2 and activating PPARγ both in vitro and in vivo

Journal of Functional Foods 38 (2017) 338–348

Contents lists available at ScienceDirect

Journal of Functional Foods journal homepage: www.elsevier.com/locate/jff

Persimmon tannin promoted macrophage reverse cholesterol transport through inhibiting ERK1/2 and activating PPARc both in vitro and in vivo Zhenzhen Ge a, Mengying Zhang a, Xiangyi Deng a, Wei Zhu a, Kaikai Li a, Chunmei Li a,b,⇑ a b

College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, China Key Laboratory of Environment Correlative Food Science (Huazhong Agricultural University), Ministry of Education, China

a r t i c l e

i n f o

Article history: Received 31 March 2017 Received in revised form 6 September 2017 Accepted 14 September 2017

Keywords: Persimmon tannin Macrophage RCT Phosphorylation of ERK1/2 PPARc Cholesterol efflux

a b s t r a c t The purpose of this study was to investigate whether persimmon tannin is associated with cholesterol efflux and macrophage-reverse cholesterol transport (RCT). In J774A.1 macrophage cells, persimmon tannin could inhibit cellular cholesterol accumulation and promote 22-NBD-cholesterol efflux through inhibiting the phosphorylation of ERK1/2 and up-regulating the protein levels of PPARc. Macrophage RCT in vivo was evaluated by injecting 22-NBD-cholesterol-loaded J774A.1 macrophages intraperitoneally into C57BL/6J mice. Administration of persimmon tannin significantly (P < 0.05) decreased the cholesterol concentration in both serum and liver, and increased faecal cholesterol excretion compared with the high-cholesterol group. In transcriptional levels, persimmon tannin enhanced the expression of cholesterol transport-related genes (ABCA1, LCAT, ABCG5/G8, NPC1L1 and CYP7A1) and their upstream nuclear receptors (PPARc, PPARa and LXRa). Moreover, the regulation of persimmon tannin on RCTrelated genes might be mediated by its inhibition on ERK1/2 in mice. Therefore, persimmon tannin promoted macrophage reverse cholesterol transport through the regulation on ERK1/2-PPARc signaling pathway both in vitro and in vivo. Ó 2017 Published by Elsevier Ltd.

1. Introduction As a structural component of mammalian cell membrane, cholesterol is vital for signal transduction (Maxfield & Tabas, 2005). However, excessive accumulation of cholesterol in the blood may lead to multiple pathological consequences, especially atherosclerosis, which is one of the major causes of cardiovascular disease and global deaths (Moss & Ramji, 2016; Yu et al., 2014). An imbalance occurs between accumulation and clearance of cholesterol initiates atherosclerosis case in vivo (Rader, Alexander, Weibel, Billheimer, & Rothblat, 2009). Therefore, it is essential to maintain cholesterol homeostasis, which mainly related with de

Abbreviations: MTT, 3-(4, 5-dimethylthazal-2-yl)-2, 5diphenyltetrazoliumbromide; 22-NBD-cholesterol, 22-(N-(7-nitrobenz-2-oxa-1, 3-diazol-4-yl) amino)-23, 24-bisnr-5-cholen-3b-ol; ERK1/2, Extracelluar signal regulated kinases 1 and 2; PPAR, Peroxisome proliferator activated receptor; LXRa, Liver X receptor a; SREBP-2, sterols regulatory element-binding protein 2; ABCA1, ATP-binding cassete transporter 1; LCAT, lecithin-cholesterol acyltransferase; CYP7A1, cholesterol-a-hydroxylase; NPC1L1, Niemann-Pick C1-Like 1. ⇑ Corresponding author at: College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, China. E-mail address: [email protected] (C. Li). http://dx.doi.org/10.1016/j.jff.2017.09.023 1756-4646/Ó 2017 Published by Elsevier Ltd.

novo synthesis, intestinal cholesterol absorption, and biliary and faecal secretion (van der Wulp, Verkade, & Groen, 2013). Polyphenols, which are important nutraceuticals, represent a promising dietary consumption strategy for the prevention or treatment of atherosclerosis. It was demonstrated that polyphenols have the potential for anti-atherosclerosis therapies by regulating cholesterol metabolisms (Jiao, Zhang, Yu, Huang, & Chen, 2010; Moss & Ramji, 2016). For example, grape seed proanthocyanidins exhibited hypocholesterolaemic activity in Golden Syrian hamsters by promotion of bile acid secretion and up-regulation of choles terol-7a-hydroxylase (CYP7A1) (Jiao et al., 2010). Olive oil polyphenols promoted HDL-mediated cholesterol efflux and facilitated reverse cholesterol transport (RCT) via enhancing cholesterol efflux related genes in vitro or in vivo (Farras et al., 2013; Helal, Berrougui, Loued, & Khalil, 2013). RCT is a sequential key process of cholesterol metabolisms, which starts with excess cholesterol secretion from peripheral cells to HDL particles and transported to liver, followed by biliary excretion into intestine and finally to faeces (Lee-Rueckert, Blanco-Vaca, Kovanen, & Escola-Gil, 2013). Persimmon tannin (proanthocyanidins) is extracted from persimmon fruits (Diospyros kaki L.) and characterized with a high prodelphinidin contents (58–65%) and unique A-type interflavan linkages (Li et al., 2010). Hypocholesterolemic effect of persimmon

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

fruits has been previously reported in animal models (Gorinstein et al., 1998; Gorinstein et al., 2000; Gorinstein et al., 2011; Matsumoto, Watanabe, Ohya, & Yokoyama, 2006; Matsumoto, Yokoyama, & Gato, 2010). In addition, high molecular weight persimmon tannin was proved to be the main contributor of the cholesterol-lowering activity of persimmon fruits by Matsumoto and Yokoyama (2012) and Zou et al. (2012). Gato, Kadowaki, Hashimoto, Yokoyama, and Matsunnoto (2013) found the hypocholesterolemic effect of persimmon in human, which mechanism of action depended on bile acid-binding activity of persimmon tannin. In our previous study, we found that persimmon tannin contributed to the hypocholesterolaemic effect through enhancing serum lecithin cholesterol acyltransferase (LCAT) activity and faecal bile acids excretion in high-cholesterol diet fed rats (Zou et al., 2012) and it could also inhibit lipids and bile acid absorption by activation of AMPK and regulation its downstream targets (Zou et al., 2014). Moreover, persimmon tannin could inhibit adipocyte differentiation through regulation of PPARc, C/EBPa and miR-27 in early stage of adipogenesis (Zou et al., 2015). Currently, the mechanism of hypercholesterolemic and anti-atherosclerosis action of persimmon tannin was mainly focused on lipid or energy metabolisms. Few systematic works have been done to illustrate the underlying molecular mechanisms of persimmon tannin on the aspect of cholesterol homeostasis. Recently, we illustrated that persimmon tannin could affect cholesterol absorption and efflux in HepG2 and Caco-2 cells via regulating genes closely related with RCT, but in a LXRa independent pathway (Ge, Zhu, Peng, Deng, & Li, 2016). However, it is not clear whether persimmon tannin could facilitate RCT in vivo. It is known that extracelluar signal regulated kinases 1 and 2 (ERK1/2), which belong to a highly conserved family of proteinserine/threonine kinases, are related with a large variety of cellular activities including cell differentiation, cell migration, proliferation, immune response and cholesterol trafficking (Roskoski, 2012; Zhang et al., 2016; Zhou, Yin, Guo, Hajjar, & Han, 2010). On the base of the important role of ERK1/2 in cell physiology, we hypothesized that persimmon tannin may modulate cholesterol homeostasis by regulating the phosphorylation of ERK1/2 and its downstream targets in vitro and in vivo. Considering that macrophage cholesterol efflux is the first step in RCT, and this process is critical in maintaining a balanced cholesterol homeostasis (Nishimoto et al., 2009; Phillips, 2014), we used J774A.1 macrophage cells to illustrate whether persimmon tannin could promote cholesterol efflux through regulating ERK1/2 and its downstream genes in vitro. Furthermore, we intraperitoneally injected fluorescent 22-NBD-cholesterol-labeled J774A.1 macrophage cells into C57BL/6J mice for tracing the cholesterol distribution and evaluating the effects of persimmon tannin on macrophage RCT in C57BL/6J mice. We believed that our results will extend the current mechanisms of hypercholesterolemic and anti-atherosclerosis effects of persimmon tannin.

2. Materials and methods 2.1. Materials RPMI-1640. medium and fetal bovine serum (FBS) were obtained from Gibco (Grand Island, NY, USA). 25 cm2 culture flasks and 12-wells plates were purchased from Corning Inc. (NY, USA). 22-(N-(7-nitrobenz-2-oxa-1, 3-diazol-4-yl) amino)-23, 24-bisnr5-cholen-3b-ol (22-NBD-cholesterol) was obtained from Invitrogen Life Technologies (Carlsbad, CA, USA). Rabbit polyclonal antibodies PPARc, ERK1/2, p-ERK1/2 were obtained from Cell Signaling Technology Inc. (Beverly, MA, USA). Anti-b-actin antibody was purchased from Boster Biological Technology co.ltd

339

(Wuhan, China). Other chemicals were purchased from Thermo Fisher Scientific (Waltham, MA, USA). 2.2. Preparation of persimmon tannin The mature astringent persimmon (Diospyros kaki Gongcheng Yueshi) were used to extract persimmon tannin. As we previously reported (Zou et al., 2012), the yield of persimmon tannin was extracted with methanol containing 1% (v/v) hydrochloric acid at 80 °C for 40 min, subsequently the concentrated extract solution was separated and purified with AB-8 macroporous resin (Nankai Chemical Plant, Tianjin, China). Distilled water and 10% (v/v) ethanol/water were used to remove sugar and low molecular weight phenolic compounds, respectively. Then absolute alcohol was used to elute the target persimmon tannin at a flow rate at 2 mL/min. The eluent was collected and concentrated though a rotary evaporator under vacuum at 35 °C, and finally the residue was lyophilized (Zou et al., 2012). Persimmon tannin was characterized by MALDI-TOF, thiolysis-HPLC-ESI-MS and NMR. The extender units were epicatechin, epigallocatechin, (epi) gallocatechin-3-Ogallate, and (epi) catechin-3-O-gallate with the relative moles of 2.78, 3.95, 11.0 and 7.58, respectively, and the terminal units were catechin, (epi) gallocatechin-3-O-gallate, and myricetin with the relative moles of 0.29, 0.26, and 0.45 (Zou et al., 2014). Thiolysis suggested that persimmon tannin was composed of polymers ranging from 7 to 20 kDa (DP 19–47) (Xu, Zou, Yang, Yao, & Li, 2012). The proposed structure was elucidated in our previous study (Fig. S1) (Zou et al., 2012). 2.3. Cell culture Murine macrophage-like cell J774A.1 was purchased from China Center for Type Culture Collection (Wuhan, China). The cells were maintained in RPMI-1640 medium containing 10% FBS and 100 U/mL of penicillin and 100 lg/mL streptomycin and incubated at 37 °C in a humidified atmosphere with 5% CO2 and the medium was changed every two days until the cells were
90% confluent. Persimmon tannin was dissolved in DMSO and diluted with cell culture medium for 1000 folds. In controls, the final concentration of DMSO was 0.1%. The cytotoxicity of persimmon tannin on J774A.1 cells was determined by MTT methods according to previous study (Ge et al., 2016) and supplemented in Fig. S2. In cellular cholesterol loading assay, cells were incubated in RPMI 1640 with 1% BSA, 25 lg/mL of acetylate low-density lipoprotein (Ac-LDL) supplementing 20 lg/mL cholesterol or 4 lM 22-NBD-cholesterol for 24 h to induce macrophage foam cells according to the method of Nishimoto et al. (2009) with some modification. 22-NBD-cholesterol as a fluoresterol has been used to mimic the distribution, uptake, transport and metabolism of cholesterol either in vitro or in vivo studies (Ramirez, Ogilvie, & Johnston, 2010; Song et al., 2015; Sparrow et al., 1999). After removing the medium, cells were washed with phosphate buffer saline (PBS) for three times, then incubated with persimmon tannin or U0126 (ERK1/2 inhibitor) for 24 h. Subsequently, these cells were fixed with 4% formaldehyde for 1 h. The fixed cells were washed with PBS again and stained with 3 mg/ml oil red O (isopropanol-water 3:2 (v/v)) at RT for 1 h. Finally, cells were washed with distilled water to remove excess stain. Images were observed under microscope (Nikon, Tokyo, Japan). ImageJ was used to calculate the mean optical density (Integrated Density/Area) in oil red OAstaining images. Additionally, intracellular lipid was extracted by hexane-isopropanol 3:2 (v/v), and determined with commercial TG kits. The TG contents were normalized to cellular protein and expressed as the relative TG content compared to Ac-LDL-induced cells.

340

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

In cellular efflux assay, J774A.1 cells were incubated with phenol red-free culture medium containing 10 lg/mL ApoA1 in the presence of 0.1% (v/v) DMSO or persimmon tannin for 24 h after loading 22-NBD-cholesterol. After that, cells were washed with PBS for three times. The cellular 22-NBD-cholesterol was extracted by hexane-isopropanol 3:2 (v/v) in the dark condition. After removing cellular debris, the supernatant was evaporated under N2 flush, and resolubilized in 600 lL methanol for fluorescent intensity (FI) analysis. The 22-NBD-cholesterol concentration was detected by multiscan spectrum (Tecan, Swiss) at kEx = 469 nm, kEm = 538 nm. The efflux rates (%) were calculated by the following formula: contents of 22-NBD-cholesterol in medium/(contents of 22-NBD-cholesterol in medium + contents of 22-NBD-cholesterol extracted from cells)  100. 2.4. Animals and diets Fifty male C57BL/6J mice, weighing 20–24 g, were purchased from the Experimental Animal Center of Disease Prevention and Control of Hubei Province (Wuhan, China). All mice were given free access to diet and water. The room temperature was maintained at 24 ± 2 °C and humidity at 50 ± 10%. All procedures were performed in compliance with the Chinese legislation on the use and care of laboratory animals and were approved by the Huazhong Agricultural University of Science and Technology Committee on Animal Care and Use. After acclimatization for one week, the mice were randomly divided into 5 groups (n = 10) and were fed with different diets in the following 7 weeks: the basic diet group (normal control, NC); the high-cholesterol diet group (HC) (78.8% basic diet, 10% lard, 1% cholesterol, 0.2% sodium cholate, 5% full cream milk powder, 5% dried egg yolk); the high cholesterol diet plus 0.1% (wt/wt) of persimmon tannin group (HC/LPT); the high cholesterol diet plus 0.2% (wt/wt) of persimmon tannin group (HC/MPT); the high cholesterol diet plus 0.4% (wt/wt) of persimmon tannin group (HC/ HPT). The body weight and food consumption were recorded every 4 days. 2.5. In vivo RCT study To investigate the effect of persimmon tannin on macrophageto-faeces RCT, the mice were injected intraperitoneally with 22NBD-cholesterol loaded macrophages. At 24 h after injection, blood was taken by removing eyeballs. All animals were fasted for 12 h before taken blood and sacrificed. The liver, bile and jejunum were obtained, washed in saline and then stored at 20 °C until analysis. Faeces were collected at the final 24 h and lyophilized for analysis. The plasma, liver, bile and faeces samples from mice never given 22-NBD-cholesterol loaded macrophages were used as blanks. The fluorescent intensity of 22-NBD-cholesterol was detected as above. The contents of 22-NBD-cholesterol injected into mice were set as relative value of 100%.

Bioengineering Institute, Nanjing, China). In addition, TG kit included R1 (lipase and 4-aminophenazone) and R2, the interference of free glycerol could be eliminated after reacting with R2, and then R1 was added to determined TG contents. The protein content of liver was determined by BCA protein assay kit (Jiancheng, Nanjing, China). 2.7. Real-time RT-PCR analysis Total RNA was isolated from liver or jejunum using Trizol reagent (Aidlab; Beijing, China). Reverse transcription was performed with a first-strand cDNA synthesis kit (GeneCopoeia; MD, USA). The cDNA, each primer and SYBR Green qPCR Master Mix (2) were used for quantitative real-time PCR. The primer sequences were listed in Table 1. The initial denaturation was set at 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s and 60 °C for 30 s. After amplification, melting curves analyses were performed as follows: 95 °C for 15 s, 60 °C for 60 s, 95 °C for 15 s. Both amplification and melting curve were carried out in an ABI Prism 7900 sequence detection system (Applied Biosystems; Carlsbad, CA, USA). PCR reaction products were separated on 1.5% agarose gel to confirm the absence of nonspecific amplification. The results were normalized to bactin and the relative mRNA was counted according to the 2DDCT method. 2.8. Western-blot analysis Liver or jejunum (100 mg) was homogenized in 1 mL RIPA lysis buffer with 20 lL 50  cocktail, 10 lL 100 mM PMSF and 10 lL 1 mM sodium orthovanadate to extract the total proteins. The total protein of J774A.1 cells was also extracted as above. The protein concentrations were determined by BCA protein assay kit. 40 lg of protein was resolved on SDS-PAGE and examined by western-bolt analysis. BandScan were applied to quantity the band intensity. The band intensities of p-ERK1/2 were normalized to total ERK1/2 protein and that of PPARc were normalized to b-actin. Table 1 Quantitative real-time PCR primers. Name

Primer

Sequence

Mus b-actin

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

50 -CACGATGGAGGGGCCGGACTCATC-30 50 -TAAAGACCTCTATGCCAACACAGT-3 50 -GTGCTCCACTTCTTACTGCG-3 50 -GAACACATGGTCTTCAGGCC-3 50 -GGCATTTGGACACAGAAGCA-3 50 -ATACATCCCTTCCGTGACCC-3 50 -TTCAGTCCCAGGCAGCGTAT-30 50 -TTGATCTTGGCGGGTGTT-3 50 -ACCCGCTGTATGGAAGGAAA-3 50 -TCTGAAGGATGTCTGCGGTT-3 50 -TCTGATCATGGGCCTCTTCC -3 50 -CTGAAGGGGAGGACGTGTAG-3 50 -TGCTCGTGTGGTTGGTGGTC-30 50 -CCGAGGATGGAGAAGGTGAA-3 50 -CATCTGCTATGCTCCCCTCA-3 50 -TTGTACGTGAGAGGGGCATT-3 50 -CTCCTCCTGTGGCTGGTAAA-3 50 -AGCTGCGAAATCACCTTTGG-3 50 -AGACAAAGAGGCAGAGGTCC-30 50 -CGATCAGCATCCCGTCTTTG-3 50 -AGGGCGATCTTGACAGGAAA-30 50 -CGAAACTGGCACCCTTGAAA-3 50 - AGGGATAGGGTTGGAGTCAGC -3 50 -CGTTGTAATGGAAGCCAGAGG-3 50 -CTCCTGCTGAACACCACTT-3 50 -GCAGCCCACAGACCAAATA-3

Mus LCAT Mus CYP7A1 Mus LDLR Mus ABCA1 Mus ABCG5

2.6. Determination of cholesterol, apolipoprotein A1, apolipoprotein B, high-density lipoprotein cholesterol and low-density lipoprotein cholesterol levels in serum, liver and faeces The serum total cholesterol (TC), total triglyceride (TG), apolipoprotein A1 (ApoA1) apolipoprotein A1 (ApoA1), apolipoprotein B (ApoB), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) levels were determined with commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The TC, TG, HDL-C, LDL-C levels of liver and the TC, TG and total bile acid (TBA) of faeces were extracted as previous study (Zou et al., 2014) and analyzed with commercial kits according to the manufacturer’s instruction (Nanjing Jiancheng

Mus ABCG8 Mus NPC1L1 Mus SREBP-2 Mus PPARa Mus PPARc Mus LXRa Mus ERK1/2

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

2.9. Statistical analysis All data were presented as means ± standard deviation (means ± SD). Statistical analysis was carried out using one-way ANOVA of SPSS 19.0 followed by Tukey’s multiple-range test. 3. Results and discussion 3.1. Persimmon tannin decreased the formation of lipid droplets and promoted cholesterol efflux in J774A.1 cells To investigate the effects of persimmon tannin on the formation of Ac-LDL-mediated foam cells, oil red O staining was used. The cells induced with Ac-LDL and cholesterol showed obvious cellular lipid droplets accumulation (Fig. 1). U0126, which is an inhibitor of ERK1/2, can increase free cholesterol efflux from macrophages (Zhou et al., 2010). Co-incubating cells with U0126 for 24 h decreased lipid droplets accumulation, suggesting that U0126 exerted inhibitory effects against intracellular cholesterol accumulation in Ac-LDL-induced J774A.1 cells (Fig. 1a). Persimmon tannin exhibited a significant inhibitory effect on the formation of lipid droplets as shown in Fig. 1a. In addition, U0126 (10 lM) markedly decreased 43.75% of TG contents compared with Ac-LDL-induced cells (P < 0.05). In comparison, persimmon tannin also significantly reduced the cellular TG levels up to 62%in a dose-dependent manner (P < 0.05). In order to verify whether the inhibitory effect of persimmon tannin on formation of lipid droplets was derived from its cholesterol efflux, we detected the effect of persimmon tannin on the 22-NBD-cholesterol efflux rate. Persimmon tannin markedly (P < 0.05) enhanced cellular 22-NBD-cholesterol efflux rate in a dose-dependent manner after cells were loaded with 22-NBDcholesterol (Fig. 2). Additionally, the cellular total cholesterol contents were also detected and high dosage of persimmon tannin noticeably (P < 0.05) inhibited cellular cholesterol accumulation (Fig. S3). Our results were consistent with that of Berrougui, Ikhlef, and Khalil (2015) who demonstrated that olive oil polyphenols could increase 3H-cholesterol efflux from J774 macrophage. 3.2. The promotion of persimmon tannin on cholesterol efflux in J774A.1 cells was via ERK1/2 – PPARc pathway Nuclear receptor peroxisome proliferator-activated receptor c (PPARc), highly expressed in macrophages, is a key transcriptional regulator of lipid metabolism and cell differentiation (Chawla et al., 2001). The activation of PPARc could result in transcriptional upregulation of ATP-binding cassete transporter 1 (ABCA1) and promote the removal of cholesterol from macrophages or L-02 cells (Chawla et al., 2001; Jiao et al., 2010). Previous studies stated that activation of PPARc could inhibit the formation of macrophage foam cells and accelerate the HDL-dependent cholesterol efflux (Li et al., 2004). Our present data illustrated that the PPARc protein levels were significantly inhibited after inducing macrophages with Ac-LDL and cholesterol (P < 0.05). However, persimmon tannin could noticeably promote the protein expression of PPARc dose-dependently (P < 0.05) (Fig. 3). ERK1/2, as protein-serine/threonine kinases, participate in cell migration, differentiation, metabolism, cell survival, and proliferation. It was reported that ERK1/2 also have a function in cholesterol trafficking and could regulate its downstream genes critical for RCT, including PPARc, PPARa, LXRa and ABCA1 (Chen et al., 2015; Xue et al., 2016; Zhou et al., 2010). To elucidate whether the effect of persimmon tannin on cholesterol efflux was related to ERK1/2 signaling, the total and phosphorylated ERK1/2 were detected by western-blot analysis. The results demonstrated that, similar as the positive agent U0126, persimmon tannin noticeably

341

reduced the phosphorylation rate of ERK1/2 up to 45.4% in Ac-LDLinduced macrophages (P < 0.05) (Fig. 4). It was reported that activation of ERK1/2 could inactivate PPARc (Wang, Dougherty, & Danner, 2016) and the blockage of ERK1/2 expression could facilitate cholesterol efflux (Zhou et al., 2010). The present study showed that persimmon tannin inhibited the phosphorylation of ERK1/2 and promoted the transcription of PPARc in J774A.1 cells, stimulating the cholesterol elimination from the cells. Therefore, these results confirmed our assumption that persimmon tannin, as a diet nutraceutical component, promoted macrophage cholesterol efflux by ERK1/2 - PPARc pathway. 3.3. Persimmon tannin facilitated macrophage RCT by enhancing the excretion of cholesterol from liver to faeces in C57BL/6J mice Data from J774A.1 cells strongly indicated that persimmon tannin could promote macrophage RCT in vitro. In order to verify whether persimmon tannin could facilitate RCT in vivo, we determined the effects of persimmon tannin on cholesterol homeostasis in C57BL/6J mice fed with different diets. As complemented in Fig. S4, food intake was significantly (P < 0.05) reduced in HC group compared with NC group. But no difference was observed among the four high-fat diet groups (HC, HC + PT) (Fig. S4). Nevertheless, there was no difference in energy intake among the four groups during the experiment. In addition, the lower food intake in HC, HC/LPT, HC/MPT, HC/HPT groups also resulted in lower body weights than NC group (Fig. S5). Table 2 showed the effects of persimmon tannin on serum, hepatic and faecal cholesterol levels in C57BL/6J mice. In comparison with NC group, the TC contents in serum and liver were significantly increased after feeding C57BL/6J mice with high-cholesterol diets for 7 weeks (P < 0.05). Additionally, high-cholesterol diets caused remarkable rises in serum LDL-C, ApoB and FC levels, accompanying by a significant decrease in serum ApoA1 level in contrast with NC group (P < 0.05). Persimmon tannin (0.4%) supplementation significantly (P < 0.05) reduced serum and hepatic TC levels in highcholesterol diets mice by 25.8% and 26.4%, separately. In addition, persimmon tannin remarkably decreased the serum LDL-C and ApoB concentrations (P < 0.05). Intervention with high-dosage of persimmon tannin significantly simulated the faecal secretion of TG, TC and TBA contents (P < 0.05). These results were concordant with our previous in vitro studies (Ge et al., 2016) and provided further evidence on cholesterol-lowering activity of persimmon tannin. The effects of persimmon tannin on 22-NBD-cholesterol redistribution were also detected after mice injection with 22-NBDcholesterol-labeled macrophage for 24 h (Table 3). Highcholesterol diets notably promoted 3.77 ± 1.03% of 22-NBDcholesterol accumulation in the liver, which was 1.57-fold of that of NC group (P < 0.05). Meanwhile, high-cholesterol diets reduced the excretion of faecal fluorescent labeled cholesterol by 18.33% compared with NC group. Supplement of 0.4% persimmon tannin to high-cholesterol diets markedly (P < 0.05) decreased the fluoresterol levels both in serum and liver. The secretion fluctuations of faecal fluoresterol were increased by persimmon tannin dosedependently. No significant difference in the fluoreseterol contents of bile was observed (P > 0.05). Taken together, persimmon tannin inhibited cholesterol accumulation in plasma and liver and stimulated faecal cholesterol secretion, thereby promoting macrophage RCT in C57BL/6J mice. 3.4. Persimmon tannin affected the expression of macrophage RCTrelated genes and proteins in C57BL/6J mice To further explore the underling molecular mechanism of persimmon tannin on macrophage RCT in vivo, we detected the genes

342

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

a

b

Fig. 1. U0126 and persimmon tannin markedly reduced lipid droplets accumulation in J774A.1 cells. (a) Oil red O staining. (b) Relative cellular TG contents. Cells were treated with 1% BSA, 25 lg/mL of Ac-LDL and 20 lg/mL cholesterol for 24 h and then intervened with U0126 or persimmon tannin for another 24 h, finally stained with oil red O or extracted for determining cellular TG concentrations. The red droplets in the cells indicated the stained lipids. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

and proteins levels related with cholesterol hepato-biliary pathway. Macrophage cholesterol efflux is the first step of RCT process and it has been demonstrated to play a vital role in maintaining cellular cholesterol homeostasis. ABCA1 is an important basolateral transporter due to its responsibility for cholesterol efflux (Van Eck, 2014; Wang & Smith, 2014). It has been reported that up-regulation of ABCA1 expression could promote RCT in vitro and in vivo studies (Lv, Wang, Li, Ma, & Zhao, 2016; Terra et al., 2009; Wu et al., 2014; Zhao, Haller, & Ritsch, 2015). Therapeutic induction of ABCA1, as a promising strategy for treating atherosclerosis, could facilitate the efflux of cholesterol and phospholipids to lipid-poor ApoA1 and reduce the cholesterol accumulation in macrophages (Van Eck, 2014). Additionally, ABCA1 and lecithincholesterol acyltransferase (LCAT) are both responsible for HDL metabolism. ABCA1 could promote efflux of unesterified cholesterol and phospholipids from cells to pre-b-HDL and formation of nascent HDL (Cuchel & Rader, 2006). LCAT mediates the conversion of nascent HDL to mature HDL particles and esterifies free cholesterol to cholesterol ester (Wang & Smith, 2014; Zhang et al., 2004). As indicated in Fig. 5, compared to NC group, high cholesterol diets induced a significant inhibitory effect on the expression of ABCA1 and LCAT in mice (P < 0.05). Meanwhile, CYP7A1 and ATP-binding cassette transporters G5 and G8 (ABCG5/G8) are related with cholesterol efflux from liver.

γ

Fig. 2. The efflux rate of 22-NBD-cholesterol after incubated with persimmon tannin for 24 h. The cells were incubated in RPMI 1640 with 1% BSA, 25 lg/mL of Ac-LDL and 4 lM 22-NBD-cholesterol for 24 h to induce macrophage foam cells. After the medium was removed, cells were washed with PBS for three times and then incubated with phenol red free-culture medium containing 10 lg/mL ApoA1 with or without persimmon tannin for another 24 h. Results were expressed as means ± SD of three independent experiments. Different letters among groups indicated significant difference (P < 0.05) by Tukey’s test.

343

Fig. 3. Persimmon tannin reversed the inhibition on the protein level of PPARc. Cells were treated with 1% BSA, 25 lg/mL of Ac-LDL and 20 lg/mL cholesterol for 24 h and then intervened with persimmon tannin for another 24 h. NC, normal control group; HC, cells were induced to macrophage foam cells; PT, persimmon tannin. Results were expressed as means ± SD of three independent experiments. A representative blot from three independent experiments was shown. Different letters among groups indicated significant difference (P < 0.05) by Tukey’s test.

344

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

Fig. 4. The effects of U0126 or persimmon tannin on the phosphorylation of ERK1/2. Cells were treated with 1% BSA, 25 lg/mL of Ac-LDL and 20 lg/mL cholesterol for 24 h and then intervened with U0126 or persimmon tannin for another 24 h. Results were expressed as means±SD of three independent experiments. A representative blot from three independent experiments was shown. * P<0.05 versus NC group; # P<0.05 versus HC group.

CYP7A1 is a rate-limiting enzyme in bile acid synthesis, and ABCG5/G8 as cholesterol transporters could facilitate biliary excretion of cholesterol and phytosterols into bile or small intestine (Yu et al., 2014). In contrast with NC group, high cholesterol diets also markedly (P < 0.05) repressed the expression of CYP7A1 and

ABCG5/G8 in liver (Fig. 5). Besides, ABCG5/G8 could also inhibit the absorption of intestinal cholesterol (Yu et al., 2014). Conversely, Niemann-Pick C1-Like 1 (NPC1L1) is also a cholesterol transporter and mainly facilitates the absorption of intestinal cholesterol or the re-absorption of hepatobiliary cholesterol (Jia,

345

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348 Table 2 The cholesterol contents in serum, liver and faeces of C57BL/6J mice fed with basic diet or high-cholesterol diet with or without persimmon tannin supplement. NC

HC

HC/LPT

HC/MPT

HC/HPT

Serum TG (mmol/L) TC (mmol/L) HDL-C (mmol/L) LDL-C (mmol/L) ApoAI (lg/mL) ApoB (lg/mL) FC (lmol/L)

0.94 ± 0.08a 3.11 ± 0.17d 1.43 ± 0.28bc 1.47 ± 0.06b 18.24 ± 1.02c 13.70 ± 0.23b 0.28 ± 0.02c

1.07 ± 0.12a 5.23 ± 0.19a 1.15 ± 0.34c 2.28 ± 0.32a 14.80 ± 1.71d 24.83 ± 2.60a 0.44 ± 0.43a

0.95 ± 0.03a 5.25 ± 0.49a 1.60 ± 0.12ab 1.70 ± 0.06b 24.21 ± 0.71a 13.91 ± 1.04b 0.37 ± 0.02b

0.73 ± 0.06 b 4.35 ± 0.22b 1.72 ± 0.18a 1.63 ± 0.08b 20.23 ± 1.20bc 13.12 ± 0.25b 0.32 ± 0.01c

0.60 ± 0.11 b 3.88 ± 0.31c 1.84 ± 0.02a 1.01 ± 0.04c 22.74 ± 2.61ab 13.60 ± 0.65b 0.32 ± 0.01c

Liver TG (lmol/g prot) TC (lmol/g prot) HDL-C (lmol/g prot) LDL-C (lmol/g prot) FC (nmol/g prot)

108.90 ± 13.30c 108.26 ± 12.16b 5.31 ± 0.47a 24.91 ± 1.97c 69.67 ± 13.72c

156.44 ± 5.28a 128.61 ± 4.66a 1.71 ± 0.72b 34.50 ± 4.24a 125.86 ± 30.70a

132.49 ± 5.27b 88.06 ± 8.66c 4.14 ± 0.47a 26.79 ± 3.31bc 102 ± 12.25ab

115.50 ± 8.52c 98.11 ± 8.59bc 5.52 ± 0.94a 30.03 ± 2.14b 121.40 ± 11.50ab

115.55 ± 6.80c 94.66 ± 11.51ac 8.21 ± 1.16c 28.81 ± 2.04bc 101.60 ± 9.03b

Faeces TG (lmol/day) TC (lmol/day) TBA (lmol/day)

4.29 ± 0.83d 2.52 ± 0.07a 0.47 ± 0.04c

10.02 ± 0.41b 3.79 ± 0.12b 1.19 ± 0.08b

13.28 ± 0.56b 4.35 ± 0.58c 1.15 ± 0.16b

12.31 ± 1.94bc 6.74 ± 0.52c 1.23 ± 0.16b

16.41 ± 2.09a 10.38 ± 0.74d 1.70 ± 0.09a

TG, triglyceride; TC, total cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; FC, free cholesterol; NC, normal control group; HC, high-cholesterol diet group; HC/LPT, high-cholesterol diet with 0.1% (wt/wt) persimmon tannin group; HC/MPT, high-cholesterol diet with 0.2% (wt/wt) persimmon tannin group; HC/HPT, high-cholesterol diet with 0.4% (wt/wt) persimmon tannin group. Results were expressed by means ± SD from ten mice per group. Different letters among groups indicated significant difference (P < 0.05) by Tukey’s test.

Table 3 Effects of persimmon tannin on 22-NBD-cholesterol distribution during macrophage RCT process.

NC HC HC/LPT HC/MPT HC/HPT

Liver (% of injection/total liver)

Bile (% of injection/mL bile)

Serum (% of injection/mL serum)

Faeces (% of injection/faeces)

2.40 ± 0.40bc 3.77 ± 1.03a 3.04 ± 0.46ab 3.15 ± 0.92ab 1.73 ± 0.84c

0.21 ± 0.06a 0.34 ± 0.12a 0.23 ± 0.20a 0.33 ± 0.05a 0.29 ± 0.08a

1.53 ± 0.11b 2.14 ± 0.33a 1.45 ± 0.07b 1.64 ± 0.07b 1.43 ± 0.17b

2.51 ± 0.16a 2.05 ± 0.01c 1.80 ± 0.01d 2.17 ± 0.04bc 2.24 ± 0.04b

NC, normal control group; HC, high-cholesterol diet group; HC/LPT, high-cholesterol diet with 0.1% (wt/wt) persimmon tannin group; HC/MPT, high-cholesterol diet with 0.2% (wt/wt) persimmon tannin group; HC/HPT, high-cholesterol diet with 0.4% (wt/wt) persimmon tannin group. Results were expressed by means ± SD from ten mice per group. Different letters among groups indicated significant difference (P < 0.05) by Tukey’s test.

Betters, & Yu, 2011). In present study, high cholesterol diet significantly (P < 0.05) reduced the expression of ABCG5/G8, but induced that of NPC1L1 in jejunum (Fig. 5). However, intervention with persimmon tannin, especially with high dosage persimmon tannin (0.4% persimmon tannin, HPT), notably induced the mRNA level of ABCA1 in both liver and jejunum (P < 0.05). Additionally, HPT notably elevated the expression of LCAT by 30.9% compared to HC group (P < 0.05). Hibiscus sabdariffa leaf polyphenolic extract reduced the foam cell formation and up-regulated ABCA1 expression, thus delaying atherosclerosis (Chen et al., 2013). It was reported that overexpression of LCAT could increase plasma HDL-C concentrations and facilitate biliary cholesterol secretion in hamsters (Zhang et al., 2004). Our data illustrated that persimmon tannin affected the metabolism of HDL by up-regulating ABCA1 and LCAT. Among the multiple RCT pathway, CYP7A1 and ABCG5/G8 contribute to biliary secretion, which plays a protective role against atherosclerosis. Persimmon tannin intervention significantly (P < 0.05) upregulated the expression of CYP7A1 and ABCG5/G8 in mice. It was documented that polyphenols could increase hepatic cholesterol efflux by upregulating CYP7A1 in vivo (Del Bas et al., 2005; Jiao et al., 2010). Our previous study also found that persimmon tannin could increase cholesterol efflux and decrease cholesterol accumulation by up-regulating the expression of CYP7A1 in HepG2 cells (Ge et al., 2016). Upregulation of ABCG5/G8 might be also an effective strategy to promote cholesterol efflux and treat atherosclerosis (Calpe-Berdiel et al., 2008). Additionally, administration with persimmon tannin reversed the increased mRNA level of NPC1L1 in

jejunum. Overall, persimmon tannin promoted the transportation of HDL particles to liver by upregulating the expression of ABCA1 and LCAT, and facilitated hepatic cholesterol efflux by enhancing CYP7A1 and ABCG5/G8 gene levels, subsequently inhibited reabsorption of hepatobiliary cholesterol by downregulating NPC1L1. Thus, the cholesterol concentration of serum and liver in persimmon tannin supplemented groups decreased. We further detected some nucleus receptors (PPARa, PPARc, LXRa) and sterols regulatory element-binding protein 2 (SREBP2). Both PPARa and PPARc are critical modulators of macrophage lipid metabolism, and may affect the development of atherosclerosis (Chinetti et al., 2001). Liver X receptor a (LXRa) governs the cellular cholesterol homeostasis. The activation of PPARa, PPARc and LXRa could directly regulate their downstream genes, including ABCA1, CYP7A1, ABCG5/G8 and NPC1L1 (Chawla et al., 2001; Chinetti et al., 2001; Rigamonti, Chinetti-Gbaguidi, & Staels, 2008; Zhao & Dahlman-Wright, 2010). In the present study, after mice were fed with HC diet, the gene expressions of PPARa, PPARc and LXRa markedly decreased (P < 0.05) (Fig. 5). However, Inoue et al. (2005) reported that the mRNA and protein expression of PPARc was induced by the high fat diet, which was contrary to our results. We speculated that the contradiction might be caused by the different diet. The fat content in the diet used by Inoue et al. (2005) was significantly high than that of our high cholesterol diet, offering more potential ligands (FFAs and their derivatives) for PPARc and resulting the increased PPARc. Furthermore, our results were consistent with the data from other high cholesterol/fat diet models or the steatosis hepatic cell model (He et al., 2016; Lv et al.,

346

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

Fig. 5. The effects of persimmon tannin on the expression of macrophage RCT-related genes in (a) liver or (b) jejunum. NC, normal control group; HC, high-cholesterol group; HC/LPT, high-cholesterol with 0.1% persimmon tannin group; HC/MPT, high-cholesterol with 0.2% persimmon tannin group; HC/HPT, high-cholesterol with 0.4% persimmon tannin group. Results are means ± SD from ten mice per group. Different letters among groups indicated significant difference (P < 0.05) by Tukey’s test.

2016; Sharma et al., 2017). The expression of SREBP-2, which is tightly involved in cholesterol synthesis, was significantly (P < 0.05) increased by 2.7-fold in liver with HC diet compared with NC group (Fig. 5). As illustrated in Fig. 5, supplementation with persimmon tannin significantly increased the mRNA levels of PPARa and PPARc but decreased the expression of SREBP-2 compared with HC group (P < 0.05). In addition, the expression of LXRa was notably upregulated in both liver and jejunum by HC/HPT diet (Fig. 5). It was reported that LXRa ligand could reverse atherosclerosis; conversely, induce hypertriglyceridemia (Chen et al., 2015). Whereas, our present data displayed that persimmon tannin induced the mRNA level of LXRa but significantly reduced the TG

contents in serum and liver (Table 2 and Fig. 5). Moreover, previous studies stated that PPAR agonists (Wang et al., 2016) or inhibition of SREBPs pathway (Xiao & Song, 2013) could be used to treat metabolic diseases including atherosclerosis and type 2 diabetes. Therefore, our data suggested that persimmon tannin may have the potential of anti-atherosclerosis. Although the ERK1/2 pathway was proved to be involved in the promotion of persimmon tannin on cholesterol efflux in J774A.1 macrophage cells, whether the effect of persimmon tannin on macrophage RCT in vivo is also mediated by regulation of ERK1/2 remains to be clarified. Both the transcriptional level and translational level of ERK1/2 in mice fed with different diets were

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

347

in vitro and enhance RCT in ApoE deficient (apoE/) mice (Zhang et al., 2016). Likewise, our present data revealed that blockage of persimmon tannin on the phosphorylation of ERK1/2 might control transcriptional regulation of PPARa/c and LXRa, further affect cholesterol transport related genes (e.g., ABCA1, CYP7A1, ABCG5/ G8 and NPC1L1), consequently facilitate RCT in C57BL/6J mice. In summary, our data demonstrated that persimmon tannin not only promoted cholesterol efflux from J774A.1 macrophage cells, but also enhanced hepato-biliary cholesterol efflux and faecal cholesterol excretion from C57BL/6J mice. The regulation of persimmon tannin on macrophage-RCT might be mainly mediated via ERK1/2-PPARc pathway in vitro and in vivo. Subsequently, persimmon tannin promoted cholesterol secretion by up-regualting the mRNA levels of ABCA1, ABCG5/G8 and CYP7A1, inhibited cholesterol absorption by down-regulating NPC1L1. These results suggested that persimmon tannin could contribute to promoting macrophage-RCT, which might relief the process of atherosclerosis. Combination with our previous study in HepG2 and Caco-2 cells (Ge et al., 2016), this study further provided a specific signaling regulatory pathway of persimmon tannin on RCT. Our results extend the current mechanisms of persimmon tannin on cholesterol homeostasis, and it also supplemented evidence on reducing the risk of health disorders via consumption of persimmon tannin. Acknowledgements This study was supported by the National Natural Science Foundation of China (No. 31571839). Conflict of interest The authors declare no conflict of interest. Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jff.2017.09.023. References

Fig. 6. The effects of persimmon tannin on the phosphorylation of ERK1/2 in (a) liver or (b) jejunum. NC, normal control group; HC, high-cholesterol diet group; HC/ LPT, high-cholesterol diet with 0.1% (wt/wt) persimmon tannin group; HC/MPT, high-cholesterol diet with 0.2% (wt/wt) persimmon tannin group; HC/HPT, highcholesterol diet with 0.4% (wt/wt) persimmon tannin group. Results were expressed as means ± SD. A representative blot from three independent experiments was shown. Different letters among groups indicated significant difference (P < 0.05) by Tukey’s test.

detected. Compared with NC group, ERK1/2 mRNA levels were markedly (P < 0.05) up-regulated by 1.91-fold in liver and 5.17fold in jejunum in HC group (Fig. 5). Persimmon tannin evidently inhibited the up-regulation of ERK1/2 gene by high-cholesterol diets (P < 0.05). We also found that HC diets activated ERK1/2 and elevated the phosphorylation of ERK1/2. Conversely, persimmon tannin reversed the activation on ERK1/2 and inhibited the phosphorylation of ERK1/2, consisting with the alternations of its mRNA levels (Figs. 5 and 6). Previous study has demonstrated that inhibition of ERK1/2 could activate macrophage cholesterol efflux

Berrougui, H., Ikhlef, S., & Khalil, A. (2015). Extra virgin olive oil polyphenols promote cholesterol efflux and improve HDL functionality. Evidence-Based Complementary and Alternative Medicine, 2015, 1–9. Calpe-Berdiel, L., Rotllan, N., Fievet, C., Roig, R., Blanco-Vaca, F., & Escola-Gil, J. C. (2008). Liver X receptor-mediated activation of reverse cholesterol transport from macrophages to feces in vivo requires ABCG5/G8. Journal of Lipid Research, 49, 1904–1911. Chawla, A., Boisvert, W. A., Lee, C. H., Laffitte, B. A., Barak, Y., Joseph, S. B., & Tontonoz, P. (2001). A PPARc-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Molecular Cell, 7(1), 161–171. Chen, Y., Duan, Y., Han, J., Xiang, R., Yang, X., Sun, L., & Hajjar, D. P. (2015). Inhibition of ERK1/2 and activation of LXR synergistically reduce atherosclerotic lesions in ApoE-deficient mice. Arteriosclerosis, Thrombosis, and Vascular Biology, 35(4), 948–959. Chen, J. H., Wang, C. J., Wang, C. P., Sheu, J.-Y., Lin, C. L., & Lin, H. H. (2013). Hibiscus sabdariffa leaf polyphenolic extract inhibits LDL oxidation and foam cell formation involving up-regulation of LXRa/ABCA1 pathway. Food Chemistry, 141(1), 397–406. Chinetti, G., Lestavel, S., Bocher, V., Remaley, A. T., Neve, B., Torra, I. P., & Staels, B. (2001). PPAR-alpha and PPAR-gamma activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway. Nature Medicine, 7, 53–58. Cuchel, M., & Rader, D. J. (2006). Macrophage reverse cholesterol transport – Key to the regression of atherosclerosis? Circulation, 113, 2548–2555. Del Bas, J. M., Fernandez-Larrea, J., Blay, M., Ardevol, A., Salvado, M. J., Arola, L., & Blade, C. (2005). Grape seed procyanidins improve atherosclerotic risk index and induce liver CYP7A1 and SHP expression in healthy rats. The FASEB Journal, 19, 479–481. Farras, M., Valls, R. M., Fernandez-Castillejo, S., Giralt, M., Sola, R., Subirana, I., & Fito, M. (2013). Olive oil polyphenols enhance the expression of cholesterol efflux related genes in vivo in humans. A randomized controlled trial. Journal of Nutritional Biochemistry, 24(7), 1334–1339.

348

Z. Ge et al. / Journal of Functional Foods 38 (2017) 338–348

Gato, N., Kadowaki, A., Hashimoto, N., Yokoyama, S., & Matsunnoto, K. (2013). Persimmon fruit tannin-rich fiber reduces cholesterol levels in humans. Annals of Nutrition and Metabolism: Karger, 62(1), 1–6. Ge, Z., Zhu, W., Peng, J., Deng, X., & Li, C. (2016). Persimmon tannin regulates the expression of genes critical for cholesterol absorption and cholesterol efflux by LXRa independent pathway. Journal of Functional Foods, 23, 283–293. Gorinstein, S., Kulasek, G. W., Bartnikowska, E., Leontowicz, M., Zemser, M., Morawiec, M., & Trakhtenberg, S. (1998). The influence of Persimmon peel and persimmon pulp on the lipid metabolism and antioxidant activity of rats fed cholesterol. The Journal of Nutritional Biochemistry, 9(4), 223–227. Gorinstein, S., Kulasek, G. W., Bartnikowska, E., Leontowicz, M., Zemser, M., Morawiec, M., & Trakhtenberg, S. (2000). The effects of diets, supplemented with either whole persimmon or phenol-free persimmon, on rats fed cholesterol. Food Chemistry, 70(3), 303–308. Gorinstein, S., Leontowicz, H., Leontowicz, M., Jesion, I., Namiesnik, J., Drzewiecki, J., & Trakhtenberg, S. (2011). Influence of two cultivars of persimmon on atherosclerosis indices in rats fed cholesterol-containing diets: Investigation in vitro and in vivo. Nutrition, 27(7–8), 838–846. He, X. W., Yu, D., Li, W. L., Zheng, Z., Lv, C. L., Li, C., & Jin, X. P. (2016). Original article: Anti-atherosclerotic potential of baicalin mediated by promoting cholesterol efflux from macrophages via the PPARc-LXRa-ABCA1/ABCG1 pathway. Biomedicine & Pharmacotherapy, 83, 257–264. Helal, O., Berrougui, H., Loued, S., & Khalil, A. (2013). Extra-virgin olive oil consumption improves the capacity of HDL to mediate cholesterol efflux and increases ABCA1 and ABCG1 expression in human macrophages. British Journal of Nutrition, 109(10), 1844–1855. Inoue, M., Ohtake, T., Motomura, W., Takahashi, N., Hosoki, Y., Miyoshi, S., & Okumura, T. (2005). Increased expression of PPARc in high fat diet-induced liver steatosis in mice. Biochemical and Biophysical Research Communications, 336, 215–222. Jia, L., Betters, J. L., & Yu, L. (2011). Niemann-Pick C1-Like 1 (NPC1L1) protein in intestinal and hepatic cholesterol transport. Annual Review of Physiology, 73, 239–259. Jiao, R., Zhang, Z., Yu, H., Huang, Y., & Chen, Z. Y. (2010). Hypocholesterolemic activity of grape seed proanthocyanidin is mediated by enhancement of bile acid excretion and up-regulation of CYP7A1. Journal of Nutritional Biochemistry, 21(11), 1134–1139. Lee-Rueckert, M., Blanco-Vaca, F., Kovanen, P. T., & Escola-Gil, J. C. (2013). The role of the gut in reverse cholesterol transport – Focus on the enterocyte. Progress in Lipid Research, 52(3), 317–328. Li, A. C., Binder, C. J., Gutierrez, A., Brown, K. K., Plotkin, C. R., Pattison, J. W., & Glass, C. K. (2004). Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARalpha, beta/delta, and gamma. The Journalof Clinical Investigation, 114(11), 1564–1576. Li, C., Xu, S., Yang, J., Tian, Y., Leverence, R., Reed, J. D., & Hagerman, A. E. (2010). High molecular weight persimmon (Diospyros kaki L.) proanthocyanidin: A highly galloylated, a-linked tannin with an unusual flavonol terminal unit, myricetin. Journal of Agricultural and Food Chemistry, 58(16), 9033–9042. Lv, O., Wang, L., Li, J., Ma, Q., & Zhao, W. (2016). Effects of pomegranate peel polyphenols on lipid accumulation and cholesterol metabolic transformation in L-02 human hepatic cells via the PPARc-ABCA1/CYP7A1 pathway. Food & Function, 7(12), 4976–4983. Matsumoto, K., Watanabe, Y., Ohya, M. A., & Yokoyama, S. I. (2006). Young persimmon fruits prevent the rise in plasma lipids in a diet-induced murine obesity model. Biological & Pharmaceutical Bulletin, 29(12), 2532–2535. Matsumoto, K., & Yokoyama, S.-I. (2012). Induction of uncoupling protein-1 and -3 in brown adipose tissue by kaki-tannin in type 2 diabetic NSY/Hos mice. Food and Chemical Toxicology, 50(2), 184–190. Matsumoto, K., Yokoyama, S., & Gato, N. (2010). Bile acid-binding activity of young persimmon (Diospyros kaki) fruit and its hypolipidemic effect in mice. Phytotherapy Research, 24(2), 205–210. Maxfield, F. R., & Tabas, I. (2005). Role of cholesterol and lipid organization in disease. Nature, 438, 612–621. Moss, J. W. E., & Ramji, D. P. (2016). Nutraceutical therapies for atherosclerosis. Nature Reviews Cardiology, 13(9), 513–532. Nishimoto, T., Pellizzon, M. A., Aihara, M., Stylianou, I. M., Billheimer, J. T., Rader, D. J., & Rothblat, G. (2009). Fish oil promotes macrophage reverse cholesterol transport in mice. Arteriosclerosis, Thrombosis, and Vascular Biology, 29(10), 1502–1508. Phillips, M. C. (2014). Molecular Mechanisms of Cellular Cholesterol Efflux. [Review]. Journal Of Biological Chemistry, 289, 24020–24029. Rader, D. J., Alexander, E. T., Weibel, G. L., Billheimer, J., & Rothblat, G. H. (2009). The role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis. Journal of Lipid Research, 50, S189–S194.

Ramirez, D. M. C., Ogilvie, W. W., & Johnston, L. J. (2010). NBD-cholesterol probes to track cholesterol distribution in model membranes. BBA – Biomembranes, 1798, 558–568. Rigamonti, E., Chinetti-Gbaguidi, G., & Staels, B. (2008). Regulation of macrophage functions by PPAR-a, PPAR-c, and LXRs in mice and men. Arteriosclerosis, Thrombosis, and Vascular Biology, 28(6), 1050–1059. Roskoski, R. Jr, (2012). ERK1/2 MAP kinases: Structure, function, and regulation. Pharmacological Research, 66(2), 105–143. Sharma, S., Sharma, S. K., Singh, L., Pathak, S., Sharma, R. K., Mishra, A., & Dua, K. (2017). Pharmacological evaluation of aqueous extract of syzigium cumini for its antihyperglycemic and antidyslipidemic properties in diabetic rats fed a high cholesterol diet—Role of PPARc and PPARa. Biomedicine and Pharmacotherapy, 89, 447–453. Song, W., Wang, W., Wang, Y., Dou, L., Chen, L., & Yan, X. (2015). Characterization of fluorescent NBD-cholesterol efflux in THP-1-derived macrophages. Molecular Medicine Reports, 12(4), 5989–5996. Sparrow, C. P., Patel, S., Baffic, J., Chao, Y. S., Hernandez, M., Lam, M. H., & Detmers, P. A. (1999). A fluorescent cholesterol analog traces cholesterol absorption in hamsters and is esterified in vivo and in vitro. Journal of Lipid Research, 40(10), 1747–1757. Terra, X., Fernández-Larrea, J., Pujadas, G., Ardèvol, A., Bladé, C., Salvadó, J., ... Blay, M. (2009). Inhibitory effects of grape seed procyanidins on foam cell formation in vitro. Journal of Agricultural and Food Chemistry, 57(6), 2588–2594. van der Wulp, M. Y. M., Verkade, H. J., & Groen, A. K. (2013). Regulation of cholesterol homeostasis. Molecular and Cellular Endocrinology, 368(1–2), 1–16. Van Eck, M. (2014). ATP-binding cassette transporter A1: Key player in cardiovascular and metabolic disease at local and systemic level. Current Opinion in Lipidology, 25(4), 297–303. Wang, S., Dougherty, E. J., & Danner, R. L. (2016). PPARc signaling and emerging opportunities for improved therapeutics. Pharmacological Research, 111, 76–85. Wang, S., & Smith, J. D. (2014). ABCA1 and nascent HDL biogenesis. BioFactors, 40(6), 547–554. Wu, C., Luan, H., Zhang, X., Wang, S., Zhang, X., Sun, X., & Guo, P. (2014). Chlorogenic acid protects against atherosclerosis in ApoE/ mice and promotes cholesterol efflux from RAW264.7 macrophages. PLoS ONE, 9(9), e95452. Xiao, X., & Song, B. L. (2013). SREBP: A novel therapeutic target. Acta Biochimica Et Biophysica Sinica, 45, 2–10. Xu, S., Zou, B., Yang, J., Yao, P., & Li, C. (2012). Characterization of a highly polymeric proanthocyanidin fraction from persimmon pulp with strong Chinese cobra PLA2 inhibition effects. Fitoterapia, 83(1), 153–160. Xue, X. H., Wei, W., Shi, F. F., Chen, T., Zhou, X. M., & Chen, L. D. (2016). Inhibition of ERK1/2 improves lipid balance in rat macrophages via ABCA1/G1 and CD36. Molecular Medicine Reports, 13(2), 1533–1540. Yu, X. H., Qian, K., Jiang, N., Zheng, X. L., Cayabyab, F. S., & Tang, C. K. (2014). ABCG5/ ABCG8 in cholesterol excretion and atherosclerosis. Clinica Chimica Acta, 428, 82–88. Zhang, L., Chen, Y., Duan, Y., Han, J., Yang, X., Yang, J., & Hajjar, D. P. (2016). MEK1/2 inhibitors activate macrophage ABCG1 expression and reverse cholesterol transport—An anti-atherogenic function of ERK1/2 inhibition. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids, 1861(9), 1180–1191. Zhang, A. H., Gao, S., Huang, W., Zhao, T. Q., Liu, G., & Fan, J. L. (2004). Increased plasma HDL cholesterol levels and biliary cholesterol excretion in hamster by LCAT overexpression. FEBS Letters, 570(1–3), 25–29. Zhao, C., & Dahlman-Wright, K. (2010). Liver X receptor in cholesterol metabolism. Journal of Endocrinology, 204(3), 233–240. Zhao, W., Haller, V., & Ritsch, A. (2015). The polyphenol PGG enhances expression of SR-BI and ABCA1 in J774 and THP-1 macrophages. Atherosclerosis, 242, 611–617. Zhou, X. Y., Yin, Z. A., Guo, X. Z., Hajjar, D. P., & Han, J. H. (2010). Inhibition of ERK1/2 and activation of liver x receptor synergistically induce macrophage ABCA1 expression and cholesterol efflux. The Journal of Biological Chemistry, 285(9), 6316–6326. Zou, B., Ge, Z. Z., Zhang, Y., Du, J., Xu, Z., & Li, C. M. (2014). Persimmon Tannin accounts for hypolipidemic effects of persimmon through activating of AMPK and suppressing NF-kappa B activation and inflammatory responses in High-Fat Diet Rats. Food & Function, 5(7), 1536–1546. Zou, B., Ge, Z., Zhu, W., Xu, Z., & Li, C. (2015). Persimmon tannin represses 3T3-L1 preadipocyte differentiation via up-regulating expression of miR-27 and downregulating expression of peroxisome proliferator-activated receptor-gamma in the early phase of adipogenesis. European Journal of Nutrition, 54(8), 1333–1343. Zou, B., Li, C. M., Chen, J. Y., Dong, X. Q., Zhang, Y., & Du, J. (2012). High molecular weight persimmon tannin is a potent hypolipidemic in high-cholesterol diet fed rats. Food Research International, 48(2), 970–977.