3,4-Diaminobenzoic acid (DABA) as a redox label for electrochemical detection of single base mismatches

Electrochimica Acta 56 (2011) 10264–10269

Contents lists available at SciVerse ScienceDirect

Electrochimica Acta journal homepage: www.elsevier.com/locate/electacta

3,4-Diaminobenzoic acid (DABA) as a redox label for electrochemical detection of single base mismatches Laleh Enayati Ahangar, Masoud A. Mehrgardi ∗ Department of Chemistry, Faculty of Science, University of Isfahan, Isfahan 81746-73441, Iran

a r t i c l e

i n f o

Article history: Received 15 March 2011 Received in revised form 6 September 2011 Accepted 7 September 2011 Available online 16 September 2011 Keywords: DNA hybridization biosensor Single base mismatch Thermodynamically stable mismatches 3,4-Diaminobenzoic acid Charge transfer in DNA

a b s t r a c t The present manuscript describes an electrochemical assay for detection of different types of single base mismatches (SBM) using 3,4-diaminobenzoic acid (DABA) as a new redox reporter. DABA is covalently attached to DNA, and its electrochemical response is followed. The present assay can overcome to two main problems of the hybridization biosensors, direct electron transfer of the redox reporter with the electrode surface and the positioning of the reporter before mismatch position. The introduced biosensor is able to discriminate complementary target and the targets including a single base mismatch even thermodynamically stable ones such as G–A and G–T. © 2011 Elsevier Ltd. All rights reserved.

1. Introduction DNA biosensors play a key role in the genomic sequencing, DNA computers, mutation detection, genetic disease treatment and tissue matching [1]. The detection of the point mutations is very important in early diagnosis of genetic diseases or cancers [2]. Recently, numerous methods have been developed for the detection of point mutations including nucleic acid molecular light switches [1], enzymatic probes [3,4], molecular beacons [5,6], binary probes [7] and nanoparticle modified biosensors [8]. Electrochemical methods as transduction systems for DNA hybridization biosensors provide convenient means for the discrimination of the point mutations [9]. Different electrodes including gold [2,5,10–12], highly oriented pyrolytic graphite [13], glassy carbon electrode [14,15] and carbon paste electrode [16] have been used for the construction of DNA biosensors. Different platforms for electrochemical DNA sensors have been appeared. In the transduction of DNA hybridization, the transduction based on the charge transfer in DNA duplex is one of the most inventive strategies. Charge transfer (CT) through DNA is sensitive to the integrity of the ␲-stack in DNA [10,11]. The presence of single base mismatches (SBM) induce perturbations in the ␲-stack and could shut down the CT in DNA, and it provide a very sensitive strategy for detection of SBMs [17]. Different molecules such

∗ Corresponding author. Tel.: +98 311 7932710; fax: +98 311 6689732. E-mail addresses: [email protected], [email protected] (M.A. Mehrgardi). 0013-4686/$ – see front matter © 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.electacta.2011.09.014

as methylene blue [6,18], daunomycin [19,20], redmond red [21], and ruthenium (II) hexaamine [22] were used as redox reporters. These reporters are oxidized or reduced by DNA mediated CT. In the presence of a mis-paired base, the electrochemical response will be reduced. Therefore, several types of DNA base lesions and single base mismatches can be easily discriminated. When the redox reporters are in the solution, two main problems decrease the sensitivity of the method: First, direct charge transfer of the reporter with the electrode surface via the pinholes in DNA monolayer, and second, the penetration of the reporter through DNA film and placing under the SBM position [23]. Thus in the presence of SBM there are electrochemical signals that restricted detection of SBM, especially for the detection of thermodynamically stable SBM such as G–A and G–T mismatches. A creative strategy to overcome these problems, and increase the differences between electrochemical signals of the complementary and single base mismatch targets, is the covalent attachment of the reporters on the top of targets [24]. This method allows placing reporter in a fixed position; therefore, the high background due to nonspecific adsorption disappears [9]. Duplex modified electrodes promote efficient electron transfer between electrode and the redox-active reporter on the top of DNA. Several different molecular redox reporters including daunomycin [11], anthraquinone [25,26], redmond red [10], ferrocene [27,28] and osmium tetraoxide complexes [29,30] have been used. Break in the sugar or phosphate backbone could not show any significant effect on the electrochemistry of covalently attached redox reporter [31]. However, the base mismatches cause a dramatic attenuation in electrochemical signal [32]. Daunomycin can be site-specially cross-linked to the exocyclic amine of guanine and can form a

L.E. Ahangar, M.A. Mehrgardi / Electrochimica Acta 56 (2011) 10264–10269

10265

Scheme 1. Schematic of modification principle for electrochemical biosensor.

covalent bond. The separation between the electrode surface and covalently fixed reporter has no effect on the yield or rate of electron transfer [11]. Gooding and co-workers used the anthraquinone covalently attached to thymines and investigated the primer extension reaction [25]. Saito and co-workers used this compound to genotyping single nucleotide polymorphisms [26]. Barton’s group used covalent reporters such as redmond red and nile blue to detect a basic site in DNA and hybridization subsequently [33]. The tactic of covalent attachment of a redox reporter is a powerful tool for SBM detection even for the thermodynamically stable mismatches such as G–A and G–T mismatches. In the present study, 3,4-diaminobenzoic acid was used as a redox-active reporter. This compound was previously used to quantify DNA and determination of DNA–protein interaction by fluorometric methods [34,35]. This redox reporter is covalently attached on the top of DNA using EDC/NHS chemistry to form a carboimide bond between the reporters and amino labeled probe DNA. The capability of this biosensor is examined with different SBMs in two positions near to and far from the electrode surface. 2. Experimental 2.1. Chemicals and solutions N-hydroxysuccinimide (NHS), N-(3-dimethylaminopropyl)-Nethyl carbodimidehydrochloride (EDC), 3-mercaptopropionic acid (MPA), potassium ferrocyanide, potassium ferricyanide, nitric acid, sulfuric acid, acetic acid, sodium dihydrogen phosphate, disodium hydrogen phosphate, 3,4-diaminobenzoic acid (DABA), ruthenium (III) hexaamine, magnesium chloride, sodium borohydride, sodium chloride and potassium chloride were purchased from commercial sources (Merck, Fluka or Sigma), and used as received, without further purification. The distilled-deionized water was used in all solution preparations (18 M). The stock solution of the oligonucleotides (2 ␮M) were prepared in 1× PBS buffer solution and kept frozen at −20 ◦ C. DNA oligonucleotides were obtained from Eurofins MWG/Operon Co. and had the following sequence (from 5 to 3 ): Capture: Probe: Complementary: NON-complementary: G–A mismatch: G–T mismatch: T–T mismatch: C–A mismatch:

HSC6 -TCACTGCAAA CTCATGGTCC-C6 NH2 GGACCATGAGTTTGCAGTGA ATCTACTACTGCATTCCGTC Near: GGACAATGAGTTTGCAGTGA Far: GGACCATGAGTTTGCAGGGA Near: GGACCGTGAGTTTGCAGTGA Far: GGACCATGAGTTTGCGGTGA Near: GGACCTTGAGTTTGCAGTGA Far: GGACCATGAGTTTGCTGTGA Near: GGACCACGAGTTTGCAGTGA Far: GGACCATGAGTTTGCAGCGA

Electrochemical experiments were carried out using an Autolab electrochemical system PGSTAT 30 [ECO CHEMIE, The Netherlands]

driven by GPES software. A conventional three-electrode system, consisting of small parts of gold recordable compact disks (CD-R) as working electrode, a platinum wire as an auxiliary electrode and an Ag/AgCl/3.0 M KCl reference electrode were used for experiments. The differential pulse voltammograms have been recorded at the scan rate of 10 mV s−1 and the pulse amplitude of 25 mV. EIS experiments were accomplished at a constant DC potential of +0.23 V. The applied AC potential was 5 mV. All experiments were performed at room temperature.

2.2. Electrode modification and DNA hybridization detection The gold electrode was prepared from a recordable compact disk according to previously published method [36–38]. Briefly, a piece of CD was cut and the protective layer was removed by putting it in the concentrated nitric acid. Then, it was washed with water thoroughly. Then, the gold surface was exposed to be used as a working electrode. The surface area of the gold electrode was measured by following its voltammogram in 0.5 M of sulfuric acid and assuming that a specific charge of 386 ␮C cm−2 is required for gold oxide reduction [37]. The surface area of the gold electrode was obtained equal to 0.19 ± 0.02 cm2 . The experimental steps of the modifications of the DNA biosensor are illustrated in Scheme 1. The piece of gold CD was secured to the bottom of a Teflon cell with an O-ring. In the first step of the modification, the electrode surface was covered with 12 ␮L of 2 ␮M thiolated-capture DNA, 3 ␮L of 0.3 M NaH2 PO4 and 6 ␮L of 2 M magnesium chloride for 24 h. A self-assembled layer of the capture DNA was formed on the surface of Au electrode. After washing with 0.02 M phosphate buffer (pH 7.4), 12 ␮L of 2 ␮M target DNA and 6 ␮L of 2 M magnesium chloride were placed on the electrode surface for 90 min. In the next step after washing the electrode, 12 ␮L of 2 ␮M amine-labeled capture DNA and 6 ␮L of 2 M magnesium chloride were dropped on Au electrode for 90 min. The probe is complementary to non-hybridized section of the target and would be hybridized with this part. In the last step of the modification 100 ␮L of a solution containing 1 mM of DABA, 20 mM of EDC and 30 mM of NHS was put on the electrode surface for 2 h. The resulting electrode was ready for the electrochemical detection. Electrochemical impedance spectroscopy (EIS) and differential pulse voltammetry (DPV) were used to electrochemical detection of SBM. 3 mL of 0.05 M phosphate buffer (pH 5.5) was placed into the Teflon cell, containing the modified Au electrode, then DPV determination of DABA, attached on DNA probe, was performed by scanning the potential from 0 V to +0.65 V. Each step of modification was monitored by EIS. For EIS analysis, a solution of 0.5 mM potassium ferricyanide and potassium ferrocyanide (1:1) in 0.15 M KCl and 0.02 M of phosphate buffer with pH 5.5 was used.

10266

L.E. Ahangar, M.A. Mehrgardi / Electrochimica Acta 56 (2011) 10264–10269

3. Results and discussion

3.1. CV and EIS behavior of electrode surface in modification steps Modification of the electrode surface was monitored using CV and EIS experiments. Fig. 1A shows the cyclic voltammograms of potassium ferricyanide on the bare and modified electrodes in each step of the modification. Modification of the electrode surface with an immobilized capture DNA cause an increase in the peak separation (Ep ) and a decrease in the faradic peak current (Ip ) due to the development of negative charges on the surface of the electrode upon capture DNA immobilization (Fig. 1A, voltammogram b). After hybridization of the target and probe DNA hybridization, the ds-DNA is formed. The DNA monolayer on the electrode surface becomes denser and the negative charge of electrode surface increases than the previous step. So, the accessibility of ferricyanide ions to electrode surface becomes difficult, the peak separation (Ep ) increases, and the faradic peak current (Ip ) diminish again (Fig. 1A, voltammograms c and d). These observations are in agreement with those previously reported on DNA biosensors [39]. EIS is an effective method for the surface analysis and the investigation of immobilized layer. An important advantage of EIS is that it does not damage the biomolecular layer on the electrode surface. Binding of biomaterial on the electrode surface decreases the double-layer capacitance and retards the interfacial electrontransfer kinetics [40]. These effects depend on the molecular and immobilization characteristics of the deposited film on the surface. Fig. 1B shows the impedance features of the electrode interfaces upon the different steps of the modifications. Upon the covalent binding of the DNA capture, hybridization with complementary target and then hybridization with DNA probe (Fig. 2B, plots a–d), the electron transfer resistance (Rct ) increase. These change stemming from the blocking of the electrode surface and electrostatic repulsion of [Fe(CN)6 ]3−/4− probe due to negative charge and spatial restriction of DNA. The kinetics of the electron transfer on the DNA modified gold electrode is retarded by electrostatic repulsion between negative charges of phosphate backbone of DNA and ferri/ferrocyanide. The Rct is about 480 ± 50 , 2200 ± 300 ( and 4600 ± 500 ( for capture immobilizing, target and probe

a

A 20

b c

d

J/µA.cm-2

10

0

-10

-20

-30 -0.2

-0.1

0.0

0.1

0.2

0.3

0.4

0.5

0.6

E/V(Ag/AgCl)

2.0

B 1.5

Zim(KΩ)

DNA mediated CT offers an exquisite sensitivity to the base pairs stacking. CT in DNA that intervene between the electrode surface and the redox reporters, allowing for electrochemical detection of SBM and hybridization assay. Covalent attachment of the redox reporter molecules at the top of DNA has several advantages involving scrubbing out direct charge transfer between the surface and the redox-active reporter therefore, the detection of different mismatches can be easily performed. This type of DNA biosensor can dissolve two main problems including direct electron transfer of the redox reporter with the electrode surface via pinholes of recognition layer and positioning of the reporter before the SBM in DNA duplexes. This hypothesis is examined by designing several DNA targets, including different mismatches such as C–A, T–T mismatches and thermodynamically stable ones (G–A and G–T). Each type of the mismatches was designed in different positions: near to or far from the electrode surface. DABA displays large electrochemical signal when used as a covalently attached probe. The carboxylic group of DABA could covalently attach to the amine group of probe DNA. To show that the responses of the oxidation of DABA are originated from the covalent binding of this reporter on the top of DNA significantly, the modification of the electrode was done in the EDC and NHS in DABA immobilizing step. The response of the biosensor was recorded and a weak peak at 0.43 V has been observed. It demonstrates that DABA interacts with DNA, but its contribution is negligible in compared to covalent bound DABAs (just about 15%).

30

d

b 1.0

c a

0.5

0.0

0

1

2

3

4

5

6

Zre(kΩ) Fig. 1. (A) Cyclic voltammograms in the presence of [Fe(CN)6 3−/4− ] (5 × 10−4 M) containing 0.1 M KCl at a scan rate 0.1 V s−1 and (B) the Nyquist plots obtained in the presence of [Fe(CN)6 3−/4− ] (5 × 10−4 M; 1:1) as a redox probe at a constant DC potential of +0.23 V for (a) bare Au, (b) after 24 h capture immobilization (2 ␮M), (c) after 90 min target hybridization (2 ␮M) and (d) after 90 min probe hybridization (2 ␮M).

hybridization, respectively. This is consistent with previously published reports [32]. 3.2. Quantitation of surface density of DNA immobilization The DNA immobilization coverage at the electrode surface can be estimated using the number of cationic redox molecules such as ruthenium (III) hexamine (RuHex) that electrostatically associated to the anionic phosphate backbone of DNA [41]. Briefly, after the immobilization of DNA on the electrode surface, the modified electrode was placed in RuHex solution with low ionic strength (0.05 M KCl). Then the amount of cationic redox marker, RuHex, was measured by chronocoulometry. Using the Cottrell equation, the chronocoulometric intercept at t = 0 is sum of the double layer charging and the surface surplus terms. The surface surplus terms are determined by the difference between the chronocoulometric intercepts for identical potential step experiment in the presence and absence of redox marker. By following the relationship of the saturated surface surplus of RuHex in converted to DNA surface density: DNA = 0

z m

NA

where  DNA is the probe surface density in molecules/cm2 , m is the number of bases in probe DNA, z is the charge of RuHex and NA is

L.E. Ahangar, M.A. Mehrgardi / Electrochimica Acta 56 (2011) 10264–10269

60

21

a

A

10267

a

50

b

16

J/µA.cm-2

J/µA.cm-2

40 30 20 10 0

11

c d

5

e

-10

b -0.3

-0.2

-0.1

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0 0.0

E /V (Ag/AgCl)

0.1

0.2

0.3

0.4

0.5

0.6

E/V (Ag/AgCl) 3.0

Fig. 3. Differential pulse voltammograms at a scan rate of 10 mV s−1 and amplitude 25 mV for DNA biosensors modified with 12 ␮L of 2 ␮M (a) complementary target, (b) non-complementary target and target containing, (c) G–A mismatch, (d) G–T mismatch and (e) C–A mismatch in 1× PBS and 1 M MgCl2 .

B 2.5

J/µA.cm-2

2.0

1.0

can diminish the second problem of DNA biosensor mentioned earlier in Section 1. The results show the capability of the assay for detection of the mismatches in the far and near positions to the electrode surface for different types of mismatches.

0.5

3.4. Response characteristics of DNA biosensor

1.5

3.3. Voltammetric transductions

The analytical performance of the biosensor was explored using different amounts of the complementary target in a 12 ␮L aliquot of the target solution according to the described procedure. As shown in Fig. 5, Current intensity of electrochemical oxidation of DABA increased as the concentration of complementary target amounts increased. The relationship between peak current of DABA oxidation and the logarithm of the amount of target is described in Fig. 5. The anodic peak currents of electrochemical oxidation of DABA are increased by the increase of the complementary target amounts up to 15 fmol and then the signal remain constant roughly. Also, the experiments demonstrate that the assay can detect sub-picomoles of the target.

Voltammetric behavior of DABA was followed by DPV and CV. Fig. 2 shows the cyclic and differential pulse voltammograms of 1 mM of DABA in 0.05 M of phosphate buffer at pH 5.5. The cyclic voltammograms of DABA shows a well-known anodic peak at 0.43 V at the first scan, but in the second scan an additional anodic peak at 0.2 V, for dimer of DABA, was observed [42]. The ability of DNA recognition layer to charge transfer has been accomplished using the oxidation signal of immobilized DABA on top of monolayer. The CT through DNA relies to the ␲-stack in dsDNA. The presence of a SBM will diminished the kinetic of charge transfer significantly. As Fig. 3 shows the voltammograms for the complementary, non-complementary and targets containing SBM, non-complementary target is not hybridized; therefore it does not show the oxidation signal of DABA. The presence of a single base mismatch perturbs the ␲-stack of DNA. As a result, the targets containing SBM cannot transfer charge suitably and the oxidation peak of DABA decreased notably. The effect of the position of single base mismatches in the double stranded structure on the oxidation signal of DABA was investigated. There was no significant difference in the DPV signals for mismatches in the far from and near to positions relative to the electrode surface (Fig. 4). Thus, the strategy followed in this study

Fig. 4. Comparison of current of DPV at a scan rate of 10 mV s−1 and amplitude 25 mV in potential of 0.24 V for complementary target and different target containing SBM in near and far position in 0.02 M of NaH2 PO4 .

0.0 -0.1

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

E/V(Ag/AgCl) Fig. 2. CV (A) and (B) DPV behavior of 10 mM of DBA in 0.02 M of NaH2 PO4 at a scan rate of 50 mV s−1 (a) first scan and (b) second scan.

Avogadro’s number. At last the surface density of probe DNA has been obtained equal to 4.79 × 10−12 molecules/cm2 .

10268

L.E. Ahangar, M.A. Mehrgardi / Electrochimica Acta 56 (2011) 10264–10269

Table 1 Comparison between the proposed assay and other reported techniques for the mismatch detection. Method

Analytical technique

Type of mismatch

% SBM signal decrease

Ref.

Immobilizing a hairpin probe Redox-active intercalator, anthraquinone monosulfonic acid Hematoxylin as an electroactive label Using a triple stem DNA probe DNA-mediated electrochemistry of disulfides Nucleic acid-functionalized Pt nanoparticles Nanoporous gold electrode electrostatic report A cadmium phosphate-loaded apoferritin nanoparticle probe Groove binder molecule (CuPcS4), as redox report Unlabeled hairpin DNA probe

Differential pulse voltammetry Osteryoung square wave voltammetry Differential pulse voltammetry AC-voltammetry Square wave voltammetry Linear sweep voltammograms Chronocoulometry Square-wave voltammogram

C–A, C–C G–A, C–A

20% 70% and 85%

[32] [33]

G–A C–C C–A C–A G–G C–C

15% 15% 65% 40% 90% 90%

[34] [12] [13] [8] [35] [36]

Differential pulse voltammetry

G–A, G–T, C–A, T–T (far and near type) CC

30%

[37]

60%

[38]

A–A

55%

[39]

G–A, G–T, C–A, T–T (far and near)

61–85%

Present work

DNA biosensor based on a silver nanoparticle label This proposed assay

Electrochemical impedance spectroscopy Anodic stripping voltammetry Differential pulse voltammetry

Batool Ghanbari for language editing of the manuscript. The authors would like to gratefully acknowledge the financial support of this project by research council of University of Isfahan. References

Fig. 5. The current response of biosensor for the target at different concentration in DPV analysis at a scan rate of 10 mV s−1 and amplitude 25 mV in potential of 0.24 V. Inset shows DPV for different concentration of complementary target.

4. Conclusion A new DNA hybridization biosensor for detection of single base mismatches has been described in this manuscript. This DNA biosensor is based on the CT in DNA duplex and covalent attachment of DABA, as a redox reporter, on top of the probe DNA. The electrochemical oxidation signal of covalently attached DABA was followed as hybridization signal. Therefore by fading the direct oxidation of the redox reporter on the electrode surface, different types of SBMs including the thermodynamically stable G–A and G–T mismatches can be detected. In Table 1, a comparison between previously reported assays and the present biosensor is shown. In most of the manuscripts, thermodynamically stable mismatches such as G–A and G–T mismatches were not investigated. The present assay shows that acceptable performance for distinguishing between complementary, non-complementary target DNA and even targets with a single base mismatches; including the most thermodynamically stable G–A G–T mismatches. Acknowledgments We would like to express our thanks to Dr. Abbas Rahmati for generous providing of DABA for the present study and also Mrs.

[1] L.-S. Ling, Z.-K. He, F. Chen, Y.-E. Zeng, Talanta 59 (2003) 269. [2] H. Gong, T. Zhong, L. Gao, X. Li, L. Bi, H.-B. Kraatz, Anal. Chem. 81 (2009) 8639. [3] F. Patolsky, E. Katz, A. Bardea, I. Willner, Langmuir 15 (1999) 3703. [4] I. Willner, B. Shlyahovsky, B. Willner, M. Zayats, Amplified DNA biosensors, in: L. Yingfu, L. Yi (Eds.), Functional Nucleic Acids for Analytical Applications, Springer, New York, 2009, p. 199. [5] Z.-S. Wu, J.-H. Jiang, G.-L. Shen, R.-Q. Yu, Hum. Mutat. 28 (2007) 630. [6] E. Farjami, L. Clima, K. Gothelf, E.E. Ferapontova, Anal. Chem. 83 (2011) 1594. [7] F. Xia, X. Zuo, R. Yang, Y. Xiao, D. Kang, A. Vallée-Bélisle, X. Gong, A.J. Heeger, K.W. Plaxco, J. Am. Chem. Soc. 132 (2010) 1252. [8] R. Polsky, R. Gill, L. Kaganovsky, I. Willner, Anal. Chem. 78 (2006) 2268. [9] A.A. Gorodetsky, M.C. Buzzeo, J.K. Barton, Bioconjug. Chem. 19 (2008) 2285. [10] E.M. Boon, D.M. Ceres, T.G. Drummond, M.G. Hill, J.K. Barton, Nat. Biotechnol. 18 (2000) 1096. [11] S.O. Kelley, N.M. Jackson, M.G. Hill, J.K. Barton, Angew. Chem. Int. Ed. 38 (1999) 941. [12] Y. Xiao, X. Lou, T. Uzawa, K.J.I. Plakos, K.W. Plaxco, H.T. Soh, J. Am. Chem. Soc. 131 (2009) 15311. [13] A.A. Gorodetsky, J.K. Barton, J. Am. Chem. Soc. 129 (2007) 6074. ˜ M.B. González-García, A. Costa-García, Biosens. Bio[14] A. de la Escosura-Muniz, electron. 22 (2007) 1048. [15] J. Chen, J. Zhang, K. Wang, X. Lin, L. Huang, G. Chen, Anal. Chem. 80 (2008) 8028. [16] M. Ligaj, J. Jasnowska, W.G. Musial, M. Filipiak, Electrochim. Acta 51 (2006) 5193. [17] E.M. Boon, J.E. Salas, J.K. Barton, Nat. Biotechnol. 20 (2002) 282. [18] S.O. Kelley, J.K. Barton, N.M. Jackson, M.G. Hill, Bioconjug. Chem. 8 (1997) 31. [19] S.O. Kelley, J.K. Barton, Science 283 (1999) 375. [20] X. Chu, G.-L. Shen, J.-H. Jiang, T.-F. Kang, B. Xiong, R.-Q. Yu, Anal. Chim. Acta 373 (1998) 29. [21] M.C. Buzzeo, J.K. Barton, Bioconjug. Chem. 19 (2008) 2110. [22] S.O. Kelley, E.M. Boon, J.K. Barton, N.M. Jackson, M.G. Hill, Nucleic Acids Res. 27 (1999) 4830. [23] M.A. Mehrgardi, R. Daneshtalab, J. Electroanal. Chem. 650 (2011) 214. [24] E.M. Boon, J.K. Barton, V. Bhagat, M. Nersissian, W. Wang, M.G. Hill, Langmuir 19 (2003) 9255. [25] D.A. Di Giusto, W.A. Wlassoff, S. Giesebrecht, J.J. Gooding, G.C. King, J. Am. Chem. Soc. 126 (2004) 4120. [26] A. Okamoto, T. Kamei, K. Tanaka, I. Saito, J. Am. Chem. Soc. 126 (2004) 14732. [27] A.A. Lubin, R.Y. Lai, B.R. Baker, A.J. Heeger, K.W. Plaxco, Anal. Chem. 78 (2006) 5671. [28] E.E. Ferapontova, K.V. Gothelf, Langmuir 25 (2009) 4279. [29] G.-U. Flechsig, T. Reske, Anal. Chem. 79 (2007) 2125. [30] M. Fojta, P. Kosteˇcka, M. Trefulka, L. Havran, E. Paleˇcek, Anal. Chem. 79 (2006) 1022. [31] T. Liu, J.K. Barton, J. Am. Chem. Soc. 127 (2005) 10160. [32] Y. Fu, R. Yuan, L. Xu, Y. Chai, X. Zhong, D. Tang, Biochem. Eng. J. 23 (2005) 37. [33] A.A. Gorodetsky, A. Ebrahim, J.K. Barton, J. Am. Chem. Soc. 130 (2008) 2924. [34] P.S. Thomas, M.N. Farquhar, Anal. Biochem. 89 (1978) 35.

L.E. Ahangar, M.A. Mehrgardi / Electrochimica Acta 56 (2011) 10264–10269 ˜ R. Castro, J. Castell, R. Marco, Anal. Biochem. 90 (1978) 543. [35] A. Pestana, [36] L. Angnes, E.M. Richter, M.A. Augelli, G.H. Kume, Anal. Chem. 72 (2000) 5503. [37] A. Kiani, E.N. Fard, Electrochim. Acta 54 (2009) 7254. [38] A.A.P. Ferreira, C.S. Fugivara, S. Barrozo, P.H. Suegama, H. Yamanaka, A.V. Benedetti, J. Electroanal. Chem. 634 (2009) 111.

[39] [40] [41] [42]

K. Hu, D. Lan, X. Li, S. Zhang, Anal. Chem. 80 (2008) 9124. J. Daniels, N. Pourmand, Electroanalysis 19 (2007) 1239. A.B. Steel, T.M. Herne, M.J. Tarlov, Anal. Chem. 70 (1998) 4670. I. Losito, F. Palmisano, P.G. Zambonin, Anal. Chem. 75 (2003) 4988.

10269