18-Carbon polyunsaturated fatty acids ameliorate palmitate-induced inflammation and insulin resistance in mouse C2C12 myotubes

Available online at www.sciencedirect.com

ScienceDirect Journal of Nutritional Biochemistry xx (2015) xxx – xxx

18-Carbon polyunsaturated fatty acids ameliorate palmitate-induced inflammation and insulin resistance in mouse C2C12 myotubes☆,☆☆ Pei-Yin Chen a , John Wang b , Yi-Chin Lin a, c, Chien-Chun Li a, c, Chia-Wen Tsai d, Te-Chung Liu a, c , Haw-Wen Chen d , Chin-Shiu Huang e, Chong-Kuei Lii d, e,⁎, Kai-Li Liu a, c,⁎⁎ b

a Department of Nutrition, Chung Shan Medical University, No. 110, Sec. 1, Chien-Kuo N. Rd., Taichung 40203, Taiwan Department of Pathology and Laboratory Medicine, Taichung Veterans General Hospital, No. 1650, Sec. 4, Taiwan Boulevard, Taichung 40705, Taiwan c Department of Dietitian, Chung Shan Medical University Hospital, Taichung, Taiwan d Department of Nutrition, China Medical University, Taichung, Taiwan e Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan

Received 14 July 2014; received in revised form 4 December 2014; accepted 4 December 2014

Abstract Skeletal muscle is a major site of insulin action. Intramuscular lipid accumulation results in inflammation, which has a strong correlation with skeletal muscle insulin resistance (IR). The aim of this study was to explore the effects of linoleic acid, alpha-linolenic acid, and gamma-linolenic acid (GLA), 18-carbon polyunsaturated fatty acids (PUFAs), on palmitic acid (PA)-induced inflammatory responses and IR in C2C12 myotubes. Our data demonstrated that these three test 18-carbon PUFAs can inhibit PA-induced interleukin-6 and tumor necrosis factor-α messenger RNA (mRNA) expression and IR as evidenced by increases in phosphorylated AKT and the 160-kD AKT substrate, mRNA and plasma membrane protein expression of glucose transporter 4, and glucose uptake. Moreover, the 18-carbon PUFAs blocked the effects of PA on activation of mitogen-activated protein kinases (MAPKs), protein kinase C-θ (PKC-θ), AMP-activated protein kinase (AMPK) and nuclear factor-κB (NF-κB). Of note, supplementation with GLA-rich borage oil decreased proinflammatory cytokine production and hindered the activation of MAPKs, PKC-θ and NF-κB in the skeletal muscles of diabetic mice. The 18-carbon PUFAs did not reverse PA-induced inflammation or IR in C2C12 myotubes transfected with a constitutively active mutant IκB kinase-β plasmid, which suggests the importance of the inhibition of NF-κB activation by the 18carbon PUFAs. Moreover, blockade of AMPK activation by short hairpin RNA annulled the inhibitory effects of the 18-carbon PUFAs on PA-induced IR but not inflammation. Our findings suggest that the 18-carbon PUFAs may be useful in the management of PA-induced inflammation and IR in myotubes. © 2015 Elsevier Inc. All rights reserved. Keywords: AMP-activated protein kinase (AMPK); 18-Carbon polyunsaturated fatty acids (18-Carbon PUFAs); Inflammation; Insulin resistance (IR); Nuclear factor-κB (NF-κB)

1. Introduction Elevated plasma free fatty acid concentrations are important in the development of insulin resistance (IR) and type 2 diabetes, although the underlying mechanism for this effect is poorly defined [1]. Insulin sensitivity is primarily determined by the degree of insulin-stimulated glucose utilization in skeletal muscle, which accounts for nearly 80% to 90% of peripheral glucose disposal [2]. It has been supposed that lipid oversupplement induced abnormal production of proinflammatory ☆ This study was supported by Grants NSC102-2320-B-040-001 and CMU102-ASIA-16. ☆☆ Author disclosures: No conflicts of interest are declared. ⁎ Correspondence to: C.-K. Lii. Tel.: +886 4 22053366x7519; fax: +886 4 22062891. ⁎⁎ Correspondence to: K.-L. Liu. Tel.: +886 4 24730022x12136; fax: +886 4 23248175. E-mail addresses: [email protected] (C.-K. Lii), [email protected] (K.-L. Liu).

http://dx.doi.org/10.1016/j.jnutbio.2014.12.007 0955-2863/© 2015 Elsevier Inc. All rights reserved.

cytokines and activation of the transcription factor nuclear factor-κB (NF-κB) is associated with the development of IR in skeletal muscle [3]. Palmitic acid (PA), a common dietary saturated fatty acid, increases the production of proinflammatory cytokines such as interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α), and this increased production plays an important role in PA-induced IR in myotubes [4,5]. These findings suggest that modulating proinflammatory cytokine production is a breakthrough strategy to lessen the free fatty acid-induced IR in skeletal muscle. Recent publications have shown that the NF-κB pathway is involved in PA-induced proinflammatory cytokine expression in myotubes [4,5]. The transcription factor NF-κB exists in most eukaryotes as a homodimer or as a heterodimer with proteins of the NF-κB family, including p65 (RelA), p50/p105 (NF-κB1), p52/p100 (NF-κB2), RelB, and c-Rel. In normal conditions, the NF-κB protein complex is sequestered in the cytoplasm by noncovalently binding to an inhibitor protein termed IκB. Following phosphorylation of IκB by IκB kinase (IKK), IκB is ubiquitinated and degraded, leading to activation and translocation of NF-κB to the nucleus, where it induces

2

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

transcriptional expression of many proinflammatory cytokines [6,7]. Of note, activation of upstream stress kinases such as the mitogenactivated protein kinases (MAPKs) and protein kinase C-θ (PKC-θ) is involved in PA-induced NF-κB activation and proinflammatory cytokine expression in myotubes [4,5]. Moreover, inhibitors of MAPK, PKC-θ, and NF-κB can reverse PA-induced IR in skeletal myotubes [4,8]. Activation of AMP-activated protein kinase (AMPK), a fuel-sensing enzyme, increases energy production, which results in a decline in blood glucose and free fatty acid levels [9]. AMPK activation is involved in not only the phosphorylation of the AKT substrate of 160 kDa (AS160) but also the expression and translocation of glucose transporter 4 (GLUT4), which leads to insulin-independent glucose uptake in myotubes [10–12]. In AMPK knockout mice, 5-aminoimidazole-4-carboxamide-1-β-Dribofuranoside (AICAR), an artificial activator of AMPK, cannot increase AS160 phosphorylation or glucose uptake in skeletal muscle [13]. Moreover, data have demonstrated an interaction between AMPK activation and insulin signaling. For example, in isolated AICAR-fed rat muscles, insulin-stimulated GLUT4 translocation was up-regulated, as was glucose uptake [14]. Moreover, it was shown in C2C12 myotubes that the monounsaturated fatty acid oleic acid (C18:1n9) can diminish PAinduced IR through an AMPK-dependent mechanism [15]. In the most Western countries, there is 35%–40% of total dietary energy from fat, which is predominantly of saturated fat and is only around 8% of food energy from linoleic acid (C18:2n6; LA) and linolenic acid (C18:2n3; LNA) [16]. Data from epidemiologic study showed that intakes of vegetable fat and polyunsaturated fatty acids (PUFAs) were inversely associated with risk of type 2 diabetes [17]. The controlled intervention studies demonstrated that replacement of saturated fatty acids with PUFAs could improve insulin sensitivity and decrease diabetes risk [18]. Although the mechanism of this action was not clear, LA and LNA, 18-carbon PUFAs, can reverse the inhibition by PA of insulin-stimulated glucose uptake in myotubes [19]. Moreover, LA abolished the effect of PA on IL-6 and AMPK messenger RNA (mRNA) expression in myotubes [20,21]. The most important natural sources of gamma-linolenic acid (C18:3n6; GLA) are plant seed oils of evening primrose, borage, black currant, hemp and fungal oil of Mortierella isabellina and Mucor fragilis[22]. In human, GLA can be generated from LA by the action of Δ-6-desaturase which, however, is decreased by various pathophysiological states and life-style factors. Supplementation with GLA to offset the decline in activity of delta-6desaturase has therapeutic benefits in several inflammation-related diseases, including asthma, ulcerative colitis, rheumatoid arthritis, and atopic dermatitis, cardiovascular disease and cancer [22,23]. A renoprotective property of GLA was also shown in an animal model of diabetic nephropathy, which was attributed to the anti-inflammatory and antifibrotic actions of GLA [24]. Furthermore, data from our previous study showed that GLA is more potent than LA in inhibition of lipopolysaccharide-induced NF-κB transcriptional activity and inflammatory events in RAW 264.7 macrophages [25]. Based on these above findings, this study tested the hypothesis that GLA similar to other 18-carbon PUFAs, LA and LNA, restrained inflammation and IR in PA treated myotubes. Furthermore, we aimed to clarify the mechanism of action of these effects. 2. Materials and methods 2.1. Materials The C2C12 murine skeletal muscle cell line (BCRC number 60083) was purchased from the Food Industry Research and Development Institute (Hsinchu, Taiwan) and C57BL/6JNarl male mice were from the National Laboratory Animal Center (Taipei, Taiwan). Dulbecco's modified Eagle's medium (DMEM), Lipofectamine 2000 and TriReagent were obtained from Invitrogen Corporation (Carlsbad, CA, USA), and jetPRIME transfection reagent was from PolyPlus (Illkirch, France). Fetal bovine serum (FBS) and horse serum for cell culture were purchased from HyClone (Logan, UT, USA). LNA, LA, GLA and PA were from NuChek Prep, Inc. (Elysian, MN, USA), and borage oil was from Sigma Chemical Co. (St. Louis, MO, USA). Reagents for synthesizing complementary DNA were from Promega Corp. (Madison, WI, USA), and real-time quantitative

polymerase chain reaction (PCR) primers and TaqMan Universal PCR Master Mix were from Applied Biosystems (Foster City, CA, USA). The specific antibodies for IκB-α and GLUT4 and for total and phosphorylated PKC-θ, IKK-α/β and c-Jun N-terminal kinase (JNK) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Total and phosphorylated antibodies of p38 MAPK, extracellular-signal-regulated kinase 1/2 (ERK1/2), AMPK, AKT and acetyl-CoA carboxylase (ACC), as well as the phosphorylated antibody of AS160 were from Cell Signaling Technology Inc. (Beverly, MA, USA). The LightShift Chemiluminescent EMSA Kit, SuperSignal West Pico kit and chemiluminescence kits were from Pierce Chemical Corp (Rockford, IL, USA). The Plasma Membrane Protein Extraction Kit and Great EscAPe SEAP Chemiluminescence Kit 2.0 were from BioVision, Inc. (San Francisco, CA, USA) and Clontech (Takara Bio Company, Mountain View, CA, USA), respectively. [3H]2-Deoxyglucose was from PerkinElmer (Boston, MA, USA). All other chemicals were of the highest quality available. 2.2. Cell culture and treatment The mouse C2C12 myoblasts were maintained in DMEM supplemented with penicillin (100 units/ml), streptomycin (100 μg/ml), glutamine (2 mM) and 10% FBS at 37°C in a humidified atmosphere of 5% CO2. When cells reached 80% to 90% confluence, the medium was switched to the differentiation medium containing DMEM and 2% horse serum, and the myoblasts were fused into myotubes after 6 days of incubation. Differentiated C2C12 myotubes were incubated in DMEM containing 2% fatty acid-free bovine serum albumin (Sigma Chemical Co.) in the presence or absence of 750 μM PA with or without 100 μM LNA, LA and GLA. Fatty acid stocks were dissolved in methanol, and final concentrations were 20 μg/μl and 10 μg/μl for PA and18-carbon PUFAs, respectively. Control cells were incubated in DMEM containing 2% fatty acid-free bovine serum albumin and 1% methanol vehicle. 2.3. Cell viability assay The mitochondria-dependent reduction of 3-(4,5-dimethylthiazol-2yl)-2,5diphenyltetrazolium bromide (MTT) was used to measure cell respiration as an indicator of cell viability [26]. After treatment with fatty acids, C2C12 myotubes were incubated in DMEM containing 0.5 mg/ml MTT for 3 h. The medium was removed and isopropanol was added to dissolve the formazan. After centrifugation at 5000×g for 5 min, 200 μl of supernatant fluid from each sample was added to 96-well plates, and absorbance was read at 570 nm in a VersaMax Tunable Microplate Reader (Molecular Devices Corporation, Sunnyvale, CA, USA). 2.4. Isolation of RNA and real-time reverse transcriptase-PCR (real-time RT-PCR) Total RNA was extracted from gastrocnemius (GA) muscles and C2C12 myotubes by using Tri-Reagent as described by the manufacturer. RNA extracts were suspended in RNase-free water and were frozen at −80°C until analyzed. RNA was reverse transcribed with M-MMLV reverse transcriptase for synthesis of complementary DNA. Complementary DNA was amplified with TaqMan Universal PCR Master Mix primers and probes, and the reactions were measured in the StepOne System (Applied Biosystems). The primers and probes were ordered from Applied Biosystems: GLUT4 (Mm00436615_ml), IL-6 (Mm00446190_ml), TNF-α (Mm00443258_ml) and β-actin (Mm01205647_gl). Relative expression compared with the internal control β-actin was determined by using the 2−ΔΔCt method [27]. 2.5. Protein extraction Total protein extracts were prepared by homogenizing GA muscles and myotubes in phosphate-buffered saline (PBS) and RIPA buffer, respectively. Plasma membrane protein extracts were prepared by using the Plasma Membrane Protein Extraction Kit following the manufacturer's instructions. Protein contents were quantified by the modified Lowry assay [28].

Table 1 Effects of 18-carbon PUFAs on MTT assay and PA-induced IL-6 and TNF-α mRNA expression in C2C12 myotubes. Treatment ⁎ 100 μM

–

PA 750 μM –

LNA

LA

GLA

MTT † IL-6 † TNF-α †

122.3±14.8 3.0±1.2c 13.2±7.3c

100.0±0.0a 100.0±0.0a 100.0±0.0a

113.7±9.8 35.3±16.7b 26.3±7.4b

107.3±2.2 2.5±1.0c 12.3±7.9c

136.5±11.1 11.5±3.7bc 19.8±6.8bc

Values in the same row with different superscript letters are significantly different (Pb.05). ⁎ C2C12 myotubes were treated with or without PA (750 μM) plus vehicle control, LNA, LA or GLA (100 μM) for 16 h. † Data are the mean±S.D. of at least four separate experiments and are expressed as the percentage of the culture treated with PA alone.

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

3

2.6. Western blot

2.8. Plasmids and transient transfection

Equal amounts of proteins were denatured and separated on sodium dodecyl sulfate (SDS)–polyacrylamide gels and were then transferred to polyvinylidene difluoride membranes (New Life Science Product, Inc., Boston, MA, USA). The blots were incubated sequentially with primary antibodies and horseradish peroxidase-conjugated secondary antibodies (Bio-Rad, Hercules, CA, USA). Immunoreactive protein bands were developed by the enhanced chemiluminescence kit, were visualized by use of a luminescent image analyzer (LAS-1000 plus; Fuji Photo Film Company, Japan) and were quantified by use of AlphaImager 2200 (Alpha Innotech Corp., San Leandro, CA, USA).

IKK-2 WT and IKK2-S177E S181E (IKK-2 SE) expression plasmids were purchased from Addgene (Cambridge, MA, USA). pSV-β-galactosidase control vector and NF-κBsecreted embryonic alkaline phosphatase (SEAP) reporter plasmid were from Promega Co. and Dr. Jaw-Ji Yang (Chung Shan Medical University, Taiwan), respectively. At 50%– 60% confluence, the C2C12 myoblasts were used for transfection with lipofectamine 2000 reagent. The transfected myoblasts were cultured in differentiation medium for 6 days and were then treated as indicated in the figure legends. 2.9. Reporter gene assay

2.7. Isolation of nuclear protein and EMSA After being washed with cold PBS, C2C12 myotubes were scraped with ice-cold PBS and centrifuged. The pellets were resuspended in the hypotonic extraction buffer (10 mM HEPES, 10 mM KCl, 1 mM MgCl2, 1 mM EDTA, 0.5 mM dithiothreitol, 0.2 mM PMSF, 4 μg/ml leupeptin, 20 μg/ml aprotinin and 0.5% NP-40) at 4°C for 15 min and were then centrifuged at 6000×g for 15 min. The pellets were resuspended in 50 μl hypertonic extracted buffer (10 mM HEPES, 10 mM KCl, 1 mM MgCl2, 1 mM EDTA, 0.5 mM dithiothreitol, 0.2 mM PMSF, 4 μg/ml leupeptin, 20 μg/ml aprotinin and 10% glycerol) and were constantly shaken for 30 min at room temperature. The samples were then centrifuged at 10,000×g for 15 min. The supernatant fluid containing nuclear proteins was collected and stored at −80°C. EMSA was performed according to our previous study [29]. The LightShift Chemiluminescent EMSA Kit and synthetic biotin-labeled, double-stranded consensus oligonucleotides of NF-κB (5′-AGTTGAGGGGACTTTCCCAGGC-3′) were used to measure the effects of 18-carbon PUFAs on PA-induced NF-κB nuclear protein–DNA binding activity. Nuclear protein extracts in reaction mixture containing poly(dI-dC), binding buffer, and biotin-labeled double-stranded oligonucleotides of NF-κB were incubated at room temperate for 30 min. In addition, excess amount (100-fold molar excess) of the unlabeled double-stranded oligonucleotides and mutant double-stranded oligonucleotides of NF-κB (5′-AGTTGAGGCGACTTTCCCAGGC-3′) were used for the competition assay to confirm specificity of binding. Nuclear protein–DNA complexes were separated from the unbound DNA probe on an 8% Tris/boric acid/EDTA–polyacrylamide gel and were then transferred to nylon membranes. The membranes were treated with streptavidin–horseradish peroxidase, and the nuclear protein–DNA bands were developed by using a SuperSignal West Pico kit.

NF-κB transcriptional activity was determined by activity of the reporter enzyme SEAP by use of the Great EscAPe SEAP chemiluminescence kit 2.0. SEAP activity was corrected on the basis of β-galactosidase activity by using the β-galactosidase enzyme assay system with reporter lysis buffer. 2.10. RNA interference by small hairpin RNA of AMPK Lentiviral infection of the C2C12 myotubes was used to stably integrate and express short hairpin RNA (shRNA) targeting the AMPK mRNA sequence. Lentiviral shRNA vectors of control and two different sequences targeting AMPK mRNA were purchased from the National RNAi Core Facility (Taipei, Taiwan) as follows: shLuc TRCN00000772246 (responding sequence: 5′ CGCTGAGTACTTCGAAATGTC 3′) for vector control targeted to luciferase and shAMPK (1) TRCN 0000360842 (responding sequence: 5′ TGTTGGATTTCCGTAGTATT 3′) and shAMPK (2) TRCN 0000360841 (responding sequence: 5′ CACGAGTTGACCGGACATAAA 3′) targeted to AMPK. Lentiviral particles were generated in 293T cells grown in DMEM medium supplemented with 10% FBS in an incubator at 37°C and 5% CO2. Until full confluence, the 293T cells were transfected with 5 μg pLKO.1 shRNA, 5 μg pCMVΔR8.91 and 0.5 μg pMD.G with jetPEI DNA transfection reagent according to the manufacturer's protocol. After incubation for 8 h, the culture medium was changed to remove the transfection reagent. The medium was then collected at the end of an additional 24 and 48 h of incubation with the 293T cells. The medium was filtered through a 0.22-μm filter (Sartorius Stedim Biotech) and was stored at −80°C for future use. C2C12 myoblasts were seeded into 6-cm plastic culture dishes. The next day, the cells were infected with recombinant lentivirus vectors at a multiplicity of infection of 1. At 24 h after transfection, the cells were selected by puromycin for another 24 h and

Fig. 1. The 18-carbon PUFAs obstruct PA-induced activation of PKC-θ and the MAPKs in C2C12 myotubes. C2C12 myotubes were preincubated with 100 μM LNA, LA or GLA for 12 h and were then treated with either vehicle (methanol) control or 750 μM PA for 8 h (PKC-θ activation) or 12 h (MAPK activation). Cells were lysed and Western blot was performed to measure phosphorylated and total protein expression of PKC-θ (A) and ERK 1/2, p38 MAPK and JNK (B). The ratios of immunointensity between the total and the phosphorylated proteins are expressed as the percentage of the culture treated with PA alone. Data are the mean±S.D. of four separate experiments and values not sharing the same letter are significantly different (Pb.05).

4

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

were then passaged to 10-cm plastic culture dishes in differentiation media containing puromycin for cell differentiation and stable transfection. At the end of differentiation, the infected myotubes were treated as indicated.

terminate the reaction. Cells were lysed in 0.1% SDS in KRH (−) glucose buffer, and the radioactivity incorporated into the cells was measured by using a scintillation counter (MicroBeta, Perkin-Elmer, MA). The values of glucose uptake were corrected for nonspecific background by subtracting the radioactivity of the KRH (−) glucose buffer.

2.11. 2-Deoxyglucose uptake assay 2.12. Animals and induction of diabetes 2-Deoxyglucose uptake measurement was according to the method of Shi and Kandror [30] with some modifications. Briefly, after experimental treatments, C2C12 myotubes were incubated in serum-free media for 4 h. Thereafter, cells were incubated with or without 10 nmol/l insulin in Krebs Ringer HEPES buffer without glucose (KRH (−) glucose; 121 mM NaCl, 4.9 mM KCl, 1.2 mM MgSO4, 0.33 mMCaCl2, 12 mM HEPES, pH 7.4) for 1 h. To measure glucose transport, cells were incubated in KRH (−) glucose buffer containing 100 mM 2-deoxyglucose and 10 Ci/mM [3H]2-deoxyglucose for 5 min and then washed with ice-cold KRH (+) glucose buffer (121 mM NaCl, 4.9 mM KCl, 1.2 mM MgSO4, 0.33 mM CaCl2, 12 mM HEPES, 25 mM glucose, pH 7.4) to

C57BL/6JNarl male mice aged 5 weeks were purchased from the National Laboratory Animal Center (National Science Council, Taipei City, Taiwan) and were housed in standard laboratory conditions (22±2°C and 60%–80% relative humidity, 12-h light–dark cycle) with free access to food and water. Mice in the control group were fed a standard commercial mouse chow and were injected with sodium citrate buffer. To induce diabetes, mice were fed a 60% high-fat diet (HFD; TestDiet, St. Louis, MO) for 2 weeks and were then intraperitoneally injected with streptozotocin (STZ; 50 mg/kg, dissolved in 0.1 M sodium citrate buffer, pH 4.5) for 5 consecutive days. The fasting blood glucose level was measured from the tail

Fig. 2. The 18-carbon PUFAs ameliorate PA-induced IR in C2C12 myotubes. C2C12 myotubes were treated with or without PA (750 μM) plus vehicle (methanol) control, LNA, LA or GLA (100 μM) for 16 h followed by stimulation with insulin (10 nmol/l) for 15 min (phosphorylated PKC-θ, AKT and AMPK protein) or 60 min (phosphorylated AS160 and plasma membrane GLUT4 protein as well as [3H]2-deoxyglucose uptake). The protein expression of phosphorylated PKC-θ, AKT, AMPK and AS160 as well as plasma membrane GLUT4 was measured by Western blot and is expressed as the percentage of the culture treated with insulin alone after adjustment with total protein (for phosphorylated PKC-θ, AKT and AMPK), actin (for phosphorylated AS160) or cytosolic GLUT4 and actin (for plasma membrane GLUT4) (A). [3H]2-Deoxyglucose uptake was measured as described in Materials and Methods and is expressed as fold induction over basal (non-insulin-stimulated) glucose uptake (B). Data are the mean±S.D. of three separate experiments and values not having the same letter are significantly different (Pb.05).

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

vein by using a blood glucose meter (LifeScan Inc, Milpitas, CA, USA). After 2 weeks of STZ injection, mice with sustained elevated blood glucose levels during fasting (N500 mg/dl) were selected and randomly divided into supplemented with borage oil (150 μl/mouse by intragastric gavage, every other day) or without gavage feeding of borage oil (10 animals each groups). Body weight and fasting blood glucose were measured every other week, and mice were sacrificed after a 16-week treatment. GA muscles were then collected for Western blot and real-time RT-PCR analysis. All animals were handled in compliance with the guidelines of the Institutional Animal

5

Care and Use Committee of Chung Shan Medical University for the care and use of laboratory animals. 2.13. Statistical analysis Data are expressed as means±S.D. and were evaluated for statistical significance by oneway analysis of variance and Tukey's multiple-range test by use of Statistical Analysis System (Cary, NC, USA). A value of Pb.05 was considered to be statistically significant.

Fig. 3. The 18-carbon PUFAs inhibit PA-induced NF-κB activation in C2C12 myotubes. C2C12 myotubes were preincubated with 100 μM LNA, LA or GLA for 12 h and were then treated with either vehicle (methanol) control or 750 μM PA for 12 h. Western blot analysis was used to measure the protein content of phosphorylated IKK-β and IκB-α in the cytosolic factions (A). EMSA experiments were carried out by using the LighShift Chemiluminescent EMSA kit. The unlabeled double-stranded oligonucleotides and mutant double-stranded oligonucleotides of NF-κB were added for the competition assay and specificity assay, respectively. Bands were detected by using streptavidin–horseradish peroxidase and were developed by using a SuperSignal West Pico kit (B). C2C12 myoblasts were transiently transfected with pSV-β-galactosidase and pNF-κB-SEAP reporter gene for 24 h and were then cultured in differentiation media for 6 days followed by treatments with or without PA (750 μM) plus vehicle (methanol) control, LNA, LA or GLA (100 μM) for 16 h. The activity of the reporter enzyme SEAP by use of the Great EscAPe SEAP chemiluminescence kit 2.0 and the β-galactosidase activity was measured by β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer from Promega Corp (C). Data are the mean±S.D. of four separate experiments and are expressed as the percentage of the culture treated with PA alone after adjustment with total protein (for IKK-β), actin (for IκB-α) or β-galactosidase activity (for SEAP activity). Values not sharing the same letter are significantly different (Pb.05).

6

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

3. Results 3.1. The 18-carbon PUFAs inhibit PA-induced proinflammatory mediator expression in C2C12 myotubes Treatment with 750 μM PA alone or with 100 μM LNA, LA or GLA did not influence cell viability compared with the methanol vehicle control (Table 1). Compared with the control, incubation of C2C12 myotubes with PA dramatically induced IL-6 and TNF-α mRNA expression, and this increase in expression was significantly inhibited by co-treatment with the 18-carbon PUFAs (Pb.05; Table 1).

3.2. The 18-carbon PUFAs obstruct PA-induced activation of PKC-θ and MAPKs in C2C12 myotubes To test whether 18-carbon PUFAs modulated PA-induced activation of PKC-θ and MAPKs we examined the phosphorylation of these kinases by Western blotting. Compared with the control, PA treatment resulted in a strong increase in expression of phosphorylated PKC-θ, ERK1/2 and p38 MAPK but not JNK (Pb.05; Fig. 1A and B). Addition of the 18-carbon PUFAs, however, significantly reduced the PA-induced phosphorylation of PKC-θ and MAPKs (Pb.05; Fig. 1A and B).

Fig. 4. Effects of 18-carbon PUFAs on PA-induced inflammation and IR in C2C12 myotubes transfected with constitutively active mutant IKK-β. C2C12 myoblasts were transiently transfected with IKK-2 WT and IKK-2 SE for 24 h and were then cultured in differentiation media for 6 days. C2C12 myotubes were preincubated with 100 μM LNA, LA or GLA for 12 h and were then treated with either vehicle (methanol) control or 750 μM PA for 12 h to measure levels of phosphorylated IKK-β and IκB-α protein (A). C2C12 myotubes were treated with or without PA (750 μM) plus vehicle control, LNA, LA or GLA (100 μM) for 16 h to measure IL-6 and TNF-α mRNA expression (B). C2C12 myotubes were treated with or without PA (750 μM) plus vehicle (methanol) control, LNA, LA or GLA (100 μM) for 16 h followed by stimulation with insulin (10 nmol/l) for 60 min to measure insulin-stimulated phosphorylated AS160 protein (C) and [3H]2-deoxyglucose uptake (D). The amount of protein expression was adjusted to total protein or actin. Data are the mean±S.D. of three separate experiments and are expressed as the percentage of the culture treated with IKK-2 WT control or IKK-2 WT PA alone. Within treatments with the same plasmid transfection, values not sharing the same letter are significantly different (Pb.05).

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

3.3. The 18-carbon PUFAs ameliorate PA-induced IR in C2C12 myotubes The phosphorylation of PKC-θ, AKT and AS160 as well as GLUT4 translocation and glucose uptake were assessed to explore the effects of the 18-carbon PUFAs on PA-induced IR. Compared with control, insulin enhanced the phosphorylation of AKT and AS160 as well as plasma membrane GLUT4 content and glucose uptake in C2C12 myotubes. These insulin signaling parameters were disrupted when cells were treated with 750 μM PA for 16 h, whereas the addition of the 18-carbon PUFAs reversed the effect of PA on insulin responsiveness (Pb.05; Fig. 2A and B). Moreover, compared with insulin alone treatment, PA plus insulin treatment increased phosphorylated PKC-θ expression, whereas the addition of the 18-carbon PUFAs reversed the effect of PA (Pb.05; Fig. 2A). 3.4. The 18-carbon PUFAs inhibit PA-induced activation of the NF-κB pathway in C2C12 myotubes Previous data showed that the anti-inflammatory activity of the LA and GLA is through the blockade of NF-κB activation in lipopolysaccha-

7

ride-stimulated RAW264.7 macrophages [25]. In C2C12 myotubes also, the 18-carbon PUFAs abolished the PA-induced NF-κB activation as evidenced by decreases in PA-induced IKK-β phosphorylation, IκB-α degradation, NF-κB nuclear protein–DNA binding activity and NF-κB transcriptional activity (Pb.05; Fig. 3A–C). Notably, when we used a constitutively active mutant IKK-β (IKK-2 SE) plasmid, which blocked the ability of the 18-carbon PUFAs to inhibit PA-induced NF-κB activation, the protective ability of the 18-carbon PUFAs was abolished. Specifically, the protection against the PA-induced increase in proinflammatory cytokine expression vanished, as did the protection against the decrease in insulinstimulated AS160 phosphorylation as well as glucose uptake (Pb.05; Fig. 4A–D). 3.5. The 18-carbon PUFAs improve AMPK-related events and glucose uptake in PA-treated C2C12 myotubes Previous studies have shown that AMPK activation results in an enhancement of glucose uptake in basal and insulin-treated myotubes [12–14]. In C2C12 myotubes, treatment with 750 μM PA significantly

Fig. 5. The 18-carbon PUFAs improve AMPK-related events and glucose uptake in PA-treated C2C12 myotubes. C2C12 myotubes were treated with or without PA (750 μM) plus vehicle (methanol) control, LNA, LA or GLA (100 μM) for 16 h except for phosphorylated AMPK protein (12 h). Western blot analysis was used to measure the protein content of phosphorylated AMPK, ACC and AS160 adjusted to total protein or actin (A). Real-time RT-PCR was used to measure GLUT4 mRNA expression and the [3H]2-deoxyglucose level was measured for glucose uptake (B). Data are the mean±S.D. of four separate experiments and are expressed as the percentage of the culture treated with control or PA alone. Values not sharing the same letter are significantly different (Pb.05).

8

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

reduced the phosphorylation of AMPK and ACC (Pb.05; Fig. 5A). Moreover, PA treatment decreased plasma membrane GLUT4 content, GLUT4 mRNA expression and basal glucose uptake (without insulin treatment) compared with control (Pb.05; Figs. 5A and B and 2A). Notably, PA treatment inhibited the insulin-induced AMPK phosphorylation and plasma membrane GLUT4 content when compared with insulin alone treatment (Pb.05; Fig. 2A). Cotreatment with the 18-carbon PUFAs, however, annulled the inhibitory effect of PA. Moreover, co-treatment with the 18-carbon

PUFAs increased phosphorylated AS160 level compared with PA alone treatment (Pb.05; Fig. 5A). Next, we utilized a lentiviral-vector-constructed shRNA targeting AMPK to examine the role of AMPK activation in the effects of the 18carbon PUFAs. Western blot analysis revealed that both shRNA-1 and shRNA-2 led to notable suppression of AMPK (Fig. 6A and D) and phosphorylated AMPK expression (data not shown), whereas no knockout effect was observed following scrambled shRNA infection. Both shRNAs exerted a powerful and specific knockout of AMPK

Fig. 6. Effect of AMPK silencing on mitigation of PA-induced NF-κB activation and IR by 18-carbon PUFAs. After transduction with Luc or AMPK shRNA expression lentivirus, C2C12 myoblasts were selected by puromycin for 2 days and were then cultured in differentiation media for 6 day. C2C12 shLuc and shAMPK myotubes were preincubated with 100 μM LNA, LA or GLA for 12 h and were then treated with either vehicle (methanol) control or 750 μM PA for 12 h to measure the levels of AMPK (A), cytosolic IκB-α and nuclear p65 protein (adjusted to actin and PARP, respectively) (B). C2C12 shLuc and shAMPK myotubes were treated with or without PA (750 μM) plus vehicle control, LNA, LA or GLA (100 μM) for 16 h to measure IL-6 and TNF-α mRNA expression (C). C2C12 shLuc and shAMPK myotubes were treated with or without PA (750 μM) plus vehicle control, LNA, LA or GLA for 16 h followed by stimulation with insulin (10 nmol/l). The levels of AMPK, and phosphorylated AS160 protein (adjusted to actin) (D) and [3H]2-deoxyglucose uptake were measured (E). Data are the mean±S.D. of at four separate experiments and are expressed as the percentage of the culture treated with Luc vehicle control or Luc PA alone. Within treatments with the same shRNA transduction, values not sharing the same letter are significantly different (Pb.05).

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

expression in C2C12 myotubes. Silencing of AMPK did not change the inhibitory effects of the 18-carbon PUFAs on PA-induced NF-κB activation or proinflammatory cytokine expression (Pb.05; Fig. 6B and C). Notably, silencing of AMPK in turn reduced the ability of the 18-carbon PUFAs to inhibit the action of PA on insulin-stimulated AS160 phosphorylation and glucose uptake (Pb.05; Fig. 6D and E).

9

3.6. Borage oil decreases inflammatory responses in the gastrocnemius muscles of diabetic mice To confirm the anti-inflammatory effect of GLA, we attempted to determine the effects of GLA-rich borage oil on inflammatory responses in the skeletal muscle of HFD/STZ-induced diabetic mice.

Fig. 7. Ameliorative effect of borage oil (BO) on inflammatory responses in the GA muscles of HFD/STZ-induced diabetic mice. A representative Western blot gel showing the protein levels of phosphorylated MAPKs and PKC-θ as well as cytoplasm IκB-α and nuclear p65 in the GA muscles is shown (A). Real-time RT-PCR was used to measure IL-6 and TNF-αmRNA expression in GA muscles (B). Data are the mean±S.D. of five mice per group and are expressed as the percentage of expression in diabetic mice consuming the chow diet. Values not sharing the same letter are significantly different (Pb.05). N, normal control mice; DM, diabetic mice consuming the chow diet; DM/BO, diabetic mice supplemented with borage oil.

10

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

As shown in Fig. 7A and B, compared with the normal control, diabetic mice showed a markedly increased mRNA expression of IL-6 and TNFα as well as increased phosphorylation of ERK1/2, p38 MAPK and PKC-θ in GA muscle. Moreover, NF-κB was activated in the GA muscles of diabetic mice as evidenced by the increase in nuclear p65 level and the decrease in cytoplasmic IκB-α protein content. Of note were the decreases in these inflammatory events in diabetic mice fed borage oil. 4. Discussion Chronic low-grade inflammation, which is characterized by increased production of proinflammatory cytokines such as IL-6 and TNF-α, plays a crucial role in the development of IR and type 2 diabetes [3]. In response to PA treatment, the considerable production of IL-6 and TNF-α acts in an autocrine manner to induce IR in myotubes [4,5]. Interestingly, administration of LA diminishes IL-6 and TNF-α mRNA expression in the skeletal muscle of spontaneous type 2 diabetic rats [31]. Compared with a control diet, LNA intake decreases serum IL-6 and TNF-α in HFD/STZ-induced diabetic rats [32]. Our present data showed that GLA has a similar inhibitory potency to that of LA and LNA on PA-induced IL-6 and TNF-α expression in C2C12 myotubes. Moreover, these 18-carbon PUFAs blocked the PA-induced proinflammatory signal transduction pathways as evidenced by the decreased phosphorylation of PKC-θ, ERK1/2 and p38MAPK as well as the decreased NF-κB activation. NF-κB has long been considered the central mediator of chronic inflammation-related diseases through the transcriptional regulation of proinflammatory gene expression [7]. Lipid overload, especially with PA, activates NF-κB transcriptional activity, which results in subclinical inflammation and has been linked to the pathogenesis of IR in skeletal muscle [4,5]. Inhibition of NF-κB activity by pharmacological means or by use of small interfering RNA technology can ameliorate PA-induced proinflammatory cytokine expression and IR [4,5,8]. Previous data showed that oleic acid can prevent PA-induced IL-6 expression and NF-κB activation and can ameliorate PA-induced inhibition of AKT phosphorylation and glucose uptake by insulin stimulation [33]. Our data showed that the 18-carbon PUFAs also inhibited PA-induced NFκB activation and IR in C2C12 myotubes. Notably, when the ability to inhibit NF-κB activation was impeded by transfection with a constitutively active mutant IKK-β (IKK-2 SE) plasmid, the 18-carbon PUFAs could no longer inhibit the PA-induced inflammatory response and IR. These data suggest that modulating NF-κB activity plays an important role in the inhibitory effects of the 18-carbon PUFAs on the PA-induced inflammatory response and IR in C2C12 myotubes. AMPK activation is involved not only in the increase in glucose uptake in the absence of insulin but also in the amelioration of IR in skeletal muscle [12,15]. Moreover, AMPK activation restrains NF-κB activity and inflammatory responses in different cell types including myotubes [34,35]. A recent study reported that AMPK activation is required for the inhibitory effect of oleic acid on PA-induced inflammation and IR in C2C12 myotubes [15]. In the present work, we showed that supplementation with 18-carbon PUFAs limited the reduction in phosphorylation of AMPK and its downstream mediators by PA treatment. To further underpin the involvement of AMPK in the effects of the 18-carbon PUFAs on PA-treated myotubes, we manipulated AMPK activity by use of AMPK shRNA. Similar to the effects of oleic acid, our data showed that the 18-carbon PUFAs blocked the PA-induced reduction in glucose uptake and insulin signaling through an AMPK-dependent mechanism. Of note, decreasing AMPK activation did not influence the anti-inflammatory properties of the 18-carbon PUFAs in PA-treated C2C12 myotubes. These data suggest that other signal transduction pathways such as PCK-θ and the MAPK pathways rather than AMPK activation are involved in the inhibitory effects of the 18-carbon PUFAs on PAinduced inflammatory events.

Diets rich in saturated fat contribute to the development of IR, and inflammatory signaling pathways play a major role in this interaction [36]. Our previous results revealed that GLA inhibits inflammatory responses through inactivation of NF-κB and AP-1 by suppressing oxidative stress and the MAPK signal pathway in lipopolysaccharideinduced RAW 264.7 macrophages [25]. Moreover, in STZ-induced diabetic nephropathy, GLA exerts anti-inflammatory effects [24]. The data presented herein showed that oral administration of GLA-rich borage oil decreased IL-6 and TNF-α expression in GA muscles of HFD/ STZ-induced diabetic mice. Consistent with the in vitro findings, activation of the proinflammatory signal pathways was impeded in diabetic mice supplemented with borage oil. Previous data demonstrated that PA through modulating cell membrane function, fatty acyl-CoA metabolites, gene expression and enzyme activity influenced inflammatory responses and insulin action [37,38]. Our data showed that LA, GLA and LNA have an antiinflammatory property in PA-treated skeletal muscle by impeding the activation of the MPAKs and PKC-θ and transcriptional activity of NF-κB. Supplementation with GLA-rich borage oil has a beneficial effect on inflammatory responses in the skeletal muscle of diabetic mice. Notably, we have demonstrated for the first time that these 18carbon PUFAs can annul the effect of PA on AMPK and NF-κB activity and that this annulment is accompanied by an increase of insulin responsiveness in PA treated C2C12 myotubes. Skeletal muscle is the major peripheral tissue responsible for glucose disposal and therefore IR in skeletal muscle is important in development of type 2 diabetes [39]. Our findings support the beneficial role of 18-carbon PUFAs in improving IR and decreasing type 2 diabetes. References [1] Boden G. Role of fatty acids in the pathogenesis of insulin resistance and NIDDM. Diabetes 1997;46:3–10. [2] Biddinger SB, Kahn CR. From mice to men: insights into the insulin resistance syndromes. Annu Rev Physiol 2006;68:123–58. [3] Wellen KE, Hotamisligil GS. Inflammation, stress, and diabetes. J Clin Invest 2005; 115:1111–9. [4] Jove M, Planavila A, Sanchez RM, Merlos M, Laguna JC, Vazquez-Carrera M. Palmitate induces tumor necrosis factor-alpha expression in C2C12 skeletal muscle cells by a mechanism involving protein kinase C and nuclear factorkappaB activation. Endocrinology 2006;147:552–61. [5] Jove M, Planavila A, Laguna JC, Vazquez-Carrera M. Palmitate-induced interleukin 6 production is mediated by protein kinase C and nuclear-factor kappaB activation and leads to glucose transporter 4 down-regulation in skeletal muscle cells. Endocrinology 2005;146:3087–95. [6] Chen F, Castranova V, Shi X, Demers LM. New insights into the role of nuclear factor-kappaB, a ubiquitous transcription factor in the initiation of diseases. Clin Chem 1999;45:7–17. [7] Barnes PJ, Karin M. Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 1997;336:1066–71. [8] Zhang J, Wu W, Li D, Guo Y, Ding H. Overactivation of NF-kappaB impairs insulin sensitivity and mediates palmitate-induced insulin resistance in C2C12 skeletal muscle cells. Endocrine 2010;37:157–66. [9] Long YC, Zierath JR. AMP-activated protein kinase signaling in metabolic regulation. J Clin Invest 2006;116:1776–83. [10] Bruss MD, Arias EB, Lienhard GE, Cartee GD. Increased phosphorylation of Akt substrate of 160 kDa (AS160) in rat skeletal muscle in response to insulin or contractile activity. Diabetes 2005;54:41–50. [11] Zheng D, MacLean PS, Pohnert SC, Knight JB, Olson AL, Winder WW, et al. Regulation of muscle GLUT-4 transcription by AMP-activated protein kinase. J Appl Physiol 2001;91:1073–83. [12] Kurth-Kraczek EJ, Hirshman MF, Goodyear LJ, Winder WW. 5-AMP-activated protein kinase activation causes GLUT4 translocation in skeletal muscle. Diabetes 1999;48:1667–71. [13] Treebak JT, Glund S, Deshmukh A, Klein DK, Long YC, Jensen TE, et al. AMPKmediated AS160 phosphorylation in skeletal muscle is dependent on AMPK catalytic and regulatory subunits. Diabetes 2006;55:2051–8. [14] Buhl ES, Jessen N, Schmitz O, Pedersen SB, Pedersen O, Holman GD, et al. Chronic treatment with 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside increases insulin-stimulated glucose uptake and GLUT4 translocation in rat skeletal muscles in a fiber type-specific manner. Diabetes 2001;50:12–7. [15] Salvado L, Coll T, Gomez-Foix AM, Salmeron E, Barroso E, Palomer X, et al. Oleate prevents saturated-fatty-acid-induced ER stress, inflammation and insulin resistance in skeletal muscle cells through an AMPK-dependent mechanism. Diabetologia 2013;56:1372–82.

P.-Y. Chen et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx

[16] Sanders TA. Polyunsaturated fatty acids in the food chain in Europe. Am J Clin Nutr 2000;71:176S–8S. [17] Salmerón J, Hu FB, Manson JE, Stampfer MJ, Colditz GA, Rimm EB, et al. Dietary fat intake and risk of type 2 diabetes in women. Am J Clin Nutr 2001;73:1019–26. [18] Risérus U, Willett WC, Hu FB. Dietary fats and prevention of type 2 diabetes. Prog Lipid Res 2009;48:44–51. [19] Sawada K, Kawabata K, Yamashita T, Kawasaki K, Yamamoto N, Ashida H. Ameliorative effects of polyunsaturated fatty acids against palmitic acid-induced insulin resistance in L6 skeletal muscle cells. Lipids Health Dis 2012;11:36. [20] Weigert C, Brodbeck K, Staiger H, Kausch C, Machicao F, Haring HU, et al. Palmitate, but not unsaturated fatty acids, induces the expression of interleukin-6 in human myotubes through proteasome-dependent activation of nuclear factorkappaB. J Biol Chem 2004;279:23942–52. [21] Lam YY, Hatzinikolas G, Weir JM, Janovska A, McAinch AJ, Game P, et al. Insulinstimulated glucose uptake and pathways regulating energy metabolism in skeletal muscle cells: the effects of subcutaneous and visceral fat, and longchain saturated, n-3 and n-6 polyunsaturated fatty acids. Biochim Biophys Acta 1811;2011:468–75. [22] Kapoor R, Huang YS. Gamma linolenic acid: an antiinflammatory omega-6 fatty acid. Curr Pharm Biotechnol 2006;7:531–4. [23] Fan YY, Chapkin RS. Importance of dietary gamma linolenic acid in human health and nutrition. J Nutr 1998;128:1411–4. [24] Kim DH, Yoo TH, Lee SH, Kang HY, Nam BY, Kwak SJ, et al. Gamma linolenic acid exerts anti-inflammatory and anti-fibrotic effects in diabetic nephropathy. Yonsei Med J 2012;53:1165–75. [25] Chang CS, Sun HL, Lii CK, Chen HW, Chen PY, Liu KL. Gamma-linolenic acid inhibits inflammatory responses by regulating NF-kappaB and AP-1 activation in lipopolysaccharide-induced RAW 264.7 macrophages. Inflammation 2010;33: 46–57. [26] Denizot F, Lang R. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods 1986;89:271–7. [27] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 2001;25:402–8.

11

[28] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265–75. [29] Liu KL, Chen HW, Wang RY, Lei YP, Sheen LY, Lii CK. DATS reduces LPS-induced iNOS expression, NO production, oxidative stress, and NF-kappaB activation in RAW 264.7 macrophages. J Agric Food Chem 2006;54:3472–8. [30] Shi J, Kandror KV. Study of glucose uptake in adipose cells. Methods Mol Biol 2008; 456:307–15. [31] Figueras M, Olivan M, Busquets S, Lopez-Soriano FJ, Argiles JM. Effects of eicosapentaenoic acid (EPA) treatment on insulin sensitivity in an animal model of diabetes: improvement of the inflammatory status. Obesity (Silver Spring) 2011;19:362–9. [32] Xie N, Zhang W, Li J, Liang H, Zhou H, Duan W, et al. α-Linolenic acid intake attenuates myocardial ischemia/reperfusion injury through anti-inflammatory and anti-oxidative stress effects in diabetic but not normal rats. Arch Med Res 2011 Apr;42(3):171–81. [33] Coll T, Eyre E, Rodriguez-Calvo R, Palomer X, Sanchez RM, Merlos M, et al. Oleate reverses palmitate-induced insulin resistance and inflammation in skeletal muscle cells. J Biol Chem 2008;283:11107–16. [34] Green CJ, Macrae K, Fogarty S, Hardie DG, Sakamoto K, Hundal HS. Countermodulation of fatty acid-induced pro-inflammatory nuclear factor kappaB signalling in rat skeletal muscle cells by AMP-activated protein kinase. Biochem J 2011;435:463–74. [35] Katerelos M, Mudge SJ, Stapleton D, Auwardt RB, Fraser SA, Chen CG, et al. 5Aminoimidazole-4-carboxamide ribonucleoside and AMP-activated protein kinase inhibit signalling through NF-kappaB. Immunol Cell Biol 2010;88:754–60. [36] Shi H, Kokoeva MV, Inouye K, Tzameli I, Yin H, Flier JS. TLR4 links innate immunity and fatty acid-induced insulin resistance. J Clin Invest 2006;116:3015–25. [37] Vessby B. Dietary fat and insulin action in humans. Br J Nutr 2000;83(Suppl. 1): S91–6. [38] Risérus U. Fatty acids and insulin sensitivity. Curr Opin Clin Nutr Metab Care 2008; 11:100–5. [39] Baron AD, Brechtel G, Wallace P, Edelman SV. Rates and tissue sites of non-insulinand insulin-mediated glucose uptake in humans. Am J Physiol Endocrinol Metab 1988;255:E769–74.