda, K. Murata, and A. Kimura, J. Bacteriol. 153, 163 (1983). 3o R. H. Schiestl, P. Manivasakam, R. A. Woods, and R. D. Gietz, Methods 5, 79 (1993). 31 j. E. Hill, A. M. Myers, T. J. Koerner, and A. Tzagoloff, Yeast 2, 163 (1986).
[ 16]
TWO-HYBRID SYSTEM
251
TABLE II REPORTER STRAINS FOR Two-HYBRID SYSTEM
Strain
Genotype
GGYI::17I
MATch, ura3, leu2, his3, tyr, Agal4, Agal80, URA3::GALI-IacZ MA Tee, Agal4, Agal80, URA3::GAL1lacZ, ITs2-80, his3-200, trpl-63, leu2, ade2-101 MA Ta, ura3-52, his3-200, ade2-101, ITs2-801, trpl-901, leu2-3, 112, can r, ga14-542, ga180-538, URA3::GALIlacZ MA Ta, ura3-52, his3-200, ade2-101, ITs2-801, trp l-901, leu2-3, 112, can r, gal4-542, ga180-538, URA3::GaI4 binding sites-CYCl-lacZ MATa, leu2-3, 112, ura3-52, trpl-901, his3-200, ade2-101, gal4A, gal8OA, URA3::GALI-lacZ, L YS2::GAL1HIS3 MA Ta, leu2-3, 112, ura3-52, trpl-901, his3-200, ade2-101, gal4A, galSOA, URA3::GALI-IacZ, L YS2::GALIHIS3, cyh r MA Ta, ura3-52, his3-200, ade2-101, ITS2-801, trp l-901, leu2-3, 112, can r, gal4-542, ga180-538, URA3::GaI4 binding sites-CYCl-lacZ, L YS2::GA L1-H1S3 MATa, ade2, trpl-901, leu2-3, 112, his3-200, Agal4, Agal80, URA3::lexAop-lacZ MA Ta, trpl, leu2, his3, L YS2::lexAoplacZ MA Ta, trpl, ura3, his3, LEU2::pLexAop6-LEU2
PCY2
Y526
Y527
Y153
YI90
Hf7c
CYTI0-5d
L40 EGY48
Reporter genes
Markers
Refs.
GALI-lacZ
his3, leu2
24
GALI-IacZ
his3, trpl, leu2
17
GALI-lacZ
his3, leu2, trpl
25
GAL-CYCI-IacZ
his3, leu2, trpl
25
GALI-lacZ GALl-HIS3
trpl, leu2
12
GALI-lacZ GALl-HIS3
trpl. leu2
16
GAL-CYCI-IacZ GA L I-HIS3
his3, leu2, trpl
26
lexAop-lacZ
his3, leu2, trpl
15
lexAop-lacZ
his3, trpl, leu2
9
lexAop-LEU2
trpl, leu2, ura3
13
The cells are then plated onto a minimal media that lacks the appropriate nutrients for plasmid selection and, if appropriate, reporter gene expression. The recipes for standard yeast media can be obtained from other sources 2s'32 and are not included here. 32 C. Guthrie and G. R. Fink, "Guide to Yeast Genetics and Molecular Biology." Academic Press, San Diego, CA, 1991.
252
MOLECULARCLONES
[ 16]
Protocol
1. Inoculate 50 ml YEPD with yeast cells from a freshly grown culture. Incubate at 30 ° with shaking overnight. 2. Dilute the cells into 300 ml YEPD to give a final OD600 of 0.2. Incubate at 30 ° with shaking for 3 to 4 more hours. The culture should have an OD600 of about 0.5. 3. Pellet the cells by centrifugation (4000g, 5 rain, room temperature) 4. Resuspend the cells in 10 ml sterile H20. 5. Pellet the cells by centrifugation (6000g, 5 rain, room temperature) 6. Resuspend the cells in 1.5 ml TE/lithium acetate [10 mM Tris-C1, 1 mM EDTA, 100 m M CzH302Li made fresh from stocks of 100 mM Tris-Cl (pH 7.5), 10 mM EDTA, and 1 M CzH3OzLi (adjusted to pH 7.5 with dilute acetic acid)]. 7. Prepare the plasmid DNAs in a 1.5-ml microcentrifuge tube. Add 1-5~g of each plasmid and 100 ~g of single-stranded carrier D N A to each tube. The carrier DNA is prepared by dissolving D N A (salmon sperm or calf thymus) in H20, sonicating to reduce its viscosity, extracting with phenol/ chloroform [50% phenol (equilibrated to pH 8.0), 50% v/v chloroform] and then chloroform, and precipitating with ethanol. The carrier D N A is resuspended in TE [10 mM Tris-C1 (pH 8.0), 1 mM EDTA] at a concentration of 10 mg/ml and is denatured in a boiling water bath for 30 rain, then is chilled on ice. Aliquots can be stored frozen until they are needed. 8. Add 200 ~1 cell suspension to each tube of plasmid DNA. 9. Add 600 ~1 polyethylene glycol (PEG)/TE/lithium acetate [40% PEG, 10 mM Tris-C1, 1 mM EDTA, 100 mM C2H3OzLi made fresh from stocks of 50% PEG 3340, 100 mM Tris-C1 (pH 7.5), 10 mM EDTA, and 1 M C2H302Li (adjusted to pH 7.5 with dilute acetic acid)] to each tube. Mix gently. 10. Incubate at 30 ° for 30 min. 11. Add 90 bd fresh dimethyl sulfoxide (DMSO). Heat shock at 42 ° for 15 min. 12. Pellet the cells by centrifuging for 10 sec at high speed in a microcentrifuge. 13. Resuspend the pellet in 1 ml TE. Plate 100 ~1 of the cell suspension onto the appropriate selective media. Transformation of a reporter strain with a single plasmid yields 104 to 105 transformants/b~g plasmid DNA. If two plasmids are introduced simultaneously, the transformation frequency may drop by a factor of 10. Instead of introducing two plasmids simultaneously, some workers prefer to first transform with the plasmid expressing the hybrid of the DNAbinding domain with the target protein. The transformed strain is then
[ 16]
rWO-HVBalD SYSTEM
253
grown in selective media, and transformed with the activation domain plasmid. This method works well unless expression of the DNA-binding domain hybrid is detrimental to the reporter strain, in which case expression of this hybrid is often lost before the second transformation. For these hybrids, simultaneous transformation with the activation domain vector is necessary. Assaying .for Reporter Gene Expression After the transformants have grown into colonies, which usually takes 2 to 3 days in the absence of any selection for reporter gene expression, they must be tested for expression of a reporter gene. If the reporter gene encodes a protein, such as His3p or Leu2p, required for the synthesis of an amino acid, the colonies may grow slowly and take up to 10 days until they are visible. In either case, the most common reporter for the twohybrid system is the lacZ gene, because/3-galactosidase assays are simple, rapid, and easily quantified. The filter assay presented below is a sensitive method to test whether colonies on a plate express/3-galactosidaseY It is a useful method to assay transformants carrying defined hybrid proteins, usually on the third day after transformation. It is also used as a secondary screen of the rare positives that arise in a two-hybrid library search. Protocol 1. Prepare Z buffer [16.1 g/liter NazHPO4-7H20, 5.5 g/liter Nail2_ PO4" H20, 0.75 g/liter KC1, 0.246 g/liter MgSO4"7H20, 2.7 ml/liter 2-mercaptoethanol (add this fresh)] with 5-bromo-4-chloro-3-indolyl-/3-Dgalactopyranoside (X-Gal). To each 100 ml of Z buffer, add 1.67 ml of X-Gal stock (20 mg/ml X-Gal in N, N-dimethylformamide). 2. Add an aliquot of the Z buffer containing X-Gal to a clean petri dish. Use 1.8 ml for a 100-mm dish and 5 ml for a 150-ram dish. Layer a clean paper filter disc onto the buffer, taking care to avoid air bubbles. We use 75- or 125-ram-diameter VWR grade 413 filters, although other paper filters will also work. 3. Layer a sterile paper or nitrocellulose filter onto the plate of transformants, taking care to avoid air bubbles. Allow the filter to wet completely. 4. Remove the filter from the plate and place it in a pool of liquid nitrogen such that the colonies face up. Let the filter freeze for 5-10 sec. ~3L. Breeden and K. Nasmyth,Cold Spring Harbor Symp. Quant. BioL 50, 643 (1985).
254
MOLECULARCLONES
[ 161
5. Remove the filter from the liquid nitrogen and allow it to thaw completely at room temperature. 6. Layer the thawed filter, with the colonies facing up, onto the previously prepared filter that is soaked with Z buffer containing X-Gal. Take care to avoid air bubbles. 7. Incubate the filters at 30°. Strong positives may appear blue in as short as 30 rain whereas weaker positives may take overnight or longer to turn blue. The level of/3-galactosidase expression in yeast transformants can be quantified using one of two different colorimetric assays. The first uses the inexpensive substrate O-nitrophenyl-/3-o-galactopyranoside (ONPG), 34 and the second uses chlorophenol red-fl-o-galactopyranoside (CPRG) (see, for example, Iwabuchi et al.lt), which results in greater sensitivity. Prepare cultures for these assays by picking colonies to liquid selective media and incubating them at 30° on a roller or shaker.
Protocol 1. Grows cells in selective media to an OD600 of 0.5 to 1. 2. Pellet 0.1 to 1.5 ml of cells (depending on the expected enzyme activity) in a microcentrifuge tube. Resuspend the pellet in 0.8 ml Z buffer (see protocol for filter assay). 3. Add 50/xl CHC13 and 50/zl 0.1% (w/v) sodium dodecyl sulfate (SDS). Vortex the sample for 30 sec. 4. Add 0.16 ml of an ONPG stock solution [4 mg/ml in 100 mM phosphate buffer (pH 7.0)]. Mix well. 5. Incubate at 30° for a few minutes to 2 hr (depending on how rapidly the color changes). Quench the reaction by adding 0.4 ml of 1 M Na2CO3. 6. Spin the sample at high speed in a microeentrifuge for 10 min. 7. Measure the OD420 of the supernatant. Use a reaction mixture without added cells as a blank. 8. The/3-galactosidase activity can be calculated as OD420
Units of/3-galactosidase activity --- Vt(OD600) where V is the volume of culture used in milliliters and t is the reaction time in minutes. 34j. H. Miller, "Experiments in Molecular Genetics." Cold Spring Harbor Lab., Cold Spring Harbor, NY, 1972.
[ 16]
TWO-HYBRIDSYSTEM
255
Many interactions in the two-hybrid system result in a low level of fl-galactosidase expression not detected with ONPG as a substrate. For these cases, use C P R G as a substrate.
Protocol 1. Grow cells in selective media to an 0D600 of 0.5 to 1. 2. Pellet 0.1 to 5 ml of cells (depending on the expected enzyme activity) and resuspend in HEPES buffer (prepare 100 m M N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, 154 m M NaC1, 1% bovine serum albumin, adjust this solution to pH 7.2 with HC1, and add DL-aspartic acid, hemimagnesium salt to 2 raM, and Tween 20 to 0.05%) to a final volume of 765/xl. 3. Add 55/xl CHC13 and 55/xl of 0.1% (w/v) SDS to each tube. Vortex for 1 rain. 4. Add 125 tzl of a 40 m M stock (prepared in H20) of CPRG. 5. Mix the contents of the tube well and incubate at 37 °. 6. After a 20-min to 2-hr incubation (depending on how rapidly the color changes), stop the reaction with the addition of 10 txl of 100 m M ZnC12 to each tube. Mix the contents of the tube thoroughly. 7. Spin the tube at high speed in a microcentrifuge for 10 min. 8. Measure the 0D574 of the supernatant. Use a reaction mixture without added cells as a blank. 9. The/3-galactosidase activity can be calculated as Units of B-galactosidase activity =
1000 )< OD574 Vt(OD600) '
where V is the volume of culture used in milliliters and t is the reaction time in minutes.
Screening Libraries for Interacting Proteins One of the most useful applications of the two-hybrid system is to detect, from a large number of hybrids encoded by a genomic or cDNA library, proteins that interact with a protein of interest. In this application, a protein of interest expressed as a fusion protein containing a DNAbinding domain and total genomic or eDNA expressed as fusion proteins with an activation domain are cotransformed into a reporter strain. The rare transformants that express the reporter gene(s) are identified, and the activation domain plasmids from these positives are analyzed. The initial step in a two-hybrid search is to analyze the hybrid consisting of the target protein with the DNA-binding domain. Assay the DNAbinding domain hybrid alone for transcription of the reporter gene; there
256
MOLECULARCLONES
[ 161
must be no activity for this hybrid to be used in a two-hybrid search. If it does activate transcription, a search can be performed with a portion of the target protein that does not result in transcriptional activation (e.g., Iwabuchi et al.it). In addition, test whether the DNA-binding domain hybrid is expressed; if an antibody is available, check for production of the DNAbinding domain hybrid by Western analysis. If possible, check whether the target protein retains its activity in yeast. One critical assay is to determine whether the target protein can interact with a known protein partner in a two-hybrid assay if such a partner is available. If the target protein is known to complement a defect in yeast, the DNA-binding domain hybrid can be assayed for this property. The activation domain library is prepared by ligating the desired genomic D N A or cDNA to an activation domain vector. Table III provides a list of activation libraries that have been described in the literature. If the desired library is not available, it can be constructed using protocols found elsewhere. 27,28 Two-hybrid searches can be conducted as screens, by assaying for transformants that express the lacZ reporter gene, but are most often conducted using strains that allow for the selection of transformants that carry interacting hybrid proteins. These strains are cotransformed with the DNAbinding domain hybrid and the activation domain library, plating on media that select for the presence of both vectors and the expression of the reporter gene. Only those transformants that can activate the reporter gene will grow on the plate. In addition, the surviving transformants can be screened for those that express the lacZ reporter gene. By using a strain that carries two reporter genes with dissimilar promoters, many false-positives can be eliminated quickly (see "Identification of False Positive Proteins"). TABLE III ACTIVATIONDOMAINLIBRARIES Vector pPC86 pACT pJG4-5 pGADNOT pVP16 pGAD.F pPC86 pSD.10 pGAD.GH
DNA source
Ref.
Rat olfactory epithelium cDNA Epstein-Barr virus-transformed human peripheral lymphocyte cDNA HeLa cell cDNA HL-60 (human leukocyte) cell cDNA Mouse embryo (9.5 and 10.5 day) cDNA Saccharomyces cerevisiae genomic DNA Mouse embryo (14.5 day) cDNA HeLa cell cDNA HeLa cell cDNA
41 12 13 20 9 2 17 21 19
[ 161
TWO-HYBRIDSYSTEM
257
Introduction of the DNA-binding domain hybrid and the activation domain library into the reporter strain can be performed as a scaled-up version of the transformation procedure 29-3~ described previously, and outlined below.
Protocol 1. Grow the reporter strain (either with or without the plasmid encoding the DNA-binding domain hybrid) in 300 ml YEPD to an OD600 of about 0.5. 2. Pellet the cells by centrifugation (4000g, 5 min, room temperature). 3. Resuspend the cells in 10 ml sterile H20. 4. Pellet the cells by centrifugation (6000g, 5 min, room temperature). 5. Resuspend the cells in 1.5 ml TE/lithium acetate. 6. Prepare the plasmid DNAs in a 15-ml culture tube. Add 100 tzg of each plasmid (or only the activation domain plasmid if the strain already carries the plasmid encoding the DNA-binding domain hybrid) and 2 mg of single-stranded carrier DNA to the tube. 7. Add 2 ml cell suspension to the tube of plasmid DNA. 8. Add 6 ml PEG/TE/lithium acetate to the tube. Mix gently. 9. Incubate at 30° for 30 min. 10. Add 0.8 ml fresh DMSO. Heat shock at 42° for 15 min. 11. Pellet the cells by centrifuging for 2 min at half speed in a tabletop centrifuge. 12. Resuspend the pellet in 10 ml TE. Plate 300/~1 of the cell suspension onto 150-ram plates containing the appropriate selective media. If the transformation mix is plated onto media that select both for the two-hybrid plasmids and for reporter gene expression, be sure to also plate an aliquot onto media that select only for the presence of the DNA-binding and activation domain plasmids. This procedure will allow the total number of transformants to be calculated. The plates should be incubated at 30° until colonies appear, at which point expression of/3-galactosidase is assayed. Transformants positive both for growth and/3-galactosidase activity are picked either directly from the filter or from the corresponding colony on the original plate, and transferred to fresh media.
Recovery of Plasmids from Yeast After positive colonies have been purified, the activation domain plasmids should be recovered for further analysis. Since preparations of plasmid DNA from yeast are of poor quality and yield and are not useful for
258
MOLECULARCLONES
[ 161
restriction or sequence analysis, these plasmids are introduced into E. coliY A rapid procedure for preparing yeast plasmid DNA for introduction into E. coli is presented below. Protocol
1. Using a toothpick, transfer cells from a colony to 50/zl lysis solution [2% Triton X-100, 1% SDS, 100 mM NaC1, 10 mM Tris-C1 (pH 8.0), and 1 mM EDTA]. 2. Add 50/zl phenol/chloroform [50% phenol (equilibrated to pH 8.0), 50% chloroform] and ca. 0.1 g acid-washed glass beads (212-300/~m). 3. Vortex for 2 min. 4. Spin at high speed in a microcentrifuge for 5 min. 5. Transfer the supernatant to a clean tube and ethanol precipitate the DNA. Wash with 70% (v/v) ethanol and dry the pellet. 6. Resuspend the pellet in 10/xl H20. Use 1/~1 to transform electrocompetent E. coli. We usually obtain 100-1000 E. coli transformants when using this procedure. A similar but more rapid procedure has also been described? 6 If the activation domain plasmid carries the LEU2 gene, it is helpful to introduce the yeast DNA into a bacterial strain [such as MH4 (araD139 A(lac)X74 galU galK hsr- hsm + strA leuB-)] 37 that carries a leuB mutation because the LEU2 gene complements this mutation and allows the strain to grow on minimal media lacking leucine. Plasmid DNA can be prepared from the E. coli transformants by standard m e t h o d s . 27'28 Before being used for other analyses, recovered plasmids should be introduced into the reporter strain along with the plasmid expressing the target protein hybrid to confirm that the desired plasmid has been isolated. Often, multiple activation domain plasmids are introduced into individual cells during the transformation procedure, although only one of them is responsible for reporter gene activation. Maintaining selection for reporter gene (e.g., HIS3) activity on the positive yeast colonies while purifying them can increase the proportion of the plasmids being the desired ones, making these plasmids easier to isolate. Identification of False-Positive Proteins
A positive signal may be obtained from a library search even though the target protein and the protein encoded by the activation domain plasmid 35 C. S. Hoffman and F. Winston, Gene 57, 267 (1987). 36 p. Kaiser and B. Auer, BioTechniques 14, 552 (1993). 37 M. N. Hall, L. Hereford, and I. Herskowitz, Cell (Cambridge, Mass.) 36, 1057 (1984).
[ 16]
TWO-HYBRIDSYSTEM
259
do not interact with one anotherY Although some of these false-positive proteins activate transcription in the absence of a DNA-binding domain hybrid, many require the presence of a DNA-binding domain hybrid. False positives are eliminated by verifying that reporter gene expression is specific for the presence of the target protein hybrid and is not generated in the presence of other nonrelated DNA-binding domain hybrids. In addition. strains that carry two reporter genes with dissimilar promoters that both contain binding sites for the same DNA-binding domain can help eliminate many false positives. 25 Select only the putative positive clones that activate transcription of both reporter genes in the presence of the target protein hybrid. Strains such as Y15312 and H f 7 c 26 contain such reporter genes. Positives that meet the criterion of specificity are best confirmed using a biochemical assay for interaction. An additional genetic selection was developed to rapidly eliminate the DNA-binding domain vector from the reporter strain, leaving only the library plasmid present in the positive transformant. 16 The DNA-binding domain vector pAS2 (see Table I, Fig. 2) carries the CYH2 gene which confers cycloheximide sensitivity to a resistant yeast strain such as Y190 (see Table II). Growth of positive transformants on cycloheximide-containing media selects for the loss of this plasmid. Plasmids encoding various DNAbinding domain hybrids can be introduced into the resulting strain by a mating procedure to test whether or not the positive signal is due to a specific interaction with the target protein. Troubleshooting Sometimes interactions that occur normally in vivo are not detected when tested in the two-hybrid system. For example, if high level expression of one of the fusion proteins is toxic to the reporter strain, transformants will be unable to grow. Sometimes truncation of the toxic protein will alleviate its detrimental effect, yet still allow the interaction to occur or, alternatively, the hybrid could be expressed using a conditional promoter. Other reasons for not obtaining a signal include hybrid proteins that are not stably expressed in yeast, DNA-binding or activation domains that occlude the site of interaction, failure of the hybrid proteins to fold properly in yeast, or failure of the hybrid proteins to enter the nucleus. Different hybrid constructions might help, but in some cases there may be no way to detect an interaction using this system. A more common problem occurs when the protein fused to the DNAbinding domain activates transcription by itself. This activation is more likely to occur if the protein is a transcription factor but other proteins that are not involved in transcription may also activate transcription. In a
260
MOLECULARCLONES
[ 161
test involving two defined proteins, the two proteins can be switched to the opposite vectors such that the activating protein is fused to the activation domain instead of the DNA-binding domain. It may also be possible to delete the activation domain of the target protein. Less frequently an activation domain hybrid will activate transcription in the absence of a DNAbinding domain hybrid.
Mapping Domains Involved in Protein-Protein Interactions The two-hybrid system can be used to define interacting domains by assaying protein fragments for their ability to bind to a target protein or by screening large numbers of mutants to identify residues involved in a protein-protein interaction.3s DNA fragments encoding portions of an interacting protein can be generated by restriction enzyme digestion, Bal31 deletion, or by PCR and these can be cloned into the appropriate twohybrid vector. The ability of fragments encoded by each clone to interact with another hybrid can then be quickly assayed. For identifying specific residues that are involved in an interaction, a library of hybrid proteins containing point mutations is screened for mutants that have lost their ability to interact with the protein partner, as indicated below.
Protocol
1. Using PCR under suboptimal conditions,39 generate mutant fragments of the gene encoding all or part of one member of an interacting pair. 2. Clone these fragments into the appropriate vector to create a library of mutant hybrid proteins. Pool the bacterial colonies and prepare plasmid DNA. 3. Transform this library and the plasmid expressing a hybrid of the protein partner into a yeast reporter strain. Select for transformants that receive both plasmids. 4. Perform a filter assay for/3-galactosidase expression and identify colonies that are white or lighter blue than the unmutagenized control. These may represent mutants that have lost all or some of their ability to bind the protein partner. 5. Test these colonies with reduced/3-galactosidase activity for expression of the mutant hybrid protein by Western blot analysis. 38B. Li and S. Fields, FASEB J. 7, 957 (1993). 39D. W. Leung,E. Chen, and D. V. Goeddel, Technique 1, 11 (1989).
[ 16]
TWO-HYBRIDSYSTEM
261
6. For hybrid proteins that are full-length and stably expressed, isolate the plasmid encoding the mutant protein and determine the D N A sequence in the region that has been mutagenized.
Isolation of DNA-Binding Proteins In addition to identifying protein-protein interactions, many of the reagents that are used to perform two-hybrid system library searches can be used for the identification of proteins that bind to specific DNA sequences. 4°'41 The target D N A sequence of the putative binding protein is placed upstream of a reporter gene which is then integrated into yeast to create a new reporter strain. An activation domain library is introduced into the reporter strain and the transformants are then assayed for expression of the reporter gene. Hybrid proteins that bind to the test sequence are able to activate transcription of the reporter gene. The sequence of the DNAbinding protein is then obtained from the activation domain plasmid using methods discussed previously. Vectors for constructing yeast reporter genes include pRS315HIS, 4~ p601 42 and pTH1, 23 which carry HIS3 reporter genes. It is helpful to create, in parallel, a second strain carrying the same reporter gene with a mutated target sequence so that putative positive clones can be tested immediately to determine whether their binding is specific to the target D N A sequence. Included below is a brief protocol for screening activation domain libraries for site-specific DNA-binding proteins. Protocol
l. Construct a plasmid containing the target D N A sequence upstream of a reporter gene such as HIS3 or lacZ (or make both constructions). 2. Integrate the reporter gene(s) construct in an appropriately marked yeast strain. Verify that the vector has been integrated correctly by Southern blot analysis. Alternatively, transform a replicating plasmid to create the reporter strain and maintain selection for the reporter plasmid. 3. Check to ensure that the reporter strain does not express the reporter gene(s) constitutively. 4. Introduce the appropriate activation domain library into the reporter strain. Select for transformants that express the reporter gene(s). 4o j. j. Li and I. Herskowitz, Science 262, 1870 (1993). 4~ M. M. Wang and R. R. Reed, Nature (London) 364, 121 (1993). 4_~C. Alexandre, D. A. Grueneberg, and M. Z. Gilman, Methods 5, 147 (1993).
262
MOLECULARCLONES
[ 161
5. Isolate DNA from the yeast and electroporate into E. coli to isolate the activation domain plasmid. 6. Determine the sequence of the insert in the plasmid. Other Applications Other potential applications of the two-hybrid system include using it to screen for compounds that disrupt a protein-protein interaction, screening for peptides that bind to a target protein, and generating a "protein linkage map" that describes all the detectable protein-protein interactions in a cell. These applications are discussed briefly below. Compounds could be screened for their ability to inhibit a proteinprotein interaction by establishing a reporter system in which a readily detected protein, such as luciferase, is produced as a result of a two-hybrid interaction. This system could be yeast based or it could be a mammalian cell line. 43 The ceils are then treated with each member of a library of compounds, and assays are performed to detect compounds that reduce the amount of reporter transcription. As a control, a parallel line carrying two hybrid proteins, which are unrelated to the target proteins and result in similar reporter gene expression, is also treated with each compound. This control eliminates from further study compounds that bind to the DNA-binding or activation domain, that are generally deleterious for transcription, or that are toxic to the cells. The two-hybrid system is capable of detecting the interaction of a protein with a small peptide. An example of this interaction is that between the Rb protein and a peptide derived from the Simian virus 40 large T antigen. 44,45 With Rb fused to the Gal4p DNA-binding domain and the T antigen peptide fused to the Gal4p activation domain, only a L e u - X - C y s X-Glu sequence present in the T antigen peptide is required for reporter gene expression. Screening an activation domain library that consists of synthetic oligonucleotides encoding 16 amino acid residue-long peptides resulted in the identification of several peptides containing the L e u - X Cys-X-Glu motif.45 The two-hybrid system might also be used to identify large numbers of interacting proteins by preparing libraries in both the DNA-binding and activation domain vectors and screening them against one another. The plasmids encoding the DNA-binding and activation domain library fusions 43C. V. Dang, J. Barrett, M. Villa-Garcia,L. M. S. Resar, G. J. Kato,and E. R. Fearon,Mol. Cell. Biol. 11, 954 (1991). T. Durfee, B. Gorovits, C. Hensey,and W.-H. Lee, submittedfor publication. 45M. Yang, Z. Wu, and S. Fields,Nucleic Acids Res., in press.
[17]
GENE TRAP RETROVIRUSES
263
could be isolated and a short sequence of each insert would be obtained. Each pair of sequences from a positive serves as a tag for a protein-protein interaction. This screening should result in the identification of networks of interacting proteins to create a so-called protein linkage map. This information would identify new protein-protein interactions and would help place novel proteins into some cellular pathway. Acknowledgments We thank Gaff Mandel for comments on the manuscript and for sharing unpublished data, Erica Golemis and Stan Hollenberg for plasmid maps, Bin Li and Kuniyoshi lwabuchi for the CPRG assay protocol, and Judy Nimmo for assistance with the manuscript.
[ 17] By GEOFFREY
Retrovirus
Gene Traps
G . HICKS, ER-GANG SHI, JIN CHEN, MICHAEL ROSHON,
D O U G W1LLIAMSON, CHRISTINA SCHERER,
and H.
E A R L RULEY
Introduction The study of mammalian cells and animals has been hampered by the lack of efficient genetic systems as are commonly available for lower organisms. Despite improved molecular methods, genes responsible for organismal phenotypes are still difficult to clone. Moreover, relatively few mutant alleles are available for study, particularly those that are recessive or affect embryonic development. To help identify mammalian genes responsible for recessive phenotypes, several types of gene trap retroviruses have been developed for use as insertional mutagens. The viruses permit direct selection of cell clones in which expressed genes have been disrupted as a result of virus integration. The U3 gene traps contain coding sequences for a selectable marker inserted into the U3 region of the long terminal repeat (LTR). Provirus integration positions the 5' copy only 30 nucleotides from the flanking cellular DNA (Fig. 1A), and selection for U3 gene expression generates cell clones in which the proviruses have inserted in or near exons of transcriptionally active genes. 1-4 The splicing-activated gene traps (Fig. 1B) contain a selectable t H. von Melchner and H. E. Ruley, J. Virol. 63, 3227 (1989). 2 H. von Melchner, J. DeGregori, H. Rayburn, C. Friedel, S. Reddy, and H. E. Ruley. Genes Dev. 6, 919 (1992). 3 S. Reddy, J. DeGregori, H. von Melchner, and H. E. Ruley, J. Virol. 65, 1507 (1991). W. Chang, C. Hubbard, C. Friedel, and H. E. Ruley, Virology 193, 737 (1993).
METHODS IN ENZYMOLOGY,VOL.254
Copyright(c: 1995by AcademicPress,Inc. All rightsof reproductionin any formreserved.