[32] Activation of iron regulatory protein-1 by oxidative stress

324

PROTEIN SENSORS AND REACTIVE OXYGEN SPECIES

[32]

acids by the techniques of molecular biologyJ 5 The finding that the conserved carboxyl-terminal domain of human Alrp can functionally replace the yeast domain in vivo 17 extends the molecular studies to the homologous genes of higher eukaryotes. Currently, detailed site-directed mutagenesis experiments are on the way 18 to determine the functional involvement of the different cysteine residues of the protein in the catalytic reaction, in FAD binding, or in the process of dimer formation. Figure 7 summarizes the experimental approaches for molecular biology techniques that are possible with the yeast genetic system. 19 The value of our genetic approach is proven by the recent identification of the first target molecules for sulfhydryl oxidase functions in yeast mitochondria.2° A conditional mutant for ERV112 identified the yeast Ervlp sulfhydryl oxidase as an essential constituent of the mitochondrial export machinery for iron/sulfur cluster. 15 C. Guthrie and G. R. Fink, Methods Enzymol. 194, (1991). 16 j. Sambrook, E. E Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). 17 T. Lisowsky, D. L. Weinstat Saslow, N. Barton, T. S. Reeders, and M. C. Schneider, Genomics 29, 690 (1995). 18 J.-E. Lee, G. Hofhaus, and T. Lisowsky, unpublished results, 2001. 19 T. Lisowsky, Recent Res. Dev. Curr. Genet. 1, 1 (2001). 20 H. Lange, T. Lisowsky, J. Gerber, U. M~ihlenhoff, G. Kispal, and R. Lill, EMBO Reports 2, 715 (2001).

[32] Activation of Iron Regulatory Protein- I by Oxidative Stress B y SEBASTIAN M U E L L E R a n d KOSTAS PANTOPOULOS

Introduction Iron regulatory protein 1 (IRP1) posttranscriptionally controls the expression of proteins implicated in iron and energy metabolism, such as the transferrin receptor (iron uptake), ferritin (iron storage), ALAS2 (erythroid heme synthesis), mitochondrial aconitase (citric acid cycle), and possibly DMT1/Nramp2 and ferroportin/IREG1 (iron transport). The mechanism involves high-affinity binding of IRP1 to "iron-responsive elements" (IREs), phylogenetically conserved hairpin structures in mRNA-untranslated regions (UTRs). IRE/IRP1 interactions modulate mRNA translation or stability and result in homeostatic adaptations to changes in iron availabilityJ ,2 IRP1 belongs to the family of iron-sulfur isomerases, which I K. Pantopoulos and M. W. Hentze, "Nitric Oxide" (L. Ignarro, ed.), p. 293. Academic Press, San Diego, 2000. 2 R. S. Eisenstein, Annu. Rev. Nutr. 20~ 627 (2000).

METHODSIN ENZYMOLOGY,VOL.348

Copyright© 2002by AcademicPress. All rightsof reproductionin any formreserved. 0076-6879/02$35.00

[32]

IRP1 AND OXIDATIVESTRESS

325

also includes mitochondrial aconitase. Its genetic activity is regulated by the irondependent assembly--disassembly of a cubane, aconitase-type [4Fe-4S] cluster. In iron-loaded cells, assembly of the cluster converts IRP1 to a cytosolic aconitase and precludes IRE binding. Iron starvation and nitric oxide trigger dissociation of the cluster, yielding apo-IRPl that is competent for high-affinity IRE binding. A second iron regulatory protein, IRP2, is expressed at lower levels in most tissues and displays homology to IRP1, but its IRE-binding activity is regulated at the level of protein stability. A c t i v a t i o n of IRPI b y Oxidative S t r e s s Direct administration of H202 to cells leads to a rapid activation of IRP1 to its IRE-binding form (hereafter referred to as "IRPI activation"), whereas IRP2 activity remains unaltered. Early experiments employing murine B6 and Ltkfibroblasts3'4 or Chinese hamster V79 ovary fibroblasts5 showed that a single bolus of H202 (in micromolar concentrations) was sufficient to elicit activation of IRP1 within 30-60 min. However, treatment of cell extracts3,5 or iron-loaded recombinant IRPI 6 with H 2 0 2 failed to activate IRPI. These results have raised obvious mechanistic and physiological questions. This article describes the basic methods that have been developed and applied to study the activation of IRPI by H202. These include the electrophoretic mobility shift assay to detect IRE-binding activity, the chemiluminescence luminol/hypochlorite assay to detect extracellular H202, the method for enzymatic generation of H202 at steady-state levels, and the fluorometric assay to monitor relative intracellular H202 levels. In addition, we describe key experiments that have provided insights regarding the mechanism and the physiological implications of IRP1 activation by H202 in cultured B6 fibroblasts, in permeabilized B6 fibroblasts, and in the intact rat liver. E l e c t r o p h o r e t i c Mobility Shift A s s a y (EMSA) for D e t e c t i o n of I R E - B i n d i n g Activity Preparation of Radiolabeled IRE Probe We generate 32p-labeled IRE probes by in vitro transcription reactions from the plasmid I-12.CAT. 7 Standard reactions contain 6 tzg template (linearized with 3 K. Pantopoulos and M. W. Hentze, E M B O Z 14, 2917 (1995). 4 K. Pantopoulos, G. Weiss, and M. W. Hentze, MoL Cell Biol. 16, 3781 (1996). 5 E. A. L. Martins, R. L. Robalinho, and R. Meneghini, Arch. Biochem. Biophys. 316, 128 (1995). 6 X. Brazzolotto, J. Gaillard, K. Pantopoulos, M. W. Hentze, and J. M. Moulis, J. Biol. Chem. 274, 21625 (1999). 7 N. K. Gray, S. Quick, B. Goossen, A. Constable, H. Hiding, L. C. Ktihn, and M. W. Hentze, Eur. J. Biochem. 218, 657 (1993).

326

PROTEINSENSORSAND REACTIVEOXYGENSPECIES

[32]

XbaI), 1 mM ATE CTP, GTP, 0.1 mM UTP, 30/zCi [ot-32p]UTP (3000 Ci/rnmol), 30 mM 1,4-dithiothreitol II (DTT), 1.5 U RNase inhibitor, 1 x transcription buffer (Stratagene, La Jolla, CA), and 50 U T7 RNA polymerase (Stratagene). Following incubation at 37 ° for 1 hr and addition of an equal volume of RNA-loading buffer (100% formamide + bromphenol blue), the transcription reaction is heat denatured at 95 ° for 1 min and loaded on a polyacrylamide/urea gel [15% polyacrylamide : bisacrylamide (20 : 1), 8 M urea, 1 x TBE]. Electropboresis is performed at 30 W for 30-60 rain. The labeled probe is visualized by autoradiography, cut out with a scalpel, and eluted from the gel by ovemight agitation in elution buffer [0.1% sodium dodecyl sulfate (SDS), 0.5 M ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA]. The probe is then extracted with phenol/chloroform, precipitated with ethanol, washed with 70% (v/v) ethanol, and dissolved in water. After counting radioactivity, the probe is aliquoted and stored at - 8 0 °. The resulting transcript has the sequence (5~-GGGCGAAUUC GAGCUCGGUA CCCGGGGAUC CUGCUUCAACAGUGCUUGGA CGGAUCCU-3'), in which the underlined nucleotides represent critical functional elements of the IRE (an unpaired C residue and the loop). Under these conditions, the specific radioactivity of the probe is "~3 x 10 7 cpm//~g.

Preparation of Cytoplasmic Extracts of Cultured Cells Cells are harvested and lysed in ice-cold "cytoplasmic lysis buffer" (1% Triton X-100, 40 mM KC1, 25 mM Tris-C1, pH 7.4). We routinely use 100/zl lysis buffer/107 cells, incubate the lysate on ice for 20 min, and centrifuge it for 10 min in an Eppendorf microfuge (full speed at 4°). The pellet is discarded, and the supernatant is transferred into a new tube and kept on ice. Protein concentration is determined by the Bradford assay 8 and usually ranges between 1 and 10/zg/#l. At this stage, the cytoplasmic lysates can be aliquoted and stored at - 8 0 °.

Electrophoretic Mobility Shift Assay Aliquots of cell extracts containing 10-25/zg protein (in 10/zl) are incubated for 20 min at room temperature with a 25,000 cpm IRE probe (in 1 #1). Subsequently, 1 #1 heparin (50 mg/ml) is added to the reaction (to inhibit nonspecific protein interactions with the probe), and the incubation is continued for another 10 min. After the addition of 3/zl loading buffer (80% glycerol + bromphenol blue), samples are loaded on a nondenaturing acrylamide gel [4-6% polyacrylamide:bisacrylamide (60: 1), 0.5× TBE]. Electrophoresis is performed for 60-90 min at 5V/cm, and the gel is directly transferred onto a Whatman (Clifton, NJ) paper and dried. RNA/protein complexes are visualized by autoradiography. 8M. M. Bradford,Anal.Biochem.72, 248 (1976).

[32]

IRP1 AND OXIDATIVESTRESS

327

IRP1 can be activated in vitro by 2-mercaptoethanol. 9 This property is often utilized as a control for equal loading in EMSA (see also Figs. 3A, 4B, and 4C~. In this case, cell extracts are treated with 2% 2-mercaptoethanol prior to addition of the probe. H202 Assays Chemiluminescence Assay for Determination of Extracellular H202 We have employed a highly sensitive nonenzymatic assay to accurately measure H202 concentrations in the low micromolar range. The method is based on the two-electron oxidation of luminol (5-amino-2,3-dihydro-1,4-phthalazinedione) by sodium hypochlorite to diazaquinone, which is further converted by H202 to an excited aminophthalate via an o~-hydroxy hydroperoxide. 1° The final product of the reaction emits a short (<2 sec) luminescence signal with a peak at 431 nm that linearly depends on [H202] (down to concentrations as low as 10 -9 M). When applied in a flow system (see later), the assay offers the advantage of studying the rapid kinetics of HEO2-generating or -removing enzymes (e.g., glucose oxidase or catalase) at physiologically low H202 concentrations. Due to the short time of measurement, the readout represents the actual H202 concentration (M) rather than the H202 generation rate (M per time). The substrate (e.g., culture medium) is mixed with luminol and sodium hypochlorite in a luminometer (AutoLumat LB 953, Berthold, Wildbad, Germany) by an injection device. The integral of the luminescence peak is determined over 2 sec, and the H202 concentration is calculated from a calibration curve. Further technical aspects of the assay are discussed in Mueller. 11 Method for Enzymatic Generation of Extracellular H202 at Steady-State Levels The enzymatic oxidation of glucose catalyzed by glucose oxidase yields H202. Under conditions of substrate saturation (both glucose and dioxygen), the rate of H202 generation is described by the equation: dH202/dt = kGo (kco: the rate constant of glucose oxidase). Addition of appropriate amounts of catalase can control H202 accumulation. Catalase is not saturated with substrate (up to molar H202 concentrations) and therefore determination of Km is not possible. Catalasemediated degradation of H202 linearly depends on the H202 concentration, following first-order kinetics. 12 The rate of H202 degradation is thus described by the equation: - d H 2 0 2 / d t = kcat[H202] (kcat: the rate constant of catalase). By adding catalase to a mixture of glucose and glucose oxidase, H202 generation 9 M. W. Hentze,T. A. Rouault, J. B. Harford,and R. D. Klausner,Science244, 357 (1989). 10S. Muellerand J. Arnhold, J. Biolumin. Chemilumin. 10, 229 (1995). 11S. Mueller, FreeRadic. Biol. Med. 29, 410 (2000). 12H. Aebi,Methods Enzymol. 105, 121 (1984).

328

PROTEIN SENSORS AND REACTIVE OXYGEN SPECIES

[32]

B 10-4.

+

ca4alase

2.5 ml

m',

glucose o~dase A

10"5

t"kl

o '1-

o "1- 10-6.

10 ~

560

10'00

time (rain)

15'00

0

25

50

7'5

time (min)

FIG. 1. (A) Generation of steady-state H202 in a calibrated mixture of catalase and glucose/glucose oxidase. Catalase is initially applied to degrade a bolus of 10 # M H202. Addition of the appropriate amount of glucose oxidase in the presence of glucose yields H202 at a steady-state concentration that depends on the kGo/kcat ratio. (B) Degradation of H202 by B6 fibroblasts. A bolus of 100/zM H202 was added to 107 B6 cells and incubated with 2.5, 5, or 10 ml of culture media. At the indicated time points, the concentration of H202 was monitored by the luminol/hypochlorite assay in 500/zl of culture supernatant. Reproduced, with permission, from S. Mueller, Free Radic. Biol. Med. 29, 410 (2000).

reaches steady-state levels when koo = kcat[n202] and kGo/kcat = [ H 2 0 2 ] . T h u s , the concentration of H202 is determined by the ratio k~o/kcat. Based on these considerations, the amount of glucose oxidase and catalase required to generate steady-state levels of H202 can be calculated, provided that k<;oand kca t a r e known. The rate constant of glucose oxidase (kGo = Vmax)is determined by fitting data to the Michaelis-Menten equation (or by generating Lineweaver-Burk plots). The rate constant of catalase (kcat) is determined from the H202 decay curve obtained at different enzyme dilutions by linear regression analysis of chemiluminescence data as described.13 In routine experiments, the appropriate amounts of the glucose oxidase and catalase are mixed with 5 mM glucose to yield H202 concentrations in the micromolar range. By varying the enzyme activities, the H202 concentration can be adjusted and maintained for hours. The actual H202 concentration at different time points can be monitored in real time by the luminol/hypochlorite assay (Fig. 1A). We have developed a flow technique for this procedure. The solution of glucose, glucose oxidase, and catalase aspirated by a peristaltic pump (4 ml/min) is mixed with luminol (10 -4 mol/liter) and sodium hypochlorite (10 - 4 mol/liter), which are added continuously by a perfusion pump (6 ml/min). H202 is quantified by the emitted chemiluminescence signal as described earlier.

13 S. Mueller, H. D. Riedel, and W. Stremmel, Anal. Biochem. 245, 55 (1997).

[32]

IRP1 AND OXIDATIVESTRESS

329

Fluorometric Assay to Monitor Relative lntracellular H202 Levels This method is based on the oxidation of 2',7'-dichlorodihydrofluorescein diacetate (H2DCF-DA) (Molecular Probes, Eugene, OR) and is widely used to assess oxidative stress in cells. 14Oxidation of intracellularly trapped H2DCF-DA requires removal of the diacetate group by esterases. Activated H2DCF is converted by H202 and peroxidases to the fluorescent derivative 2',7'-dichlorofluorescin (DCF), and fluorescent cells are analyzed by fluorescence-activated cell sorting (FACS). The intensity of DCF fluorescence serves as a measure for the intracellular H202 concentration. The ability of DCF to catalyze generation of reactive oxygen species has questioned the validity of this approach to accurately quantify intracellular H202J 5 However, when appropriate controls are designed, this method provides a useful tool to monitor relative changes in intracellular H202 levels. We have employed the DCF fluorometric assay for two types of experiments: (i) to detect intracellular oxidative stress in response to various pharmacological stimuli, such as antimycin A, menadione, or 3-amino-1,2,4-triazole 16'17 and (ii) for intracellular detection of H202 supplied extracellularly, either by direct treatment of cells with a bolus of H2Oe or by treatment with an H202-generating system. 16 Samples are prepared for FACS analysis as follows: Cells are washed twice with ice-cold phosphate-buffered saline (PBS), trypsinized (1 ml trypsin) for 2-3 min at 37 °, and finally suspended in 5 ml PBS. We have used a Facscan flow cytometer (Becton Dickinson, Franklin Lakes, NJ), supported by a Macintosh computer system and CellQuest (Becton Dickinson) software. This software offers acquisition and analysis tools for plotting, gating, statistical analysis, and reporting. It also allows instrument control. The Facscan is equipped with an air-cooled argon ion laser fixed at an excitation wavelength of 488 nm. The emitted fluorescence is collected at 530 nm using a narrow bandpass filter. Dead cells and debris are gated out on the forward and 90 ° scatter parameters. A c t i v a t i o n of I R P I b y E x t r a c e l l u l a r H 2 0 2 in B 6 F i b r o b l a s t s

Growth of B6 Cells and Conditions for H202 Treatment B6 cells are grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, 2 mM glutamine, 100 U/ml penicillin, and 0.1 ng/ml streptomycin. We routinely perform H202 treatments in iron- and

14M. Tsuchiya, M. Suematsu, and H. Suzuki, Methods Enzymol. 233, 128 (1994). 15 C. Rota, Y. C. Fann, and R. P. Mason, J. Biol. Chem. 274, 28161 (1999). 16 K. Pantopoulos, S. Mueller, A. Atzberger, W. Ansorge, W. Strernmel, and M. W. Hentze, J. Biol. Chem. 272, 9802 (1997). 17N. Gehring, M. W. Hentze, and K. Pantopoulos, J. BioL Chem. 274, 6219 (1999).

330

PROTEINSENSORSAND REACTIVEOXYGENSPECIES

[32]

serum-free minimal essential medium (MEM) to avoid possible interference of iron and serum-derived H202-degrading activities [MEM has no added iron, whereas DMEM contains 0.1 mg/liter Fe(NO3)3 • 9(H20)].

Degradation of H202 in Supernatant of Cell Culture The luminol/hypochlorite assay was employed to analyze the fate of H202 administered as a single bolus to B6 fihroblasts. H202 is stable in tissue culture medium but undergoes a rapid degradation in the culture supernatant, suggesting that B6 cells have the capacity to decompose extracellular H202 (Fig. 1B). The degradation kinetics are exponential, indicating the involvement of catalase, and depend on the absolute amount of H202 and the number of cells in the culture.11,18 This result is in agreement with earlier observations showing exponential decay of H202 in cultures of human IMR-90 fibroblasts.19

Kinetic Analysis of lRP1 Activation by H202 We have compared the kinetics of IRP1 activation in response to treatment of cells with 100 # M H202 administered either as a single bolus or generated enzymatically in the medium at steady-state levels by a titrated mixture of glucose, glucose oxidase, and catalase. 16At different time points the H202 concentration in the medium was monitored by the luminol/hypochlorite assay, and cytoplasmic cell extracts were prepared for analysis of IRE binding. As expected, the H202 bolus decays rapidly (Fig. 2A), whereas H202 generation and degradation in the titrated mixture of glucose, glucose oxidase, and catalase reach equilibrium, maintaining a steady-state H202 concentration of 100/zM (Fig. 2B). Despite these differences in the exposure of cells to H202, the pattern of IRP1 activation is similar. In both cases, a partial activation of IRP1 is observed after 15 min and complete induction within 30-60 min of H202 treatment (Figs. 2A and 2B). This result suggests that HzOz-mediated activation of IRPI is biphasic. The activation pathway is initiated in the early (0-15 min) phase and requires the presence of an H202 threshold to activate IRP1 partially. IRP1 activation is completed in the late (15-60 min) phase, essentially in the absence of H202.4

Determination of Threshold 14202 Concentration Required for IRP1 Activation The H202 decay curve shown in Fig. 2A shows that >10 /zM H202 is sustained in the early (0-15 min) phase of treatment. The exact H202 threshold required for IRP1 activation can be determined by assessing IRE-binding activity 18S. Mueller,K. Pantopoulos,M. W. Hentze,and W. Stremmel(Hastingset al., eds.), "Bioluminescenceand Chemiluminescence,"p. 338. Wiley,Chichester,Sussex, 1997. 19N. Makino,Y. Mochizuki,S. Bannai,and Y. Sugita,J. Biol. Chem.269, 1020(1994).

[32]

IRP1 AND OXIDATIVESTRESS

B

A

I

IRE/IRP-I-I~

O' S' 10' 15' 30' 60'

331

IRF./IRP-1"1~ O' S' 10' 15' 30' 60'

10 -2J

bolus

steady

state

10.3~ 1

10 .6 10 -7 0

10

. . . . . . . . . . . . 10

20

30

40

50

"~

10";'1

60

0

~lme (mln)

.

,

10

.

,

20

.

.

.

30 time

.

.

40

.

.

50

,

60

(min)

FIG.2. IRP1 activationby extracellularH202. B6 fibroblasts(107) were treated with (A) a bolus of 100/zM H202 or (B) a titratedmixtureof glucose, glucoseoxidase (kGo = 4.2 x 10-7 M - sec- J), and catalase (kcat = 4.2 x 10-3 sec-1), calculatedto yield 100/zMH202. H202 concentrationsin the culture media were monitoredwith the luminol/hypochloriteassay after 0, 5, 10, 15, 30, and 60 min. At the indicated time points, cells were lysed, and cytoplasmicextracts (25 ~g) were analyzed by EMSA with a 25,000 cpm 32p-labeledIRE probe. Only IRE/IRP1 complexes are shown (A and B, top). Analysisof the sameextracts on EMSAin the presenceof 2% 2-mercaptoethanolconfirmedequal loading(not shown).Reproduced,withpermission,from K. Pantopoulos,S. Mueller,A. Atzberger,W. Ansorge, W. Stremmel,and M. W. Hentze,J. Biol. Chem. 272, 9802 (1997). in response to cell treatments with < 1 0 / z M steady-state H202 concentrations. We have calibrated the enzymatic HzOz-generating system to yield 10 or 5 / z M steady-state H202 and applied it to B6 cells. Treatment with 10/zM H202 for 1 hr resulted in complete activation of IRP1, whereas a similar treatment with 5 / z M H202 had no effect. 16 Thus, exposure of B6 cells to 1 0 / z M H202 for 15 rain defines the minimal requirement for IRP1 activation.

Effects o f lntracellular Oxidative Stress on IRP1 We have employed different drugs to assess the effects of intracellular oxidative stress on IRP1. These include antimycin A (inhibitor of respiratory chain complex III), menadione (redox-cycling quinone), and 3-amino-l,2,4-triazole (inhibitor of catalase). The specific conditions used in our experiments are the following: B6 cells, subjected to treatment with antimycin A or 3-amino-l,2,4triazole, receive 5 /~M HzDCF-DA 30 min prior to harvesting. 16 Alternatively, cells are pretreated with 5 /zM H2DCF-DA for 2 hr, washed, and treated with menadione. 17 All treatments are performed in supplemented DMEM. A stock solution of HzDCF-DA (10 mM in DMSO) is always freshly prepared. The DCF

332

PROTEIN SENSORS AND REACTIVE OXYGEN SPECIES

[32]

fluorometric assay reveals that all these drugs are efficient at promoting an increase in intracellular H202 levels. However, their effects on IRP1 differ significantly. Antimycin A (100/zM) elicits a dramatic increase in intracellular H202 levels within 30 min (by electron leakage in respiratory chain) but only activates IRPI after 2 hr. 4'16 Menadione (100/zM) undergoes redox cycling and partially activates IRP1 within 15 min, but then leads to irreversible damage of both IRE-binding and cytosolic aconitase activity. 17 Finally, 3-amino-1,2,4-triazole promotes intracellular H202 accumulation (by inhibiting its degradation) but has no effect on IRE binding. These results suggest that a mere increase in intracellular H202 levels is not sufficient to activate IRP1. Measurement of Relative Changes in IntraceUular 11202 Levels in Response to Various Sources of Extracellular 1-1202:Effects on IRP1 The DCF fluorometric assay is employed to address whether activation of IRP1 by extracellular HzO2 involves increases in intracellular H202 levels. B6 cells and pretreated with H2DCF-DA (5/zM) for 30 min. Subsequently, the dye is washed away and cells are treated for 30 min with different sources of exogenous H202. Intracellular H202 levels are then assessed by FACS (Fig. 3B), and IRP1 activity is monitored in parallel by EMSA (Fig. 3A). Increasing concentrations of H202 generated by glucose/glucose oxidase (without catalase) lead to a substantial increase of DCF fluorescence accompanied by activation of IRP1. Similarly, treatment with glucose, glucose oxidase, and catalase calibrated to yield 100/zM steady-state H202 is associated with a detectable increase in DCF fluorescence and IRP1 activation. However, treatment with 10/zM steady-state H202 or a bolus addition of 100/zM H202 for 30 min results in IRP 1 activation without a detectable increase in DCF fluorescence. This result is consistent with the idea that an increase in intracellular H202 levels is not necessary for the activation of IRP1 by extracellular H202. A more conservative interpretation implies that any potential increase in intracellular H202, required for IRP1 activation by extracellular H202, is below the detection limit of the DCF fluorometric assay. A c t i v a t i o n o f IRP1 b y

H202

in P e r m e a b i l i z e d B 6 F i b r o b l a s t s

Permeabilization of Cells with Streptolysin-O (SLO) We have developed an in vitro system to study IRP1 activation by H202 based on the permeabilization of B6 cells with SLO. 2°,2~ This toxin from Staphylococsus aureus initially binds as a monomer to cholesterol in the plasma membrane, subsequently oligomerizes into arc- and ring-shaped structures, and eventually forms 20 K. Pantopoulos and M. W. Hentze, Proc. Natl. Acad. Sci. U.S.A. 95, 10559 (1998). 21 M. W. Hentze and K. Pantopoulos, German Patent Application Nr. 198 12930.0 (1998).

[32]

A

IRP1 AND OXIDATIVE STRESS

G/GO H202 (I~M) bolus H202 (BM)

catalase

B

- >100 I00 10 -

-

333

1$0-~-

ctrl ~-1.27

100

30~

+ +

150~ 90~H

IRE/IRP-1

H202>10Olt M

2

~-I0.94

3 0 ~ _ _

1501 H202 =lO01tM "1 (steady state) ~ 90~-~. ~.3'34

3

/~

fr~probe --~ 1 2 3 4 5 150-1 "1~ IRE/IRP-1

+ 2-ME (296)

freeprobe

H202 -1OpM . (steady state)

4

H202 =100 pM

S

I \ 150"]t "~

_ (bolus) 9 0 ~ ~''~1"39 " ......

--t .....

[

;!.

Fluorescenceintensity FIG. 3. IRP1 activation by extracellular H202 can occur without detectable increases in intracellular H202 levels. (A) B6 fibroblasts (107) were pretreated with 5 /zM HeDCF-DA for 30 rain and subsequently either left untreated (lane 1) or treated for 30 min with glucose and glucose oxidase (kGo = 4.2 x 10 -7 M-sec -I) to yield H202> 100 /*M (lane 2); glucose, glucose oxidase (kGo = 4.2 x 1 0 - 7 M.sec-1), and catalase to yield 100 ~M (kca t = 4.2 x 10-3 sec -1) (lane 3); 10 #M (kca t = 4.2 x 10 -2 sec - l ) (lane 4) steady-state H202; or treated with a bolus of 100 /*M H202 (lane 5). Cytoplasmic extracts (25 /zg) were analyzed by EMSA with a 25,000 cpm 32p-labeled IRE probe in the absence (top) or presence of 2% 2-mercaptoethanol (2-ME) (bottom). The positions of IRE/IRP1 complexes and of excess free IRE probe are indicated by arrows. Note the lower sample loading in lane 4. (B) Detection of intracellular H202. Control cells (box 1) or cells treated with extracellular H202 sources for 30 min (boxes 2-5) were analyzed for DCF fluorescence by FACS. Fluorescence intensity is plotted against counts (number of cells analyzed). The median value of the fluorescence intensity is given by X. Reproduced, with permission, from K. Pantopoulos, S. Mueller, A. Atzberger, W. Ansorge, W. Stremmel, and M.W. Hentze, J. Biol. Chem. 272, 9802 (1997).

334

PROTEINSENSORSAND REACTIVEOXYGENSPECIES

[32]

transmembrane pores up to 30 nm in diameter. 22 Technical details on cell permeabilization with pore-forming toxins can be found in Bhakdi et al. 23 Treatment with SLO allows diffusion of soluble cell constituents and separation of the cytosol from the remaining cell by centrifugation (Fig. 4A). We have used following protocol for permeabilization: B6 cells are washed twice with PBS and harvested by scraping with a rubber policeman. Cells are then pelleted by gentle centrifugation (1000g for 5 min at 4 °) and resuspended in SLO buffer (25 mM HEPESKOH, pH 7.4, 115 mM potassium acetate, 2.5 mM magnesium acetate, and 10 mM glucose). Approximately 108 cells are treated with 5 /zl SLO (200 #g/ml) in 2.5-3 ml SLO buffer for 10 min on ice, pelleted by gentle centrifugation (1000g for 5 min), washed, resuspended in SLO buffer (--~250/zl/107 cells), and tumbled at 37 ° for 20 min. The efficiency of permeabilization is assessed by trypan blue exclusion and usually exceeds 95%. Treatment o f Permeabilized Cells with the HeO2-Generating System

The conditions for H202 treatment are as follows: A suspension of'-~ 107 SLOpermeabilized B6 cells (in 250/zl SLO buffer) is tumbled at 37 ° with glucose oxidase (koo = 1.4 x 108 M sec-1). Taking into account degradation by cellular activities, this treatment yields --~50 tzM H202 at steady state. Generation of H202 can be monitored easily with semiquantitative peroxide test strips (Merckoquant, Darmstadt, Germany) from Merck. All reactions are stopped by the addition of excess catalase (kcat = 695 sec- t), and the cells are pelleted by centrifugation. In an exploratory experiment, the response of IRP1 to H202 was first assessed in suspensions of SLO-permeabilized and intact control B6 cells (Fig. 4B). After treatment with H2 02 for I hr, IRE-binding activity in the supernatants and pellet-derived lysates was analyzed by EMSA. Under these conditions, IRP1 activity is extracted from the pellet of intact control cells but is predominantly found in the supernatant from SLO-permeabilized cells (Fig. 4B). Treatment with H202 activates IRP1 in intact cells as well as in permeabilized cells. Analysis with 2-mercaptoethanol (Fig. 4B, bottom) indicates that more than 95% of cytoplasmic IRP1 is released from the cell pellet after treatment with SLO. Thus, permeabilization of B6 fibroblasts with SLO is quantitative, and treatment of permeabilized cells with H202 leads to the activation of IRP 1. The strength of this method lies in its amenability to biochemical manipulations. The cytosol of SLO-permeabilized cells can be separated by centrifugation and treated with H202 either separately, or recombined with the cell pellet. Treatment of the cytosol alone with H202 has no effect on IRP 1, whereas a combination of the cytosolic with the cell pellet fractions reconstitutes IRP1 activation by H202 (Fig. 4C). Addition of ATPyS and GTPyS inhibits the 2~S. Bhakdi, J. Tranum-Jensen,and A. Sziegoleit,Infect. Immun. 47, 52 (1985). 23S. Bhakdi,U. Weller,I. Walev,E. Martin,D. Jonas,and M. Palmer,Med. Microbiol. lmmunol. 182, 167 (1993).

[32]

IRPI AND OXIDATIVE STRESS

335

A

'

~~~

~o'> ~, ~27 "~' "lo,'~ .u4 V

"cell

+ SLO

9,',~- "C~='/4- ~,.~

~:e..> P,-..~,:.'-'I"

pellet"

spin

cytosol

B

[' intact cells [SLO-treated cellsI

n2u2-generatinB

system

.

+

-

+

-

+

-

+

1RE/IRP- 1 ""1~

free probe

ffactlon H202-generatinl~'

~system

StO-treated cells

Ipellet

I

+[-,,'o-~ b~ellet +l

lcytosoll ~ . . . . lbufferl + ' . -+ f " " "

free probe

1

+ 2-ME/2%}

I

H202-t~ated

IRE/IRP-1

free probe

IRE/IRP-I

C

2

3

4

5

6

7

8

1

2

3

4

5

6

IRE/|RP-I

+ 2-ME (2%) free probe

F1G. 4. A cell-free assay for IRPI activation by H202 based on SLO-permeabilized cells: requirement for nonsoluble factor(s). (A) A schematic representation of the SLO permeabilization procedure. (B) 107 control and 107 SLO-permeabilized B6 fibroblasts were suspended in 250/zl SLO buffer, tumbled for 20 min at 37 °, and treated with an HzO2-generating system for 1 hr. Following centrifugation, 10 tzl of supernatants (2.5/zg/#l) and pellet lysates (25/zg protein) was analyzed by EMSA with a 25,000 cpm radiolabeled IRE probe without (top) or with (bottom) 2% 2-mercaptoethanol (2-ME). Lanes 1, 2 and 5, 6, supernatants; lanes 3, 4 and 7, 8 pellet lysates (in cytoplasmic lysis buffer) of intact and SLO-permeabilized cells treated without or with H202. (C) 107 B6 fibroblasts were permeabilized with SLO as in B. Cytosol was separated by gentle centrifugation (supernatant), and cell pellets were washed twice with SLO buffer. Cytosol alone and cell pellets, mixed with one cytosol equivalent or resuspended in buffer, were treated, or not, with H202 for 1 hr. Following centrifugation, 10 #1 of supernatants (2.5/zg/#l) was analyzed by EMSA with a 25,000 cpm radiolabeled IRE probe without (top) or with (bottom) 2-ME. Lanes 1 and 2, cell pellet mixed with cytosol; lanes 3 and 4, cytosol alone; and lanes 5 and 6, cell pellets resuspended in buffer, treated without or with H202. The positions of IRE/IRP1 complexes and excess free probe are indicated by arrows. Reproduced, with permission, from K. Pantopoulos and M. W. Hentze, Proc. Natl. Acad. Sci. U.S.A. 95, 10559 (1998).

336

PROTEIN SENSORS AND REACTIVEOXYGENSPECIES

[32]

in vitro activation of IRP1 by H202 .20 Taken together, these observations provide evidence that the activation of IRP1 by H202 involves "sensing" of H202 by insoluble components and relay of the signal in the cytoplasm by a stress-response signaling cascade.

A c t i v a t i o n o f IRP1 b y H 2 0 2 in I n t a c t R a t Liver In light of the well-established role of iron and H202 in tissue injury, 24 IRP1 activation by H202 may have important pathophysiological implications, especially in the context of inflammation, where cytotoxic immune cells release large amounts of reactive oxygen species to kill invading microorganisms. We have applied the methodology described earlier to mimic a physiological inflammatory response and to study its effect on IRP1 in the intact rat livery In contrary to the results obtained with cultured cells, perfusion of rat liver with a bolus of 100 # M H202 (in Krebs-Henseleit buffer containing 0.3 mM pyruvate and 2 mM lactate) and analysis of liver extracts by EMSA do not show any activation of IRP1. This is due to the fact that the bolus of H202 is degraded rapidly in the organ, and liver cells are not exposed to the critical threshold H202 required for IRP1 activation. Under inflammatory conditions, phagocytes continuously generate reactive oxygen species and, thus, oxidative stress is sustained. By employing the luminol/ hypochlofite assay, we found that stimulated neutrophils are able to increase serum levels of H202 by a factor of 10, even in the presence of H202-removing erythrocytes. This corresponds to a generation rate of 0.2 /zM/sec H202 from 6 x l06 neutrophils/ml in the blood. Perfusion of rat liver with the glucose/glucose oxidase/catalase system, calibrated to yield a continuous flux of 0.2 #M/sec H202 and, thus, to mimic physiologic inflammatory conditions, leads to activation of IRP1. This result validates at the intact organ level the observations previously made in cultured cells. Conclusions IRP1 is activated by low concentrations of extracellular H202 to bind to cognate IREs. We have shown elsewhere that H202-mediated activation of IRP1 is sufficient to control the expression of IRE-containing mRNAs and thereby modulate cellular iron metabolism. 3,26 While H202 converts [4Fe-4S] to [3Fe-4S] IRP1 in vitro, 6 this interaction fails to generate apo-IRP1 and thus activate IRE binding. 24B. Halliwelland J. M. C. Gutteridge,Methods Enzymol. 186, 1 (1990), 25S. Mueller, K. Pantopoulos,C. Hiibner,W. Stremmel,and M. W. Hentze,J. Biol. Chem. 276, 23192 (2ool). 26A. Caltagirone,G. Weiss, and K. Pantopoulos,J. B&I. Chem. 276, 19738 (2001).

[33]

METALLOTHIONEIN AS ANTIOXIDANT

337

The methods described in this article have provided evidence that H 2 0 2 exerts a signaling function to IRP1 in vivo. The mechanism for IRP1 activation is still elusive, but very likely involves "sensing" of extracellular H202 and transmission of the stress signal in the cytoplasm. Acknowledgments KP is a scholar of the Canadian Institutes of Health Research (CIHR) and a researcher of the Canada Foundation for Innovation (CFI).

[33] Mouse Astrocyte Cultures Used to Study Antioxidant Property of Metallothionein Isoforms B y M . GEORGE CHERIAN, YUTAKA SUZUKI, a n d M A R G A R I T A APOSTOLOVA

Introduction

Metallothioneins (MTs) are low molecular weight and cysteine-rich intracellular proteins that bind both essential (zinc and copper) and toxic (cadmium and mercury) metals with high affinity.1 They have no known enzymatic activity and are not essential, but their induced synthesis is important in the detoxification of toxic metals, and also protection against reactive-free radicals. 2-4 The many nucleophilic thiol-rich groups in MT can react with various electrophilic chemicals, can participate in controlling the intracellular redox potential, and may scavenge free radicals generated during the metabolism of xenobiotics.5-7 In addition, the induction of MT synthesis in oxidative stress and exposure to various organic compounds, anticancer drugs, and ionizing radiation suggests a role for MT in protection against free radical toxicity.4'8-1°

I j. H. K. Kagi, Methods Enzymol. 205, 613 (1991). 2 p. j. Thornalley and M. Vasak, Biochem. Biophys. Acta 884, 448 (1985). 3 M. Sato and I. Bremner, Free Radic. Biol. Med. 14, 325 (1993). 4 L. Cai, M. Satoh, C. Tohyamma, and M. G. Cherian, Toxicology 15, 85 (1999). 5 B. L. Vallee, Neurochem. Int. 27, 23 (1995). 6 H. N. Chan, R. Tabarrok, Y. Tamura, and M. G. Cherian, Chem.-Biol. Interact. 84, 113 (1992). 7 M. Aschner, Neurotoxicology 19, 653 (1998). 8 j. S. Lazo, S. M. Kuo, E. S. Woo, and B. R. Pitt, Chem-Biol. Interact. 1111112, 155 (1998). 9 M. Satoh, D. M. Kloth, S. A. Kadhim, J. L. Chin, A. Naganumra, N. Imura, and M. G. Cherian, Cancer Res. 53, 1829 (1993). l0 K. Shibuya, M. G. Cherian, and M. Satoh, Radic. Res. 148, 235 (1997).

METHODSIN ENZYMOLOGY,VOL.348

Copyright© 2002by AcademicPress. All rightsof reproductionin any formreserved. 0076-6879102$35.00