- Email: [email protected]
16S–23S rDNA Intergenic Spacer Region Polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as Revealed by PCR and Nucleotide Sequence Analysis
System. Appl. Microbiol. 25, 520–527 (2002) © Urban & Fischer Verlag http://www.urbanfischer.de/journals/sam
16S–23S rDNA Intergenic Spacer Region Polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as Revealed by PCR and Nucleotide Sequence Analysis Giuseppe Blaiotta, Olimpia Pepe, Gianluigi Mauriello, Francesco Villani, Rosamaria Andolfi, and Giancarlo Moschetti Dipartimento di Scienza degli Alimenti, Sezione di Microbiologia Agraria, Alimentare ed Ambientale e di Igiene, Università degli Studi di Napoli “Federico II”, Portici, Italy Received: August 15, 2002
Summary The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of “Fior di Latte” cheese were analyzed. After 16S–23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S–23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S–23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates. Key words: 16S–23S rDNA ISR – L. lactis – L. garvieae – L. raffinolactis – S. thermophilus – S. suis – S. parauberis
Introduction Lactococcus (L.) garvieae and L. raffinolactis are commonly isolated, as “non-dominant” species, in the dairy environment such as natural starter cultures, raw milk, curd and cheese [23, 32, 39, 43]. However, L. garvieae is also considered an emerging zoognotic pathogen that has been isolated from cattle, fish and humans [6, 7, 16, 29, 48] even though their role as infection agents remains unclear [1]. L. garvieae, L. raffinolactis and L. lactis are genealogically quite distinct but phenotypically closely related, making their differentiation on the basis of phenotypic criteria very difficult [13, 40]. Ribosomal RNA gene restriction patterns and rRNA-targeted oligonucleotide probes allow the five currently recognized lactococcal species to be distinguished [28, 40]. It is well known that non-starter lactic acid bacterial floras, particularly raw milk microflora, increase the diversity of cheese flavors and may also be involved in producing the typical organoleptic characteristics of cheeses during ripening [12, 31, 18].
Therefore, it is of primary importance to obtain a reliable description of the physiologically active microbial community in order to understand the role that the different species of lactic acid bacteria play in dairy fermentation. Classically, such questions are addressed through the enumeration of some microbial groups on a variety of culture media, followed by identification through traditional microbiological methods. This approach is generally time-consuming, and only a limited number of isolates can be identified. Molecular identification methods are a powerful alternative to the conventional differentiation of bacteria by plating especially when closely related species are analyzed. Detecting and identifying various species with rapid methods is also important for in vivo monitoring fermentation processes and for quality control (especially in mixed cultures). At species level there are several reports on specific identification systems for LAB, mainly based on 16S ribo0723-2020/02/25/04-520 $ 15.00/0
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis
somal RNA gene (rDNA) [15, 24, 25]. However, it has been widely shown [4, 27, 21, 19] that the ribosomal ISRs are more variable between bacterial species than 16S and 23S rDNA. Following this approach, the 16S–23S rDNA ISR has already been successfully used as a speciesspecific marker to distinguish dominant LAB species occurring in dairy products [5, 9, 33, 34, 38, 37, 44]. In this paper we describe the sequence analysis of the 16S–23S rDNA ISR of L. garvieae and L. raffinolactis and the possibility of rapidly distinguishing these “non-dominant” species from strains of the genus Lactococcus (L.), Streptococcus (S.), Lactobacillus (Lb.), Enterococcus (E.)
521
and Leuconostoc (Ln.) that normally dominate dairy environments. Moreover, the suitability of this approach to differentiate LAB strains at species level was validated by testing wild streptococcal strains isolated during traditional Italian “Pasta Filata” cheese production.
Materials and Methods Bacterial strains and culture conditions The reference strains used in this study are listed in Table 1. 127 wild streptococcal strains, isolated (see below) during the whole “Fior di Latte” cheese-making process, were also used
Table 1. Reference strains used in this study Species
Strains
Origina
Source
E. casseliflavus E. durans E. faecalis E. faecium L. lactis subsp. lactis L. lactis subsp. lactis L. lactis subsp. cremoris L. lactis subsp. hordniae L. garvieae L. raffinolactis S. thermophilus S. salivarius Lb. delbrueckii subsp. bulgaricus Lb. delbrueckii subsp. lactis Ln. mesenteroides subsp. mesenteroides Ln. mesenteroides subsp. dextranicum Ln. mesenteroides subsp. cremoris
ATCC 25788T ATCC 11576 ATCC 19433T ATCC 19434T DSM 20481T ATCC 11454 DSM 4645 DSM 20450T DSM 20684T DSM 20443T NCDO 822 DSM 20560T DSM 20081T DSM 20072T DSM 20343T DSM 20484T DSM 20346T
ATCC ATCC ATCC ATCC DSM ATCC DSM DSM DSM DSM NCIMB DSM DSM DSM DSM DSM DSM
Plant material Cheddar cheese – – – – – – Bovine mastitis Raw milk German yoghurt Human blood Bulgarian yoghurt Emmental cheese Fermented olives – Dried starter powder
T
, Type strain; aATCC, American Type Culture Collection, Rockville, Maryland, USA; DSM, Deutsche Samlung von Mikroorganismen, Brauschweig, Germany; NCIMB, National Collection of Industrial and Marine Bacteria, Aberdeen, Scotland, UK.
Table 2. 16S–23S rDNA intergenic spacer patterns of strains isolated during the whole fermentation process of “Fior di Latte” cheese Samplesa
Isolation temperature
n° isolates analysed
Reference patternsb –––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– A B C D E F G H
Other patterns c ––––––––––––––––––––––––––––––––––––––– I L
M Co CF PF
30 °C
33 14 35 9
2d 3
1f 1
M Co CF PF
44 °C
a
4 8 9 15
20 7 30 5
8e 2 1
1 1 2 3
2 1
4 4 6 14
4 3 1
1g
M, raw milk; Co, curd at beginning of ripening; CF, curd at the end of ripening; PF, “Fior di Latte” cheese. Reference patterns: A) L. garvieae; B) L. lactis ; C) L. raffinolactis; D) S. thermophilus and S. salivarius; E) E. faecalis, E. casseliflavus and E. durans; F) E. faecium; G) Lb. delbrueckii; H) Ln. mesenteroides. c Other patterns, different from those of reference strains: I) with one class of spacer located at about 540 bp; L) with 1 one class of spacer located at about 510 bp. d Among strains of this group, L. garvieae SAP L1-5 was analysed by sequencing. e Among strains of this group, L. raffinolactis SAP 37 was analysed by sequencing. f Among strains of this group, Streptococcus spp. SAP 77 was analysed by sequencing. g Among strains of this group, Streptococcus spp. SAP 99 was analysed by sequencing. b
522
G. Blaiotta et al.
(Table 2). All strains were stored at –30 °C in appropriate broths with 25% (v/v) sterile glycerol. Working cultures were prepared on M17 (Oxoid, Unipath Limited, Basingstoke, Hampshire) agar (streptococci, lactococci and enterococci) and on MRS (Oxoid) agar (lactobacilli and leuconostocs). Sampling and isolation of wild bacterial strains A traditional Italian unripened “Pasta Filata” cheese called “Fior di Latte” was manufactured as previously described [35]. Samples were collected from a dairy at Agerola (Province of Naples, Southern Italy). Sampling was performed during one cycle of cheese production. The samples, stored at 4 °C, were transferred to the laboratory, homogenized and serially diluted (until 10–9) in 0.1% peptone water. For the purpose of this study, six 0.1 ml of each dilution were surface-plated on M17 agar and incubated at 30 °C (3 plates) and 44 ° C (3 plates) for 48 h. From countable plates, 127 colonies (91 and 26 from plates incubated at 30 °C and 44 °C, respectively) were randomly isolated and stored for further characterization. Amplification of the 16S–23S rDNA ISR and 16S rDNA DNA extraction was carried out from a single colony by using an InstaGene Matrix (Bio-Rad Laboratories, Hercules, CA) following the conditions described by the supplier. About 25 ng of DNA were used for PCR amplification. Synthetic oligonucleotide primers G1 (5’GAAGTCGTAACAAGG3’) and L1 (5’CAAGGCATCCACCGT3’) described by Jensen et al. (1993) were used to amplify the 16S–23S rDNA ISR. The first primer, G1, was selected from a high conserved region immediately adjacent to the 16S–23S rDNA ISR (30–40 bp nucleotide upstream); while, the second, L1, represents a conserved region of the 23 rDNA located at about 20 bp downstream the 16S–23S rDNA ISR. PCR conditions consisted of 25 cycles (1 min at 94 °C, 2 min at 55 °C, 3 min at 72 °C) plus one additional cycle at 72 °C for 10 min as a final chain elongation. Synthetic oligonucleotide primers fD1 (5’AGAGTTTGATCCTGGCTCAG3’; positions 8-27 of E.coli 16S rDNA) and rD1 (5’AAGGAGGTGATCCAGCC3’; positions 1524-1540 of E. coli 16S rDNA) described by Weisburg et al. [47] were used to amplify the 16S rDNA. PCR conditions consisted of 30 cycles (1 min at 94 °C, 45 sec at 54 °C, 2 min at 72 °C) plus one additional cycle at 72 °C for 7 min as a final chain elongation. The presence of PCR products was verified by agarose (2% w/v) gel electrophoresis at 7 V cm–1 for 2–3 h. Cloning, sequencing and nucleotide sequence accession numbers The 16S–23S rDNA spacer region of L. lactis subsp. lactis ATCC 11454, L. garvieae DSM 20684T, L. raffinolactis DSM 20443T and of 4 wild strains (SAP L1-5, SAP 37, SAP 77 and SAP 99; see Table 2) and 16S rDNA of wild strains SAP 77 and SAP 99 were amplified as described above. PCR fragments were
purified from agarose gel by using a QIAquick gel extraction kit (Qiagen S. p. A., Milan) and cloned into the pCR-Script SK(+) cloning vector (Stratagene, La Jolla, CA). The DNA sequence of the cloned fragments was determined by the dideoxy chain termination method [41] by using the DNA sequencing kit (Perkin-Elmer Cetus, Emeryville, CA) according to the manufacturer’s instructions. The sequences were analyzed by MacDNasis Pro v3.0.7 (Hitachi Software Engineering Europe S. A., Olivet Cedex, F) and research for DNA similarity was performed with the GenBank and EMBL database. The GenBank accession numbers (a.n.) of 16S–23S spacer sequences are AF284218 for L. lactis subsp. lactis ATCC11454, AF225967 for L. garvieae DSM 20684T, AF284219 for L. raffinolactis DSM 20443, AF284220 for the strain SAP 37, AF284576 for the strain SAP77, AF225968 for the strain SAP L1-5 and AF284577 for the strain SAP 99. Accession numbers of 16S rDNA are AF284578 for the strain SAP 77 and AF284579 for the strain SAP 99.
Fig. 1. Etidium bromide-stained 2% agarose gel of PCR-amplified 16S–23S intergenic spacer regions of some LAB strains used in this study. Line a, L. garvieae DSM 20684T; line b, L. lactis subsp. lactis DSM 20481T; line c, L. raffinolactis DSM 20443T; line d, S. thermophilus NCDO 822; line e, E. faecalis ATCC 19433T; line f, E. faecium ATCC 19434T; line g, Lb. delbrueckii subsp. bulgaricus DSM 230081T; line h, Ln. mesenteroides subsp. mesenteroides DSM20343T; line i, strain SAP 77; line j, strain SAP 99. 1 Kb DNA Ladder (Gibco BRL) used as molecular weight marker.
Fig. 2. Multiple alignment of some regions of the 16S–23S ISR of L. lactis subsp. lactis [strain ATCC 11454, this study], L. raffinolactis [strain DSM 20433T, this study], L. garvieae [strain DSM 20684T, this study], S. suis [strain SAP 77, this study], S. parauberis [strain SAP 99, this study] and S. thermophilus [strain ATCC 19528 [37]. The extremities of the tRNA coding region (tRNA-Ala), sequences involved in formation of the double-strand processing sites (dsPS), sequence of stem/loop structure I downstream of tRNA and regions A and B (nt 1–10 and 222–243, respectively) are shown. Sequence differences compared with tRNA-Ala of E. coli are indicated by nucleotides in squares. The conserved [in L. lactis, S. thermophylos, S. salivarius and S. pneumonie [37] TTGT and TTG sequences that border the 5’ and 3’ ends of the tRNA coding sequences are boxed. The nucleotide sequence of stem/loop structure I downstream of tRNA of L. lactis and S. thermophilus are underlined. The DNasis pro.v 3.0.7 program (Hitachi) was used for the sequence alignment. Nucleotide numbers correspond to positions in the L. lactis sequences. Gaps correspond to insertions and dots to missing nucleotides. When a significant degree of similarity was found between aligned sequences (the same nucleotide in at least four of the aligned sequences) these common nucleotides are indicated in grey.
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis
523
524
G. Blaiotta et al.
Results PCR amplification of the 16S–23S rDNA ISR Primers G1 and L1 were used to amplify the 16S–23S rDNA ISR from genomic DNA of 17 reference strains (representing 11 different LAB species) and 127 wild streptococcal gram-positive catalase-negative strains isolated during the whole fermentation process of “Fior di Latte” cheese (Table 2). On the basis of the 16S–23S rDNA ISR PCR pattern displayed, the reference strains (Figure 1, lines a to h) were gathered in the following 8 groups: A) L. garvieae (1 band located at about 430 bp); B) L. lactis (1 band located at about 380 bp); C) L. raffinolactis (1 band located at about 450 bp); D) S. thermophilus and S. salivarius (1 band located at about 360 bp); E) E. faecalis, E. casseliflavus and E. durans (2 bands located at about 300 and 400 bp); F) E. faecium (2 bands located at about 410 and 510 bp); G) Lb. delbrueckii (2 bands located at 320 and 520 bp); H) Ln. mesenteroides (1 bands located at 470bp). According to the results shown above, the 127 wild strains could be grouped as follows: 62 strains showed pattern B (L. lactis); 34 pattern D (S. thermophilus/salivarius), 12 pattern E (Enterococcus spp.), 11 pattern C (L. raffinolactis), and 5 pattern A (L. garvieae) (Table 2 and Figure 1, lines a to e). Three wild strains showed 16S–23S rDNA ISR patterns different from those of reference strains: SAP 77 and SAP 192, with 1 band located at 540bp (Figure 1, line j) and SAP 99, with 1 band located at 510 bp (Figure 1, line l). No amplified fragments referable to the species E. faecium were found among the 127 wild strains analyzed. Sequencing and nucleotide sequence analysis The 16S–23S rDNA ISR of L. lactis subsp. lactis ATCC 11454, L. garvieae DSM 20684T, L. raffinolactis DSM 20443T and of 4 wild strains (SAP L1-5, SAP 37, SAP 77 and SAP 99) were cloned and sequenced. In all sequences we found that the nucleotide primer G1 targets 52 bp of the 3’ end of 16S rDNA and the primer L1 targets 29 bp of the 5’ end of 23S DNA. Consequently, the length of the 16S–23S rDNA ISR sequences are 81 bp shorter than those displayed after PCR amplification and agarose gel electrophoresis . The 16S–23S DNA ISR sequences of L. lactis subsp. lactis ATCC 11454 and strain IL 1403 (a.n. X64887, [9]), L. raffinolactis DSM 20433T and strain SAP 37, L. garvieae DSM 20684T and strain SAP L1-5 displayed an high level of homology (99.6%, 100% and 99.7%, respectively). The sequence of L. lactis was homologous to L. raffinolactis and L. garvieae at 69,1% and 60,8%, respectively. Nucleotide sequences of 16S–23S rDNA ISR of unidentified strains SAP 77 and SAP 99 were very different both from them (< 60% of similarity) that in comparison to lactococci analysed in this study (< 50% of similarity).
Research of DNA homologies, performed with the GenBank and EMBL database, of nucleotide sequences 16S–23S rDNA ISR of unidentified strain SAP 99 showed 68.5% similarity with Streptococcus uberis (a.n. U39768); while the unidentified strain SAP 77 displayed 71% similarity with a wide group of streptococci such as S. thermophilus (a.n. U32965), S. salivarius (a.n. X83760), S. difficile (a.n. AF064441), S. agalactiae (a.n. L31412), S. bovis (a.n. U39766) and S. waiu (a.n. AF088899) (results not shown). DNA similarity of the full nucleotide sequences of the 16S rDNA of the isolates SAP 99 (1541 bp, an. AF284579) and SAP 77 (1549 bp, an. AF284578) were searched in the Gene Bank database so as to recognize them as belonging to a particular species. Strain SAP 77 displayed 99% of homology with S. suis (a.n. AF009497, [8]), while strain SAP 99 showed 99% of homology with S. parauberis (a.n. X89967, [14]). Therefore, strains SAP 77 and SAP 99 were identified as belonging to the species S. suis and S. parauberis, respectively. Nucleotide sequences of some regions of the 16S–23S rDNA ISR of L. lactis subsp. lactis ATCC 11454, L. raffinolactis DSM 20433T, L. garvieae DSM 20684T, S. suis SAP 77, S. parauberis SAP99 and S. thermophilus ATCC 19528 [37] are shown Fig. 2. Multiple alignment analysis of the six sequences (Fig. 2) showed that the 5’ end (Region A, pos. 1–10), the coding region of tRNA-Ala (pos. 94–166) and one of the sequences involved in the formation of double-stranded processing sites (dsPS2; pos. 197–218) were characterized by an high level of similarity in both lactococci and streptococci. Particularly, the 5’ end of the 16S–23S rDNA ISR (region A) of L. lactis was identical to those of L. garvieae while the same region of L. raffinolactis was identical to those of S. suis and S. thermophilus. However, the first eight nucleotide of this region are high conserved in both streptococci and lactococci analyzed in this study. This eight nucleotide were supposed by NOUR et al. [37] as involved in the final maturation step leading to mature 16S rDNA. The tRNA-Ala gene of the 16S–23S rDNA ISR of L. lactis, L. garvieae, L. raffinolactis, S. thermophilus, S. suis, S. paraubers are identical. They differ at six positions, as compared with the corresponding E. coli tRNAAla gene (Fig. 2). The tRNA gene organization in the 16S–23S rDNA ISR of the species analysed in this study is identical to that previously found for S. pneumoniae [2] and E. hirae [42]. By contrast, the sequences located on the 5’ and 3’ side of the tRNA-Ala gene (Fig. 2) are identical for L. lactis and S. thermophilus (TTGT-5’ and 3’-TTG) significantly different among the other species analysed. Because present also in S. salivarious and S. pneumoniae these sequences were supposed a characteristic feature of Streptococcus genus by Nour et al. [37]. Nevertheless, these sequences are not similar to those of S. suis and S. parauberis. The sequences of the dsPS2, involved in the formation of double-stranded processing sites, were also high con-
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis
served in both streptococci and lactococci, displaying only one nucleotide change among the six species analysed. A middle level of similarity among sequences was found in the region B (Fig. 2, pos. 232–243), this region is conserved in S. thermophilus and S. suis and differ for 2–4 nucleotide in the other species. The nucleotide sequences of the dsPS1 (pos. 35–46) and of stem/loop structure I downstream of the tRNA (pos. 167–177) were characterized by a high degree of divergence. The dsPS1 sequences were identical in L. lactis and L. garvieae, while differing in 9 bp of 23 in L. raffinolactis among lactococci; the same region was identical for S. thermophilus and S. parauberis while differing in 4 bp of 23 in S. suis among streptococci. Finally, the sequence of stem/loop structure I downstream of the tRNA was very different among both streptococci and lactococci.
Discussion Identification and differentiation of L. garvieae, L. lactis subsp. lactis and L. raffinolactis as well as some enterococci on the basis of their phenotypical traits are very difficult [40, 17, 23]. Therefore, 16S rDNA sequencing or 16S rDNA specific primers are becoming commonly used to differentiate L. lactis from L. garvieae and L. raffinolactis [48, 6, 3]. Our results show that the 16S–23S rDNA ISR sequences vary greatly, in size and sequence, among L. garvieae, L. raffinolactis, L. lactis. Sequence similarity level between L. lactis and L. garvieae was 69% whereas they showed a similarity level of 60% with respect to L. raffinolactis. Moreover, the sequence of the 16S–23S rDNA ISR of lactococci differ greatly in comparison to streptococci commonly isolated from dairy environments. Data obtained from comparisons between 16S–23S spacer patterns of the reference strains and those of the strains isolated during the fermentation process show that this approach is very useful to describe microbial communities in the product. Nevertheless, when reference strains are not available, 16S–23S rDNA spacer or 16S rDNA sequencing is necessary. In fact, in this study we were able to identify all the wild strains tested with the exception of strains SAP 77 and SAP 99. These strains were identified as Streptococcus spp. on the basis of the 16S–23S DNA spacer sequence and as S. suis and S. parauberis on the basis of the 16S rDNA sequence. Therefore, the 16S–23S DNA spacer-based identification system, as a rapid alternative method, can complement or even replace microbiological and biochemical methods of identification of L. lactis, L. garvieae and L. raffinolactis as well as other streptococci from dairy environments. By using this approach, we found that L. lactis, S. thermophilus and Enterococcus spp. are major members of the microbial community of “Fior di Latte” cheese: they were detected in all the phases of cheese manufacturing. Furthermore, strains of L. raffinolactis were detectable from raw milk to curd at the end of ripening, strains referable to
525
L. garvieae and S. suis were detectable from raw milk to curd at the beginning of ripening while strains referable to S. parauberis were detectable only in the raw milk. S. suis is an important cause of a wide verity of infection in pigs [10, 46] and has also been reported as a pathogen for human [45]. S. parauberis has reported as a rare mastitis-causing pathogen [26, 30]. This species seems to be more frequent among British dairy herds [20]. Isolation of S. parauberis from diseased fish was described by Domenech et al. [14]. Processing and environmental conditions applied during traditional “Fior di Latte” cheese manufacturing, that relies upon spontaneous fermentation of raw cow’s milk [35], promote the growth of only part of the complex association of microorganisms present in raw milk. Finally, because of the high degree of inter-specific polymorphism observed in this study, 16S–23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal and streptococcal isolates. Recently, species–specific region of the 16S and 23S rDNA and the 16S–23S rDNA ISR were used to construct species-specific primers in order to identify and differentiate S. uberis and S. parauberis [22]. Furthermore, application of the 16S–23S rDNA spacer technique on total microbial DNA directly extracted from food could allow recognition of technologically interesting species within complex microbial communities, detection of potential pathogenous microbes (e.g. L. garvieae, S. suis and S. paraubers) occurring at lower levels associated with raw milk and could offer a reliable instrument to study microbial communities without their cultivation. Indeed, culture-independent methods in comparison to culture-dependent approaches can provide a more realistic view of microbial diversity, as recently demonstrated in different “Mozzarella” cheeses by Coppola et al. [11]. These authors, by analyzing DNA directly isolated from “Fior di Latte” cheese samples using this technique, obtained complex patterns with some bands unidentified owing to the lack of information about the 16S–23S rDNA spacer region length of a large number of dairy microorganisms. The results of this work fit perfectly within the scope of “in situ” analysis of microbial communities, providing new information about the 16S–23S rDNA spacer region length of L. garvieae, L. raffinolactis, S. suis and S. parauberis.
Acknowledgements This work was supported by a grant from the National Research Council of Italy, Rome.
References 1. Aguirre, M., Collins, M. D.: Lactic acid bacteria and human clinical infection. J. Appl. Bacteriol. 75, 95–107 (1993).
526
G. Blaiotta et al.
2. Baccot, C. M., Reeves, R. H.: Novel tRNA gene organization in the 16S–23S intergenic spacer of the Streptococcus pneumoniae rRNA gene cluster. J. Bacteriol. 173, 4234–4236 (1991). 3. Barrakat, R. K., Griffiths, M. W., Harris L. J.: Isolation and characterization of Carnobacterium, Lactococcus, and Enterococcus spp. from cooked, modified atmosphere packaged, refrigerated, poultry meat. Int. J. Food Microbiol. 62, 83–89 (2000). 4. Barry, T., Colleran, G., Glennon, M., Dunican, L. K., Gannon, F.: The 16S/23 S ribosomal spacer region as a target for DNA probes to identify eubacteria. PCR Methods Appl. 1, 51–56 (1991). 5. Berthier, F., Ehrlich, S. D.: Rapid species identification within two groups of closely related lactobacilli using PCR primers that target the 16S/23S rRNA spacer region. FEMS Microbiol. Lett. 161, 97–106 (1998). 6. Cai, Y., Suyanandana, P., Saman, P., Benno, Y.: Classification and characterization of lactic acid bacteria isolated from the intestines of common carp and freshwater prawns. J. Gen. Appl. Microbiol. 45, 177–184 (1999). 7. Carson, J., Gudkovs, N., Austin, B.: Characteristics of an Enterococcus-like bacterium from Australia and South Africa, pathogenic for rainbow trout (Oncorhynchus mykiss Walbaum). J. Fish Disease 16, 381–388 (1993). 8. Chatellier, S., Harel, J., Zhang, Y., Gottschalk, M., Higgins, R., Devriese, L., Brousseau, R.: Phylogenetic diversity of Streptococcus suis strains of various serotypes as revealed by 16S rRNA gene sequence comparison. Int. J. Syst. Bacteriol. 48, 581–589 (1998). 9. Chiaruttini, C., Milet, M.: Gene organization, primary structure and RNA processing analysis of a ribosomal RNA operon of Lactococcus lactis. J. Mol. Biol. 230, 57–76 (1993). 10. Clifton-Hadley, F. A.: Styreptococcus suis type 2 infections. Br. Vet. J. 139, 1–5 (1983). 11. Coppola, S., Blaiotta, G., Ercolini, D., Moschetti, G.: Molecular evaluation of microbial diversity occurring in different types of Mozzarella cheese. J. Appl. Microbiol. 90, 414–420 (2001). 12. Corroler, D., Mangin, I., Desmasures, N., Gueguen, M.: An ecological study of lactococci isolated from raw milk in the Camembert cheese Registered Designation of Origin Area. Appl. Environ. Microbiol. 64, 4729–4735 (1998). 13. Deasy, B.M., Rea, M.C., Fitzgerard, G.F., Cogan, T.M., Beresford, T.P.: A rapid PCR based method to distinguish between Lactococcus and Enterococcus. Syst. Appl. Microbiol. 23, 510–522 (2000). 14. Domenech, A., Fernandez-Garayzabal, J. F., Pascual, C., Garcia, J. A., Cutuli, M. T., Moreno, M. A., Collins, M. D., Dominguez, L.: Streptococcosis in cultured tufbot (Scophthalmus maximum) associated with Streptococcus parauberis. J. Fish Disease 19, 33–38 (1996). 15. Ehrmann, M., Ludwig, W., Schleifer, K. H.: Reverse dot blot: a useful method for the direct identification of lactic acid bacteria in fermented food. FEMS Microbiol. Lett. 117, 143–150. (1994). 16. Elliot, J. A., Collins, M. D., Pigott, N. E., Facklam, R. R.: Differentiation of Lactococcus lactis and Lactococcus garvieae from human by comparison of whole-cell protein patterns. J. Clin. Microbiol. 29, 2731–2734 (1991). 17. Elliot, J. A., Facklam, R. R.: Antimicrobial susceptibilities of Lactococcus lactis and Lactococcus garvieae and proposed method to discriminate between them. J. Clin. Microbiol. 34, 1296–1298 (1996). 18. Fox, P. F., Wallace, J. M., Morgan, S., Lynch, C. M., Niland, E. J., Tobin, J.: Acceleration of cheese ripening. Anton. van Leeuwen. 70, 271–297 (1996).
19. Garcìa-Martìnez, J., Acinas, S. G., Anton, A. I., RodriguezValera, F.: Use of the 16S–23S ribosomal genes spacer region in studies of prokaryotic diversity. J. Microbiol. Methods, 36, 55–64 (1999). 20. Garvie, E. I., Bramley, A.: Streptococcus uberis: an approach to its classification. J. Appl. Bacteriol. 46, 295–304 (1979). 21. Gurtler, V., Stanisich, V. A.: New approaches to typing and identification of bacteria using the 16S–23S rDNA spacer region. Microbiology 142, 3–16 (1996). 22. Hassan, A. A., Khan, I. A., Abdulmawjood, A., Lammler, C.: Evaluation of PCR for rapid identification and differentiation of Streptococcus uberis and Streptococcus parauberis. J. Clin. Microbiol. 39, 1618–1621 (2001). 23. Hatzikamari, M., Litopoulou-Tzanetaki, E., Tzanetakis, N.: Microbiological characteristics of Anevato: a traditional Greek cheese. J. Appl. Microbiol. 87, 595–601 (1999). 24. Hensiek, K., Krupp, G., Stackebrandt, E.: Development of diagnostic oligonucleotide probes for four lactobacillus species occurring in the intestinal tract. Syst. Appl. Microbiol. 15, 123–128 (1992). 25. Hertel, C., Ludwig, W., Pot, B., Kersters, K., Schleifer, K. H.: Differentiation of lactobacilli occurring in fermented milk products by using oligonucleotide probes and electrophoretic protein profiles. Syst. Appl. Microbiol. 16, 463–467 (1993). 26. Jayarao,B. M., Dore, J. J. F., Baumbach, G. A., Matthews, K. R., Oliver, S. P.: Differentiation of Streptococcus uberis from Streptococcus parauberis by polymerase chain reaction and restriction fragment length polymorphism analysis of the 16S ribosomal DNA. J. Clin. Microbiol. 29, 2774–2778 (1991) 27. Jensen, M. A., Webster, J. A., Straus, N.: Rapid identification of bacteria on the basis of Polymerase Chain Reactionamplified ribosomal DNA spacer polymorphisms. Appl. Environ. Microbiol. 59, 945–952 (1993). 28. Klijn, N., Weerkamp, A. H., de Vos, W. M.: Identification of mesophilic lactic acid bacteria by using polymerase chain reaction-amplified variable regions of 16S rRNA and specific DNA probe. Appl. Environ. Microbiol. 57, 3390–3393 (1991). 29. Kusuda, R., Kawai, K., Salati, F., Banner, C. R., Fryer, J. L.: Enterococcus seriolicida sp. nov. A fish pathogen. Int. J. Syst. Bacteriol. 41, 406–409 (1991). 30. Lammler, C. A., Abdulmawjood, A., Danic, G., Vailant, S., Weiß, R.: Differentiation of Streptococcus uberis and Streptococcus parauberis by restriction fragment length polymorphism analysis of the 16S ribosomal RNA gene and further studies on serological properties. Med. Sci. Res. 26, 177–179 (1998). 31. Lynch, C. M., McSweeney, P. L. H., Fox, P. F., Cogan, T. M., Drinan, F. D.: Contribution of starter lactococci and nonstarter lactobacilli to proteolysis in Cheddar cheese with a controlled microflora. Lait 77, 441–459 (1997). 32. Morea, M., Baruzzi, F., Cocconcelli, P. S.: Molecular and physiological characterization of dominant bacterial population in traditional Mozzarella cheese processing. J. Appl. Microbiol. 87, 574–582 (1999). 33. Moschetti, G., Blaiotta, G., Aponte, M., Catzeddu, P., Villani, F., Deiana, P., Coppola, S.: Random amplified polymorphic DNA and amplified ribosomal DNA spacer polymorphism: powerful methods to differentiate Streptococcus thermophilus strains. J. Appl. Microbiol. 85, 25–36 (1998). 34. Moschetti, G., Blaiotta, G., Aponte, M., Mauriello, G., Villani, F., Coppola, S.: Genotyping of Lactobacillus delbruckii subsp. bulgaricus and determination of number and forms of rrn operons in Lactobacillus delbrueckii and its subspecies. Res. Microbiol. 148, 501–510 (1997).
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis 35. Moschetti, G., Blaiotta, G., Villani, F., Coppola, S.: Nisinproducing organisms during traditional ‘Fior di latte’ cheese-making monitored by multiplex-PCR and PFGE analysis. Int. J. Food Microbiol. 63, 109–116 (2001). 36. Naimi, A., Beck., G., Branlant, C.: Primary and secondary structures of rRNA spacer regions in enterococci. Microbiology 143, 823–834 (1997). 37. Nour, M., Naimi, A., Beck, G., Branlant, C.: 16S–23S and 23S-5S intergenic spacer regions of Streptococcus thermophilus and Streptococcus salivarius, primary and secondary structure. Curr. Microbiol. 31, 270–278 (1995). 38. Nour, M.: 16S–23S and 23S-5S intergenic spacer regions of lactobacilli: nucleotide sequence, secondary structure and comparative analysis. Res. Microbiol. 149, 433–448 (1998). 39. Parente, E., Rota, M. A., Ricciardi, A., Clementi, F.: Characterization of natural starter cultures used in the manufacture of pasta filata cheese in Basilicata (South Italy). Int. Dairy J. 7, 775–783 (1997). 40. Rodrigues, U. M., Aguirre, M., Facklam, R. R., Collins, M. D.: Specific and intraspecific molecular typing of lactococci based on polymorphism of DNA encoding rRNA. J. Appl. Bacteriol. 71: 509–516 (1991). 41. Sanger, F. Nicklen, S., Coulson, A. R.: DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463–5467 (1977). 42. Sechi, L. A., Daneo-Moore, L.: Characterization of intergenic spacer in two operons of Enterococcus hinie ATCC 9790. J. Bacteriol. 175, 3213–3219 (1993).
527
43. Teixeira, L. M., Merquior, V. L., Vanni, M. C., Carvalho, M. G., Fracalanzza, S. E., Steigerwalt, A. G., Brenner, D. J., Facklam, R. R.: Phenotypic and genotypic characterization of atypical Lactococcus garvieae strains isolated from water buffalo’s? with subclinical mastitis and confirmation of L. garvieae as senior subjective synonym of Enterococcus seriolicida. Int. J. Syst. Bacteriol. 46, 664–668 (1996). 44. Tilsala-Timisjarvi, A., Alatossava, T.: Development of oligonucleotide primers from the 16S–23S rRNA intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by PCR. Int. J. Food Microbiol. 35, 49–56 (1997). 45. Trottier, S., Higgins, R., Brochu, G., Gottschalk, M.: Acase of human endocarditis due to Streptococcus suis in North America. Rev. Infect. Dis. 13, 1251–1252. 46. Vetch, U., van Leengoed, M. G., Verheyen, E. R., M.: Streptococcus suis infections in pigs in the Netherland (part one). Vet. Q 7, 315–321 (1985). 47. Weisburg, W. G., Barns, S. M., Pelletier, D. A., Lane, D. J.: 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703 (1991). 48. Zlotkin, A., Eldar, A., Ghittino, C., Bercovier, H.: Identification of Lactococcus garvieae by PCR. J. Clin. Microbiol., 36, 983–985 (1998). Corresponding author: Prof. Giancarlo Moschetti, Dipartimento di Scienza degli Alimenti, Via Università, 100 Palazzo Mascabruno 80055 Portici, Italy Tel.: ++39-081-7 755 339; Fax: ++39-081-7 755 339; e-mail: [email protected]
16S–23S rDNA Intergenic Spacer Region Polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as Revealed by PCR and Nucleotide Sequence Analysis Giuseppe Blaiotta, Olimpia Pepe, Gianluigi Mauriello, Francesco Villani, Rosamaria Andolfi, and Giancarlo Moschetti Dipartimento di Scienza degli Alimenti, Sezione di Microbiologia Agraria, Alimentare ed Ambientale e di Igiene, Università degli Studi di Napoli “Federico II”, Portici, Italy Received: August 15, 2002
Summary The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of “Fior di Latte” cheese were analyzed. After 16S–23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S–23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S–23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates. Key words: 16S–23S rDNA ISR – L. lactis – L. garvieae – L. raffinolactis – S. thermophilus – S. suis – S. parauberis
Introduction Lactococcus (L.) garvieae and L. raffinolactis are commonly isolated, as “non-dominant” species, in the dairy environment such as natural starter cultures, raw milk, curd and cheese [23, 32, 39, 43]. However, L. garvieae is also considered an emerging zoognotic pathogen that has been isolated from cattle, fish and humans [6, 7, 16, 29, 48] even though their role as infection agents remains unclear [1]. L. garvieae, L. raffinolactis and L. lactis are genealogically quite distinct but phenotypically closely related, making their differentiation on the basis of phenotypic criteria very difficult [13, 40]. Ribosomal RNA gene restriction patterns and rRNA-targeted oligonucleotide probes allow the five currently recognized lactococcal species to be distinguished [28, 40]. It is well known that non-starter lactic acid bacterial floras, particularly raw milk microflora, increase the diversity of cheese flavors and may also be involved in producing the typical organoleptic characteristics of cheeses during ripening [12, 31, 18].
Therefore, it is of primary importance to obtain a reliable description of the physiologically active microbial community in order to understand the role that the different species of lactic acid bacteria play in dairy fermentation. Classically, such questions are addressed through the enumeration of some microbial groups on a variety of culture media, followed by identification through traditional microbiological methods. This approach is generally time-consuming, and only a limited number of isolates can be identified. Molecular identification methods are a powerful alternative to the conventional differentiation of bacteria by plating especially when closely related species are analyzed. Detecting and identifying various species with rapid methods is also important for in vivo monitoring fermentation processes and for quality control (especially in mixed cultures). At species level there are several reports on specific identification systems for LAB, mainly based on 16S ribo0723-2020/02/25/04-520 $ 15.00/0
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis
somal RNA gene (rDNA) [15, 24, 25]. However, it has been widely shown [4, 27, 21, 19] that the ribosomal ISRs are more variable between bacterial species than 16S and 23S rDNA. Following this approach, the 16S–23S rDNA ISR has already been successfully used as a speciesspecific marker to distinguish dominant LAB species occurring in dairy products [5, 9, 33, 34, 38, 37, 44]. In this paper we describe the sequence analysis of the 16S–23S rDNA ISR of L. garvieae and L. raffinolactis and the possibility of rapidly distinguishing these “non-dominant” species from strains of the genus Lactococcus (L.), Streptococcus (S.), Lactobacillus (Lb.), Enterococcus (E.)
521
and Leuconostoc (Ln.) that normally dominate dairy environments. Moreover, the suitability of this approach to differentiate LAB strains at species level was validated by testing wild streptococcal strains isolated during traditional Italian “Pasta Filata” cheese production.
Materials and Methods Bacterial strains and culture conditions The reference strains used in this study are listed in Table 1. 127 wild streptococcal strains, isolated (see below) during the whole “Fior di Latte” cheese-making process, were also used
Table 1. Reference strains used in this study Species
Strains
Origina
Source
E. casseliflavus E. durans E. faecalis E. faecium L. lactis subsp. lactis L. lactis subsp. lactis L. lactis subsp. cremoris L. lactis subsp. hordniae L. garvieae L. raffinolactis S. thermophilus S. salivarius Lb. delbrueckii subsp. bulgaricus Lb. delbrueckii subsp. lactis Ln. mesenteroides subsp. mesenteroides Ln. mesenteroides subsp. dextranicum Ln. mesenteroides subsp. cremoris
ATCC 25788T ATCC 11576 ATCC 19433T ATCC 19434T DSM 20481T ATCC 11454 DSM 4645 DSM 20450T DSM 20684T DSM 20443T NCDO 822 DSM 20560T DSM 20081T DSM 20072T DSM 20343T DSM 20484T DSM 20346T
ATCC ATCC ATCC ATCC DSM ATCC DSM DSM DSM DSM NCIMB DSM DSM DSM DSM DSM DSM
Plant material Cheddar cheese – – – – – – Bovine mastitis Raw milk German yoghurt Human blood Bulgarian yoghurt Emmental cheese Fermented olives – Dried starter powder
T
, Type strain; aATCC, American Type Culture Collection, Rockville, Maryland, USA; DSM, Deutsche Samlung von Mikroorganismen, Brauschweig, Germany; NCIMB, National Collection of Industrial and Marine Bacteria, Aberdeen, Scotland, UK.
Table 2. 16S–23S rDNA intergenic spacer patterns of strains isolated during the whole fermentation process of “Fior di Latte” cheese Samplesa
Isolation temperature
n° isolates analysed
Reference patternsb –––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– A B C D E F G H
Other patterns c ––––––––––––––––––––––––––––––––––––––– I L
M Co CF PF
30 °C
33 14 35 9
2d 3
1f 1
M Co CF PF
44 °C
a
4 8 9 15
20 7 30 5
8e 2 1
1 1 2 3
2 1
4 4 6 14
4 3 1
1g
M, raw milk; Co, curd at beginning of ripening; CF, curd at the end of ripening; PF, “Fior di Latte” cheese. Reference patterns: A) L. garvieae; B) L. lactis ; C) L. raffinolactis; D) S. thermophilus and S. salivarius; E) E. faecalis, E. casseliflavus and E. durans; F) E. faecium; G) Lb. delbrueckii; H) Ln. mesenteroides. c Other patterns, different from those of reference strains: I) with one class of spacer located at about 540 bp; L) with 1 one class of spacer located at about 510 bp. d Among strains of this group, L. garvieae SAP L1-5 was analysed by sequencing. e Among strains of this group, L. raffinolactis SAP 37 was analysed by sequencing. f Among strains of this group, Streptococcus spp. SAP 77 was analysed by sequencing. g Among strains of this group, Streptococcus spp. SAP 99 was analysed by sequencing. b
522
G. Blaiotta et al.
(Table 2). All strains were stored at –30 °C in appropriate broths with 25% (v/v) sterile glycerol. Working cultures were prepared on M17 (Oxoid, Unipath Limited, Basingstoke, Hampshire) agar (streptococci, lactococci and enterococci) and on MRS (Oxoid) agar (lactobacilli and leuconostocs). Sampling and isolation of wild bacterial strains A traditional Italian unripened “Pasta Filata” cheese called “Fior di Latte” was manufactured as previously described [35]. Samples were collected from a dairy at Agerola (Province of Naples, Southern Italy). Sampling was performed during one cycle of cheese production. The samples, stored at 4 °C, were transferred to the laboratory, homogenized and serially diluted (until 10–9) in 0.1% peptone water. For the purpose of this study, six 0.1 ml of each dilution were surface-plated on M17 agar and incubated at 30 °C (3 plates) and 44 ° C (3 plates) for 48 h. From countable plates, 127 colonies (91 and 26 from plates incubated at 30 °C and 44 °C, respectively) were randomly isolated and stored for further characterization. Amplification of the 16S–23S rDNA ISR and 16S rDNA DNA extraction was carried out from a single colony by using an InstaGene Matrix (Bio-Rad Laboratories, Hercules, CA) following the conditions described by the supplier. About 25 ng of DNA were used for PCR amplification. Synthetic oligonucleotide primers G1 (5’GAAGTCGTAACAAGG3’) and L1 (5’CAAGGCATCCACCGT3’) described by Jensen et al. (1993) were used to amplify the 16S–23S rDNA ISR. The first primer, G1, was selected from a high conserved region immediately adjacent to the 16S–23S rDNA ISR (30–40 bp nucleotide upstream); while, the second, L1, represents a conserved region of the 23 rDNA located at about 20 bp downstream the 16S–23S rDNA ISR. PCR conditions consisted of 25 cycles (1 min at 94 °C, 2 min at 55 °C, 3 min at 72 °C) plus one additional cycle at 72 °C for 10 min as a final chain elongation. Synthetic oligonucleotide primers fD1 (5’AGAGTTTGATCCTGGCTCAG3’; positions 8-27 of E.coli 16S rDNA) and rD1 (5’AAGGAGGTGATCCAGCC3’; positions 1524-1540 of E. coli 16S rDNA) described by Weisburg et al. [47] were used to amplify the 16S rDNA. PCR conditions consisted of 30 cycles (1 min at 94 °C, 45 sec at 54 °C, 2 min at 72 °C) plus one additional cycle at 72 °C for 7 min as a final chain elongation. The presence of PCR products was verified by agarose (2% w/v) gel electrophoresis at 7 V cm–1 for 2–3 h. Cloning, sequencing and nucleotide sequence accession numbers The 16S–23S rDNA spacer region of L. lactis subsp. lactis ATCC 11454, L. garvieae DSM 20684T, L. raffinolactis DSM 20443T and of 4 wild strains (SAP L1-5, SAP 37, SAP 77 and SAP 99; see Table 2) and 16S rDNA of wild strains SAP 77 and SAP 99 were amplified as described above. PCR fragments were
purified from agarose gel by using a QIAquick gel extraction kit (Qiagen S. p. A., Milan) and cloned into the pCR-Script SK(+) cloning vector (Stratagene, La Jolla, CA). The DNA sequence of the cloned fragments was determined by the dideoxy chain termination method [41] by using the DNA sequencing kit (Perkin-Elmer Cetus, Emeryville, CA) according to the manufacturer’s instructions. The sequences were analyzed by MacDNasis Pro v3.0.7 (Hitachi Software Engineering Europe S. A., Olivet Cedex, F) and research for DNA similarity was performed with the GenBank and EMBL database. The GenBank accession numbers (a.n.) of 16S–23S spacer sequences are AF284218 for L. lactis subsp. lactis ATCC11454, AF225967 for L. garvieae DSM 20684T, AF284219 for L. raffinolactis DSM 20443, AF284220 for the strain SAP 37, AF284576 for the strain SAP77, AF225968 for the strain SAP L1-5 and AF284577 for the strain SAP 99. Accession numbers of 16S rDNA are AF284578 for the strain SAP 77 and AF284579 for the strain SAP 99.
Fig. 1. Etidium bromide-stained 2% agarose gel of PCR-amplified 16S–23S intergenic spacer regions of some LAB strains used in this study. Line a, L. garvieae DSM 20684T; line b, L. lactis subsp. lactis DSM 20481T; line c, L. raffinolactis DSM 20443T; line d, S. thermophilus NCDO 822; line e, E. faecalis ATCC 19433T; line f, E. faecium ATCC 19434T; line g, Lb. delbrueckii subsp. bulgaricus DSM 230081T; line h, Ln. mesenteroides subsp. mesenteroides DSM20343T; line i, strain SAP 77; line j, strain SAP 99. 1 Kb DNA Ladder (Gibco BRL) used as molecular weight marker.
Fig. 2. Multiple alignment of some regions of the 16S–23S ISR of L. lactis subsp. lactis [strain ATCC 11454, this study], L. raffinolactis [strain DSM 20433T, this study], L. garvieae [strain DSM 20684T, this study], S. suis [strain SAP 77, this study], S. parauberis [strain SAP 99, this study] and S. thermophilus [strain ATCC 19528 [37]. The extremities of the tRNA coding region (tRNA-Ala), sequences involved in formation of the double-strand processing sites (dsPS), sequence of stem/loop structure I downstream of tRNA and regions A and B (nt 1–10 and 222–243, respectively) are shown. Sequence differences compared with tRNA-Ala of E. coli are indicated by nucleotides in squares. The conserved [in L. lactis, S. thermophylos, S. salivarius and S. pneumonie [37] TTGT and TTG sequences that border the 5’ and 3’ ends of the tRNA coding sequences are boxed. The nucleotide sequence of stem/loop structure I downstream of tRNA of L. lactis and S. thermophilus are underlined. The DNasis pro.v 3.0.7 program (Hitachi) was used for the sequence alignment. Nucleotide numbers correspond to positions in the L. lactis sequences. Gaps correspond to insertions and dots to missing nucleotides. When a significant degree of similarity was found between aligned sequences (the same nucleotide in at least four of the aligned sequences) these common nucleotides are indicated in grey.
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis
523
524
G. Blaiotta et al.
Results PCR amplification of the 16S–23S rDNA ISR Primers G1 and L1 were used to amplify the 16S–23S rDNA ISR from genomic DNA of 17 reference strains (representing 11 different LAB species) and 127 wild streptococcal gram-positive catalase-negative strains isolated during the whole fermentation process of “Fior di Latte” cheese (Table 2). On the basis of the 16S–23S rDNA ISR PCR pattern displayed, the reference strains (Figure 1, lines a to h) were gathered in the following 8 groups: A) L. garvieae (1 band located at about 430 bp); B) L. lactis (1 band located at about 380 bp); C) L. raffinolactis (1 band located at about 450 bp); D) S. thermophilus and S. salivarius (1 band located at about 360 bp); E) E. faecalis, E. casseliflavus and E. durans (2 bands located at about 300 and 400 bp); F) E. faecium (2 bands located at about 410 and 510 bp); G) Lb. delbrueckii (2 bands located at 320 and 520 bp); H) Ln. mesenteroides (1 bands located at 470bp). According to the results shown above, the 127 wild strains could be grouped as follows: 62 strains showed pattern B (L. lactis); 34 pattern D (S. thermophilus/salivarius), 12 pattern E (Enterococcus spp.), 11 pattern C (L. raffinolactis), and 5 pattern A (L. garvieae) (Table 2 and Figure 1, lines a to e). Three wild strains showed 16S–23S rDNA ISR patterns different from those of reference strains: SAP 77 and SAP 192, with 1 band located at 540bp (Figure 1, line j) and SAP 99, with 1 band located at 510 bp (Figure 1, line l). No amplified fragments referable to the species E. faecium were found among the 127 wild strains analyzed. Sequencing and nucleotide sequence analysis The 16S–23S rDNA ISR of L. lactis subsp. lactis ATCC 11454, L. garvieae DSM 20684T, L. raffinolactis DSM 20443T and of 4 wild strains (SAP L1-5, SAP 37, SAP 77 and SAP 99) were cloned and sequenced. In all sequences we found that the nucleotide primer G1 targets 52 bp of the 3’ end of 16S rDNA and the primer L1 targets 29 bp of the 5’ end of 23S DNA. Consequently, the length of the 16S–23S rDNA ISR sequences are 81 bp shorter than those displayed after PCR amplification and agarose gel electrophoresis . The 16S–23S DNA ISR sequences of L. lactis subsp. lactis ATCC 11454 and strain IL 1403 (a.n. X64887, [9]), L. raffinolactis DSM 20433T and strain SAP 37, L. garvieae DSM 20684T and strain SAP L1-5 displayed an high level of homology (99.6%, 100% and 99.7%, respectively). The sequence of L. lactis was homologous to L. raffinolactis and L. garvieae at 69,1% and 60,8%, respectively. Nucleotide sequences of 16S–23S rDNA ISR of unidentified strains SAP 77 and SAP 99 were very different both from them (< 60% of similarity) that in comparison to lactococci analysed in this study (< 50% of similarity).
Research of DNA homologies, performed with the GenBank and EMBL database, of nucleotide sequences 16S–23S rDNA ISR of unidentified strain SAP 99 showed 68.5% similarity with Streptococcus uberis (a.n. U39768); while the unidentified strain SAP 77 displayed 71% similarity with a wide group of streptococci such as S. thermophilus (a.n. U32965), S. salivarius (a.n. X83760), S. difficile (a.n. AF064441), S. agalactiae (a.n. L31412), S. bovis (a.n. U39766) and S. waiu (a.n. AF088899) (results not shown). DNA similarity of the full nucleotide sequences of the 16S rDNA of the isolates SAP 99 (1541 bp, an. AF284579) and SAP 77 (1549 bp, an. AF284578) were searched in the Gene Bank database so as to recognize them as belonging to a particular species. Strain SAP 77 displayed 99% of homology with S. suis (a.n. AF009497, [8]), while strain SAP 99 showed 99% of homology with S. parauberis (a.n. X89967, [14]). Therefore, strains SAP 77 and SAP 99 were identified as belonging to the species S. suis and S. parauberis, respectively. Nucleotide sequences of some regions of the 16S–23S rDNA ISR of L. lactis subsp. lactis ATCC 11454, L. raffinolactis DSM 20433T, L. garvieae DSM 20684T, S. suis SAP 77, S. parauberis SAP99 and S. thermophilus ATCC 19528 [37] are shown Fig. 2. Multiple alignment analysis of the six sequences (Fig. 2) showed that the 5’ end (Region A, pos. 1–10), the coding region of tRNA-Ala (pos. 94–166) and one of the sequences involved in the formation of double-stranded processing sites (dsPS2; pos. 197–218) were characterized by an high level of similarity in both lactococci and streptococci. Particularly, the 5’ end of the 16S–23S rDNA ISR (region A) of L. lactis was identical to those of L. garvieae while the same region of L. raffinolactis was identical to those of S. suis and S. thermophilus. However, the first eight nucleotide of this region are high conserved in both streptococci and lactococci analyzed in this study. This eight nucleotide were supposed by NOUR et al. [37] as involved in the final maturation step leading to mature 16S rDNA. The tRNA-Ala gene of the 16S–23S rDNA ISR of L. lactis, L. garvieae, L. raffinolactis, S. thermophilus, S. suis, S. paraubers are identical. They differ at six positions, as compared with the corresponding E. coli tRNAAla gene (Fig. 2). The tRNA gene organization in the 16S–23S rDNA ISR of the species analysed in this study is identical to that previously found for S. pneumoniae [2] and E. hirae [42]. By contrast, the sequences located on the 5’ and 3’ side of the tRNA-Ala gene (Fig. 2) are identical for L. lactis and S. thermophilus (TTGT-5’ and 3’-TTG) significantly different among the other species analysed. Because present also in S. salivarious and S. pneumoniae these sequences were supposed a characteristic feature of Streptococcus genus by Nour et al. [37]. Nevertheless, these sequences are not similar to those of S. suis and S. parauberis. The sequences of the dsPS2, involved in the formation of double-stranded processing sites, were also high con-
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis
served in both streptococci and lactococci, displaying only one nucleotide change among the six species analysed. A middle level of similarity among sequences was found in the region B (Fig. 2, pos. 232–243), this region is conserved in S. thermophilus and S. suis and differ for 2–4 nucleotide in the other species. The nucleotide sequences of the dsPS1 (pos. 35–46) and of stem/loop structure I downstream of the tRNA (pos. 167–177) were characterized by a high degree of divergence. The dsPS1 sequences were identical in L. lactis and L. garvieae, while differing in 9 bp of 23 in L. raffinolactis among lactococci; the same region was identical for S. thermophilus and S. parauberis while differing in 4 bp of 23 in S. suis among streptococci. Finally, the sequence of stem/loop structure I downstream of the tRNA was very different among both streptococci and lactococci.
Discussion Identification and differentiation of L. garvieae, L. lactis subsp. lactis and L. raffinolactis as well as some enterococci on the basis of their phenotypical traits are very difficult [40, 17, 23]. Therefore, 16S rDNA sequencing or 16S rDNA specific primers are becoming commonly used to differentiate L. lactis from L. garvieae and L. raffinolactis [48, 6, 3]. Our results show that the 16S–23S rDNA ISR sequences vary greatly, in size and sequence, among L. garvieae, L. raffinolactis, L. lactis. Sequence similarity level between L. lactis and L. garvieae was 69% whereas they showed a similarity level of 60% with respect to L. raffinolactis. Moreover, the sequence of the 16S–23S rDNA ISR of lactococci differ greatly in comparison to streptococci commonly isolated from dairy environments. Data obtained from comparisons between 16S–23S spacer patterns of the reference strains and those of the strains isolated during the fermentation process show that this approach is very useful to describe microbial communities in the product. Nevertheless, when reference strains are not available, 16S–23S rDNA spacer or 16S rDNA sequencing is necessary. In fact, in this study we were able to identify all the wild strains tested with the exception of strains SAP 77 and SAP 99. These strains were identified as Streptococcus spp. on the basis of the 16S–23S DNA spacer sequence and as S. suis and S. parauberis on the basis of the 16S rDNA sequence. Therefore, the 16S–23S DNA spacer-based identification system, as a rapid alternative method, can complement or even replace microbiological and biochemical methods of identification of L. lactis, L. garvieae and L. raffinolactis as well as other streptococci from dairy environments. By using this approach, we found that L. lactis, S. thermophilus and Enterococcus spp. are major members of the microbial community of “Fior di Latte” cheese: they were detected in all the phases of cheese manufacturing. Furthermore, strains of L. raffinolactis were detectable from raw milk to curd at the end of ripening, strains referable to
525
L. garvieae and S. suis were detectable from raw milk to curd at the beginning of ripening while strains referable to S. parauberis were detectable only in the raw milk. S. suis is an important cause of a wide verity of infection in pigs [10, 46] and has also been reported as a pathogen for human [45]. S. parauberis has reported as a rare mastitis-causing pathogen [26, 30]. This species seems to be more frequent among British dairy herds [20]. Isolation of S. parauberis from diseased fish was described by Domenech et al. [14]. Processing and environmental conditions applied during traditional “Fior di Latte” cheese manufacturing, that relies upon spontaneous fermentation of raw cow’s milk [35], promote the growth of only part of the complex association of microorganisms present in raw milk. Finally, because of the high degree of inter-specific polymorphism observed in this study, 16S–23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal and streptococcal isolates. Recently, species–specific region of the 16S and 23S rDNA and the 16S–23S rDNA ISR were used to construct species-specific primers in order to identify and differentiate S. uberis and S. parauberis [22]. Furthermore, application of the 16S–23S rDNA spacer technique on total microbial DNA directly extracted from food could allow recognition of technologically interesting species within complex microbial communities, detection of potential pathogenous microbes (e.g. L. garvieae, S. suis and S. paraubers) occurring at lower levels associated with raw milk and could offer a reliable instrument to study microbial communities without their cultivation. Indeed, culture-independent methods in comparison to culture-dependent approaches can provide a more realistic view of microbial diversity, as recently demonstrated in different “Mozzarella” cheeses by Coppola et al. [11]. These authors, by analyzing DNA directly isolated from “Fior di Latte” cheese samples using this technique, obtained complex patterns with some bands unidentified owing to the lack of information about the 16S–23S rDNA spacer region length of a large number of dairy microorganisms. The results of this work fit perfectly within the scope of “in situ” analysis of microbial communities, providing new information about the 16S–23S rDNA spacer region length of L. garvieae, L. raffinolactis, S. suis and S. parauberis.
Acknowledgements This work was supported by a grant from the National Research Council of Italy, Rome.
References 1. Aguirre, M., Collins, M. D.: Lactic acid bacteria and human clinical infection. J. Appl. Bacteriol. 75, 95–107 (1993).
526
G. Blaiotta et al.
2. Baccot, C. M., Reeves, R. H.: Novel tRNA gene organization in the 16S–23S intergenic spacer of the Streptococcus pneumoniae rRNA gene cluster. J. Bacteriol. 173, 4234–4236 (1991). 3. Barrakat, R. K., Griffiths, M. W., Harris L. J.: Isolation and characterization of Carnobacterium, Lactococcus, and Enterococcus spp. from cooked, modified atmosphere packaged, refrigerated, poultry meat. Int. J. Food Microbiol. 62, 83–89 (2000). 4. Barry, T., Colleran, G., Glennon, M., Dunican, L. K., Gannon, F.: The 16S/23 S ribosomal spacer region as a target for DNA probes to identify eubacteria. PCR Methods Appl. 1, 51–56 (1991). 5. Berthier, F., Ehrlich, S. D.: Rapid species identification within two groups of closely related lactobacilli using PCR primers that target the 16S/23S rRNA spacer region. FEMS Microbiol. Lett. 161, 97–106 (1998). 6. Cai, Y., Suyanandana, P., Saman, P., Benno, Y.: Classification and characterization of lactic acid bacteria isolated from the intestines of common carp and freshwater prawns. J. Gen. Appl. Microbiol. 45, 177–184 (1999). 7. Carson, J., Gudkovs, N., Austin, B.: Characteristics of an Enterococcus-like bacterium from Australia and South Africa, pathogenic for rainbow trout (Oncorhynchus mykiss Walbaum). J. Fish Disease 16, 381–388 (1993). 8. Chatellier, S., Harel, J., Zhang, Y., Gottschalk, M., Higgins, R., Devriese, L., Brousseau, R.: Phylogenetic diversity of Streptococcus suis strains of various serotypes as revealed by 16S rRNA gene sequence comparison. Int. J. Syst. Bacteriol. 48, 581–589 (1998). 9. Chiaruttini, C., Milet, M.: Gene organization, primary structure and RNA processing analysis of a ribosomal RNA operon of Lactococcus lactis. J. Mol. Biol. 230, 57–76 (1993). 10. Clifton-Hadley, F. A.: Styreptococcus suis type 2 infections. Br. Vet. J. 139, 1–5 (1983). 11. Coppola, S., Blaiotta, G., Ercolini, D., Moschetti, G.: Molecular evaluation of microbial diversity occurring in different types of Mozzarella cheese. J. Appl. Microbiol. 90, 414–420 (2001). 12. Corroler, D., Mangin, I., Desmasures, N., Gueguen, M.: An ecological study of lactococci isolated from raw milk in the Camembert cheese Registered Designation of Origin Area. Appl. Environ. Microbiol. 64, 4729–4735 (1998). 13. Deasy, B.M., Rea, M.C., Fitzgerard, G.F., Cogan, T.M., Beresford, T.P.: A rapid PCR based method to distinguish between Lactococcus and Enterococcus. Syst. Appl. Microbiol. 23, 510–522 (2000). 14. Domenech, A., Fernandez-Garayzabal, J. F., Pascual, C., Garcia, J. A., Cutuli, M. T., Moreno, M. A., Collins, M. D., Dominguez, L.: Streptococcosis in cultured tufbot (Scophthalmus maximum) associated with Streptococcus parauberis. J. Fish Disease 19, 33–38 (1996). 15. Ehrmann, M., Ludwig, W., Schleifer, K. H.: Reverse dot blot: a useful method for the direct identification of lactic acid bacteria in fermented food. FEMS Microbiol. Lett. 117, 143–150. (1994). 16. Elliot, J. A., Collins, M. D., Pigott, N. E., Facklam, R. R.: Differentiation of Lactococcus lactis and Lactococcus garvieae from human by comparison of whole-cell protein patterns. J. Clin. Microbiol. 29, 2731–2734 (1991). 17. Elliot, J. A., Facklam, R. R.: Antimicrobial susceptibilities of Lactococcus lactis and Lactococcus garvieae and proposed method to discriminate between them. J. Clin. Microbiol. 34, 1296–1298 (1996). 18. Fox, P. F., Wallace, J. M., Morgan, S., Lynch, C. M., Niland, E. J., Tobin, J.: Acceleration of cheese ripening. Anton. van Leeuwen. 70, 271–297 (1996).
19. Garcìa-Martìnez, J., Acinas, S. G., Anton, A. I., RodriguezValera, F.: Use of the 16S–23S ribosomal genes spacer region in studies of prokaryotic diversity. J. Microbiol. Methods, 36, 55–64 (1999). 20. Garvie, E. I., Bramley, A.: Streptococcus uberis: an approach to its classification. J. Appl. Bacteriol. 46, 295–304 (1979). 21. Gurtler, V., Stanisich, V. A.: New approaches to typing and identification of bacteria using the 16S–23S rDNA spacer region. Microbiology 142, 3–16 (1996). 22. Hassan, A. A., Khan, I. A., Abdulmawjood, A., Lammler, C.: Evaluation of PCR for rapid identification and differentiation of Streptococcus uberis and Streptococcus parauberis. J. Clin. Microbiol. 39, 1618–1621 (2001). 23. Hatzikamari, M., Litopoulou-Tzanetaki, E., Tzanetakis, N.: Microbiological characteristics of Anevato: a traditional Greek cheese. J. Appl. Microbiol. 87, 595–601 (1999). 24. Hensiek, K., Krupp, G., Stackebrandt, E.: Development of diagnostic oligonucleotide probes for four lactobacillus species occurring in the intestinal tract. Syst. Appl. Microbiol. 15, 123–128 (1992). 25. Hertel, C., Ludwig, W., Pot, B., Kersters, K., Schleifer, K. H.: Differentiation of lactobacilli occurring in fermented milk products by using oligonucleotide probes and electrophoretic protein profiles. Syst. Appl. Microbiol. 16, 463–467 (1993). 26. Jayarao,B. M., Dore, J. J. F., Baumbach, G. A., Matthews, K. R., Oliver, S. P.: Differentiation of Streptococcus uberis from Streptococcus parauberis by polymerase chain reaction and restriction fragment length polymorphism analysis of the 16S ribosomal DNA. J. Clin. Microbiol. 29, 2774–2778 (1991) 27. Jensen, M. A., Webster, J. A., Straus, N.: Rapid identification of bacteria on the basis of Polymerase Chain Reactionamplified ribosomal DNA spacer polymorphisms. Appl. Environ. Microbiol. 59, 945–952 (1993). 28. Klijn, N., Weerkamp, A. H., de Vos, W. M.: Identification of mesophilic lactic acid bacteria by using polymerase chain reaction-amplified variable regions of 16S rRNA and specific DNA probe. Appl. Environ. Microbiol. 57, 3390–3393 (1991). 29. Kusuda, R., Kawai, K., Salati, F., Banner, C. R., Fryer, J. L.: Enterococcus seriolicida sp. nov. A fish pathogen. Int. J. Syst. Bacteriol. 41, 406–409 (1991). 30. Lammler, C. A., Abdulmawjood, A., Danic, G., Vailant, S., Weiß, R.: Differentiation of Streptococcus uberis and Streptococcus parauberis by restriction fragment length polymorphism analysis of the 16S ribosomal RNA gene and further studies on serological properties. Med. Sci. Res. 26, 177–179 (1998). 31. Lynch, C. M., McSweeney, P. L. H., Fox, P. F., Cogan, T. M., Drinan, F. D.: Contribution of starter lactococci and nonstarter lactobacilli to proteolysis in Cheddar cheese with a controlled microflora. Lait 77, 441–459 (1997). 32. Morea, M., Baruzzi, F., Cocconcelli, P. S.: Molecular and physiological characterization of dominant bacterial population in traditional Mozzarella cheese processing. J. Appl. Microbiol. 87, 574–582 (1999). 33. Moschetti, G., Blaiotta, G., Aponte, M., Catzeddu, P., Villani, F., Deiana, P., Coppola, S.: Random amplified polymorphic DNA and amplified ribosomal DNA spacer polymorphism: powerful methods to differentiate Streptococcus thermophilus strains. J. Appl. Microbiol. 85, 25–36 (1998). 34. Moschetti, G., Blaiotta, G., Aponte, M., Mauriello, G., Villani, F., Coppola, S.: Genotyping of Lactobacillus delbruckii subsp. bulgaricus and determination of number and forms of rrn operons in Lactobacillus delbrueckii and its subspecies. Res. Microbiol. 148, 501–510 (1997).
Differentiation of Lactococcus garvieae, L. raffinolactis and L. lactis 35. Moschetti, G., Blaiotta, G., Villani, F., Coppola, S.: Nisinproducing organisms during traditional ‘Fior di latte’ cheese-making monitored by multiplex-PCR and PFGE analysis. Int. J. Food Microbiol. 63, 109–116 (2001). 36. Naimi, A., Beck., G., Branlant, C.: Primary and secondary structures of rRNA spacer regions in enterococci. Microbiology 143, 823–834 (1997). 37. Nour, M., Naimi, A., Beck, G., Branlant, C.: 16S–23S and 23S-5S intergenic spacer regions of Streptococcus thermophilus and Streptococcus salivarius, primary and secondary structure. Curr. Microbiol. 31, 270–278 (1995). 38. Nour, M.: 16S–23S and 23S-5S intergenic spacer regions of lactobacilli: nucleotide sequence, secondary structure and comparative analysis. Res. Microbiol. 149, 433–448 (1998). 39. Parente, E., Rota, M. A., Ricciardi, A., Clementi, F.: Characterization of natural starter cultures used in the manufacture of pasta filata cheese in Basilicata (South Italy). Int. Dairy J. 7, 775–783 (1997). 40. Rodrigues, U. M., Aguirre, M., Facklam, R. R., Collins, M. D.: Specific and intraspecific molecular typing of lactococci based on polymorphism of DNA encoding rRNA. J. Appl. Bacteriol. 71: 509–516 (1991). 41. Sanger, F. Nicklen, S., Coulson, A. R.: DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463–5467 (1977). 42. Sechi, L. A., Daneo-Moore, L.: Characterization of intergenic spacer in two operons of Enterococcus hinie ATCC 9790. J. Bacteriol. 175, 3213–3219 (1993).
527
43. Teixeira, L. M., Merquior, V. L., Vanni, M. C., Carvalho, M. G., Fracalanzza, S. E., Steigerwalt, A. G., Brenner, D. J., Facklam, R. R.: Phenotypic and genotypic characterization of atypical Lactococcus garvieae strains isolated from water buffalo’s? with subclinical mastitis and confirmation of L. garvieae as senior subjective synonym of Enterococcus seriolicida. Int. J. Syst. Bacteriol. 46, 664–668 (1996). 44. Tilsala-Timisjarvi, A., Alatossava, T.: Development of oligonucleotide primers from the 16S–23S rRNA intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by PCR. Int. J. Food Microbiol. 35, 49–56 (1997). 45. Trottier, S., Higgins, R., Brochu, G., Gottschalk, M.: Acase of human endocarditis due to Streptococcus suis in North America. Rev. Infect. Dis. 13, 1251–1252. 46. Vetch, U., van Leengoed, M. G., Verheyen, E. R., M.: Streptococcus suis infections in pigs in the Netherland (part one). Vet. Q 7, 315–321 (1985). 47. Weisburg, W. G., Barns, S. M., Pelletier, D. A., Lane, D. J.: 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703 (1991). 48. Zlotkin, A., Eldar, A., Ghittino, C., Bercovier, H.: Identification of Lactococcus garvieae by PCR. J. Clin. Microbiol., 36, 983–985 (1998). Corresponding author: Prof. Giancarlo Moschetti, Dipartimento di Scienza degli Alimenti, Via Università, 100 Palazzo Mascabruno 80055 Portici, Italy Tel.: ++39-081-7 755 339; Fax: ++39-081-7 755 339; e-mail: [email protected]