- Email: [email protected]
5′-Flanking and 5′-proximal exon regions of the two Xenopus albumin genes
S-Flanking and S-Proximal Exon Regions of the Two Xenopus Albumin Genes Deletion Analysis of Constitutive Promoter Function Marina Schorpp, Udo Diibbeling, Ulrike Wagner and Gerhart U. Ryffel Kernforschungszentrum Karlsruhe Institut ftir Genetik und Toxikologie Postfach 3640, D-7500 Karlsruhe I. F.R.G. (Received 14 July 1987, and in revised form 24 August 1987) The 5’.flanking regions and the first two exons of the 68kd and 74kd albumin genes of Xenopus laeais reveal extensive sequence homology between the two in the exon part, in the $-flanking region up to position -400 as well as in the first intron. Sequence comparisons of the Xenopus genes with either the albumin genes of the chicken and mammals or the mammalian alpha-fetoprotein genes reveals no homology in the 5’-flanking region but some conserved features in the first exon. The analysis of the chromatin structure demonstrates a DNase I hypersensitive region in the promoter of the 68kd albumin gene specific for hepatocytes that express the albumin gene. Deletion analysis of albumin-CAT fusion genes indicates that a 69 base-pair fragment extending from -50 to + 19 of the 68kd albumin gene is sufficient for constitutive transcription in microinjected Xenopus oocytes. The addition of 5’-flanking sequences did not change the transcriptional activity. This is consistent with the sequence data that revealed no other promoter element in this region other than the TATA box. The absence of a CCAAT box distinguishes the Xen,opus albumin genes from the mammalian albumin genes but is in agreement with the promoter structure of the alpha-fetoprotein genes.
1. Introduction
Xenopus albumin genes have been cloned (May et al., 1982a) and their exon-intron structure has been determined (May et al., 1983). Based on electron microscopy of R-loops the Xenopus albumin genes are known to contain 15 exons. The same number has been reported for the albumin and AFP genes of mammals. Furthermore, the size of the corresponding exons between the Xenopu,s and mammalian genes is very similar. The difference in molecular weight of the t’wo Xenopus albumins reflects differences in both the length and modification of the primary translation product (Westley & Weber, 1982). As a modification glycosylation, which is specific for the 74kd albumin, has been found. Glycosylation is also a general feature of mammalian AFP but is absent in mammalian albumins (Tilghman, 1985). All these characteristics make the Xenopus albumin genes an attractive system to study their relationship t,o the mammalian albumin and AFP genes. Furthermore, the Xenopus albumin genes are an interesting model to analyze the molecular mechanism involved in their regulated expression. The genes are tissue-specifically expressed in the
Albumin and alpha-fetoprotein (AFP)t are the major serum proteins in adult and fetal life, respectively. in all vertebrates (Tilghman, 1985). Both genes coding for these proteins are very similar in their exon-intron structure (Kioussis et wl., 1981; Sargent et al., 1981; Tamaoki & Fausto, 1984; Sakai et al., 1985) as well as in their coding seyuence (Gorin et al., 1981; Morinaga et al., 1983; Lawn et al., 1981; Dugaiczyk et al., 1982; Law & Dugaiczyk, 1981; Jagodzinski et al., 1981; Sargent et al., 1981). In contrast to the mammals, the frog Xenopus laelris has two albumin genes that code for a 68kd and a 74kd serum albumin protein (Westley et al.. 1981). It has been proposed that both genes have arisen from a genomic duplication about 30 million years ago (Kisbee et al., 1977). Both t Abbreviations used: AFI’, alpha-fetoprotein; 68kd and 74kd albumins, those species of albumin of M, 68,000 and 74,000, respectively; 68kd and 74kd genes. t,hose coding for the 68kd and 74kd albumins, rrspeotively: bp, base-pair(s): nt. nucleotide(s); kb, IO3 baws or base-pairs.
83 CC’)IWi
Acadrrnic
Press Limited
M. Schorpp
84
liver and their expression is modulated by various hormones. It has been documented that Xenopus albumin gene expression is stimulated by glucocorticoids and thyroid hormones (Wangh, 1982; Jackson & Shapiro, 1986). In contrast to mammalian albumin gene expression, which is not influenced by estrogen (Chiu et al., 1981), the synthesis of albumin is down-regulated by estrogen in Xenopus (May et al., 1982b; Kazmaier et al., 1985; Wolffe et al., 1985; Riegel et al., 1986). In order to determine transcriptional control elements we report here for both genes the sequence of the 5’ region including the first two exons. The sequence data and identification of the transcriptional start site enabled us to construct hybrid genes that could be used to analyze the promoter function in microinjected Xenopus oocytes.
2. Materials and Methods (a) DNA sequence determination
To generate 5’ deletion mutants, fragments of the albumin genes (clones IX 68,201 and LX 74a 101; May et al., 1982a) were treated with BaZ31 (Klein-Hitpass et al., 1986) and cloned into the EcoRI-BamHI restriction sites of pEMBLS+ or 8+, respectively (Dente et al., 1983). The sequence was determined according to the method of Sanger et a2. (1977) and was confirmed in some parts by the method of Maxam & Gilbert (1980). Further details are given by Schorpp (1987). DNA sequences were assembled and analyzed by the MICROGENIE program (Beckman). (b) Primer extension anulysis Extraction of poly(A)+ RNA was performed according to Ryffel (1976). The primer extension analysis was done as described by McKnight & Kingsbury (1982).
(c) Isolation of nuclei and, analysis of DNase I hypersensitive sites
et al. A small transferred fraction in Samples
portion of liver and blood cells was directly to 2 x SET prior to homogenization to get a which endogenous nucleases was inhibited. (5 pg) of DNA were digested by restriction enzymes, analyzed on agarose gels and transferred to nitrocellulose filters (Southern, 1975). The filters were incubated for 3 h in 10 ml of prehybridization solution and 3 days in 5 ml of hybridization solution as described (Felber et al., 1981). Following hybridization filters were washed twice for 30min at 65°C in 2xSSC (SSC is 150 mbr-NaCl, 15 mu-sodium citrate, pH 7), 0.1 ye (w/v) SDS and 10 pg calf thymus DNA/ml, twice for 45 min at 37°C in 2 x SSC, 0.1 y0 SDS, and once for 45 min at 65°C in 0.1 x SSC, 0.2% SDS. Filters were exposed to X-ray film for 7 to 14 days at -70°C using intensifying screens.
(d) Injection of DNA into Xenopus oocyte nuclei Large oocytes of X. Eaevis mature females were isolated in modified Barth saline (Maniatis et al., 1982) and centrifuged as described by Kressmann & Birnstiel (1980). In general, 40 to 60 oocyte nuclei were injected each with 50 nl of DNA solution (20 pg/ml). The injected oocytes were incubated at 25°C for 24 h. Surviving oocytes were selected and groups of 20 oocytes were used for RNA extraction. Albumin-CAT transcripts were measured by primer extension analysis using 2Opg of RNA, an equivalent of about
4 oocytes.
3. Results (a) Sequence and exon-intron structure of the 5’ ends of both Xenopus albumin genes
The exon-intron structure of both Xenopus albumin genes has been characterized in R-loop experiments by May et al. (1983). By alignment of this structure with the restriction map of the genomic clones (May et al., 1982a), as well as of the cDNA clones (Westley et al., 1981), we identified the restriction fragment containing the 5’ end of the albumin genes. These fragments were subcloned and a series of progressive 5’ BaZ31 deletion mutants were constructed. The obtained sequences for the 5’ end of the 68kd and 74kd albumin gene are given in Figures 1 and 2, respectively. To locate the transcriptional start site, we have chosen the primer extension analysis which should allow us to discriminate between the two very homologous albumin mRNAs (Westley et al., 1981). Based on the DNA sequence data (Figs 1 and 2) and initial SP6 mapping experiments (data not shown) we synthesized oligonucleotide primers complementary to parts of the albumin genes thought to be transcribed as albumin mRNAs (Fig. 3). The size of the extension product given in
Frog livers were perfused by 3.2% (w/v) sodium citrate to remove blood cells, cut to small pieces and homogenized in RSB/aucrose (10 mm-Tris, 10 m&r-NaCl, 5 mbr-MgCl,, 0.25 M-sucrose). The homogenate was passed at 4°C through 2 layers of gauze to remove connective tissue. The filtrate contained 60 to 80% hepatocytes and approximately 20% erythrocytes. Cells were centrifuged for 10 min at 2000 revs/min, lysed in ice-cold RSB/ sucrose with 0.5% NP40 (Shell) in a Dounce apparatus and the nuclei washed twice. Blood cells were recovered by heart puncture and processed as described for liver cells. Nuclei were resuspended at a concentration of 0.5 to 1 mg DNA/ml. Portions (300 ~1) were incubated for 10 min at 25°C with varying amounts of DNase I. The reaction was stopped by the addition of 2.7 ml of 2 x SET Figure 3 showed that the cap site is for both genes (SET is 150 m&r-NaCl, 5 mru-EDTA, 50 mnr-Tris . HCl at the homologous location, i.e. 32 bp 3’ from the (pH 8.0)). DNA was purified by treatment with RNase A TATA box and 38 nt upstream from the putative and proteinase K and subsequent extraction with AUG initiation codon (Figs 1 and 2). Primer b, phenol/chloroform (1 : 1, v/v). _----_-Figure 1. The nucleotide sequence of the 5’ end of the 68kd albumin gene of Xenopus. The TATA homology is boxed. The start site of transcription is indicated by an arrow. The exon-intron boundaries are indicated by brackets. The ATG codon is boxed and the conserved pentanucleotide and its complementary sequence are underlined. The beginning and the endpoints of homologous regions between the 2 albumin sequences are indicated by small arrows. The numbering of nucleotides refers to the cap site.
Xenopus Albumin
Genes
86
M. Schmpp et al.
86
-iSO!
GGATCCiTCCTGAGATC
Figure 2. The nucleotide Fig. 1.
sequence
of the 5’ end of the 74kd albumin
genes of Xenopus.
For further
explanation
see
Xenopus Albumin
Genes
87
TGTC TACiiTCTGGTA
+I I
AUG I
+ 670 68 kd
,3!jn++---------------TGGTAGTGTTCG
53”t f ------1 io0 TACTTCACCTAGTGG
f722 I
AUG I
,26nt----------------
+7m I
74kd
---TGTC TACZTCTGGTA
Figure 3. Determination of the transcriptional start site present in viva and specific identification of the 68kd and 74kd albumin mRNA. The sequence and position of the oligonucleotides used for primer extension analysis are given. Primers b and d cover the exon I-exon 2 junction with 4 nucleotides complementary to exon 1. The nucleotide difference in primers b and d is marked by an asterisk. The numbers above the coding sequence indicate the beginning and end of the exons; the thin brackets symbolize the intron sequences. The extension products are shown by broken lines and the sizes determined on sequencing gels are indicated.
which is expected to be specific for the 68kd albumin gene and should hybridize over the exonexon border, gave the predicted extension product of 128 nt (Fig, 3). The fact that this primer hybridizes to the mRNA confirms our suggestions about the location of the exon-exon boundaries. The result with primer b, however, could also be attributed to a cross-hybridization with the 74kd mRNA, because t,his 68kd-specific primer b differs only in one nucleotide from the 74kd sequence (compare wit.h Fig. 3). To prove that primer b specifically hybridizes to the 68kd mRNA we performed primer extension sequencing of the mRNA using primer 6. In parallel, sequencing was also done with primer d that differed in one nucleotide from primer b and should recognize the 74kd mRNA only. This RNA sequencing revealed that the primers used hybridize correctly with either the 68kd or the 74kd DNA sequence (data not shown). In summary, the RNA analysis showed that the studied 5’ region of both Xenopus albumin genes contain the first t,wo exons, and that in vivo the used st,art sit,e of transcription is for both genes at
the same position, i.e. 32 bp 3’ from the TATA box. The first exon coding for 26 amino acids has a size of 117 nt for both genes and it ends with thr sequence AG/GT, a consensus sequence for exonintron borders, which also had been observed for the chicken albumin (HachB et al., 1903) and the human AFP gene (Sakai et al., 1985). Based on SP6 analysis the second exon of the 68kd gene is 67 bp in length (data not shown), and we assume the same size for the 74kd gene. Using a dot matrix analysis. we detected extensive sequence homologies between the 68kd and 74kd albumin genes. A first homology region spans 550 bp. It contains about 400 bp of 5’-flanking sequences with the promoter region, first exon and 40 bp of the first intron. Within t,he region of the TATA box, the cap site and the first exon, the homology is very great, i.e. 91 “/o; otherwise the homology is 86%. Some further homology of 709’, extends 213 bp into the intron. Another conserved region with 75% homology begins in the first intron about 180 bp in front of the second exon and ends 30 bp downstream from the exon. The fact that the homology includes about 400 bp of the 5’.flanking
M. Schorpp et al.
88
region suggests that it contains important regulatory elements. A computer search for known conserved regulatory sequences reveals only the TATA box as a conserved element. (b) The first exon of the albumin genes shows the same structure for Xenopus, chicken and mammals
By the comparison of the Xenupus albumin sequences with known 5’.flanking sequences of the albumin and AFP genes of chicken and mammals, no obvious homologies were found. Comparing the 5’-non-translated sequences of the first exon of the Xenopus gene with the genes of chicken and mammals we detected the pentanucleotide CCCAC (Figs 1 and 2) that had been reported for the albumin genes of mammals and chicken (Sargent et al., 1981; Dugaiczyk et aE., 1982; Hache et aZ., 1983) and that is also present in mouse AFP mRNA (Scott & Tilghman, 1983). This pentanucleotide has its complementary sequence GTGGG (for Xenopus only GTGG (see Figs I and 2)) within the translated region of the mRNA. From the comparison of the deduced amino acid sequences of Xenopus albumins with the albumins of mammals and chicken, some further homologies have been found (Fig. 4). The first three amino acids are
identical for all albumins and AFPs. The homology to the mouse AFP includes even the first five amino acids. More important, however, is the observation that the amino acid codons at the putative cleavage sites between prepeptide and propeptide, as well as between propeptide and mature protein, have been conserved. The result of the comparison suggests that the first exon of Xenopus albumins has an albumin-typical structure specifying the prepeptide (18 amino acids), the propeptide (6 amino acids) and the first two amino acids of the mature protein (Fig. 4). Such an arrangement is identical to that found for the mammalian albumins, and it is distinct from the structure observed in chicken albumin and mammalian AFPs, which contain either a propeptide of eight amino acids or no propeptide at all, respectively. (c) The promoter region of the 6&d albumin gene contains a DNase I hypersensitive site specific for liver cells Since DNase I hypersensitive sites may indicate regions important for gene regulation (for a review, see Reeves, 1984), we searched for such sites in the sequenced part of the 68kd albumin gene. Therefore, we isolated liver nuclei from a male Xenopus
Exon 1
Prepeptide
Xenopus 68kd:
I-
MKWITLICLLISSTLIES
<
Propeptide 1
Mature
Exon 2
>
protein
DT
I DVDHHKHIADMYNLLTERTFKG
---
--
-A--------V-TA--------
-NLQR-A-
-A
-GV
-R-
EA
HKSEIAHRFKDLGEQHFKGLVL..
-GV
-R-
__
HKSEIAHRFKDLGEEHFKGLVL..
-GV
-R-
-A
HKSEVAHRFKDLGEENFKALVL..
: ~ I
74kd:
-------------SF---
;
-- L
I
Chicken
alb:
---V-A-SFIFLFSSAT-
Rat
alb:
---V-FLL--FI-GSAF-
: I I :
Bovine
alb:
---V-F-S--LLFSSAY-
i
N.D.
I
Human
alb:
---V-F-S--FLFSSAY-
:
Mouse
AFP:
-----PAS-ILLLHFAA-
KALHENEFGI
ASTLDSSQCVTEKNVLS..
Rat*
AFP:
---SASISF-LLLNFAEP
-VLHTNEFGI
ESTLDSSQCPTEKNMFN..
Human
AFP:
---VESIF-IFLLNFTE-
-TLHRNEYGI
ASILDSYQCTAEISLAD
Figure 4. The first exon of the Xenopus albumin genes shows an albumin-typical structure. The amino acid sequences of the first and second exon of different species are shown in alignment with the amino acid sequence of the Xenopus albumin genes. All sequences except that of the bovine serum albumin are deduced from the DNA sequence (for a review, see Tilghman, 1985). The pre- and propeptide borders are indicated. (-) Identical amino acid; (*) for this alignment we used the second possible start codon for translation; (. .) the exact end of the second exon is not known in these cases.
Albumin
Xenopus
Genes I.0 kb i
t
I
*
i
I
Probe b
Probe u V
3.4 kb
I
4 2.6
kb
(0) I
2
3
4
5
6
2-6 kb 3.4 k.b
(b)
Figure 5. A liver-specific 1)Nase I hypersensitive site at the promoter of the 68kd albumin gene. (a) The restriction sites used for mapping the DNase 1 hypersensitive regions are given. The I kb KpnI- XhoI fragment (probe a) and the 0.5 kb BglII-f’.stI fragment (probe b) were used as 5’ and 3’.end-labeling probes, respectively. The sizes of DNase Igenerated fragment,s are given b-Y arrows and the DNase I hypersensitive region is located by an asterisk. (b) and Dh’A digested with either (b) KpnI or (c) PstI were separated on agarose gels and hybridized with (c) 5 pp of liwr (b) probe o or (c) probe b. In lanes I, DNA immediately isolated from the tissue was used, whereas in lanes 2 t,o 6 DNA extracted from nucl4 and inc%ubated for 10 min at 25°C was separated. The DNase T roncentration was 0. 0.75. 1.5, 3.0 and 1.5 pg,‘ml in lanes 2 to 6. respectively.
and treated portions of these nuclei with increasing amounts of DNase I. Then the isolated DNA was digested with KpnI, separated on an agarose gel, blotted to a nitrocellulose filter and hybridized with the S-end-labeling probe a. i.e. the KpnI-XhoI fragment, shown in Figure 5(a). Figure 5(b) illustrates that, a specific band appears wit’h increasing I)Xasc 1 digestion (lanes 5 and 6). From the 3.4 kb
size of this fragment we calculate that a DNase I sensitive site is close to the cap site. By the same approach using erythrocyte nuclei we cannot observe the appearance of any specific band upon DNase T digestion (data not> shown). This implies that the DNase I hypersensitive site at, the promoter is specific for liver cells. where the albumin genes are active. Since probe (I rross-
90
M. Schmpp
hybridizes with restriction fragments that are not specific for the 68kd albumin gene (Fig. 5(b), lane l), we repeated the location of the DNase I hypersensitive site with P&I-digested DNA that was hybridized with the 3’-end-labeling probe b (Fig. 5(a)). From the size of the fragment generated by DNase I digestion (2.6 kb in Fig. 5(c), lanes 4 and 5) we located the DNase I hypersensitive site to the cap site, thus confirming the location obtained in the KpnI digests. Again no hypersensitive sites could be seen in DNA derived from erythrocytes (data not shown). From this result we conclude that the 68kd Xenopus albumin gene has a tissue-specific hypersensitive site close to the cap site. (d) 69 by are sugicient for expression of the albumin gene in Xenopus oocytes To identify, by a functional assay, regulatory DNA elements in the 5’-flanking region of the Xenopus albumin genes we constructed albumin fusion genes and studied their expression in microinjected Xenopua oocytes. Promoters of other genes have been analyzed extensively by this method, most notably the Herpes simplex virus thymidine kinase promoter (McKnight & Kingsbury, 1982; Graves et al., 1986). We linked the 5’-flanking region of the 68kd albumin gene to the CAT indicator gene coding for chloramphenicol acetyltransferase (Gorman et al., 1982). For that purpose a 3’ deletion mutant was cloned that still contained the albumin promoter and cap site ending at position + 19 with an introduced BamHI linker. The region from -662 to + 19 was cut out of the deletion mutant by restriction enzymes Hind111 and BamHI and cloned into the vector pBLCAT3 in front of the CAT gene (Jantzen et al., 1987). The fusion gene was designated -662 albumin-CAT. To construct a shorter albuminCAT gene the HindIII-BglII fragment from -662 to -50 was removed yielding -50 albumin-CAT as vector. These albumin-CAT constructs were injected into the nucleus of Xenopus oocytes. Initially the expression of the injected genes was monitored by measuring the CAT activity. However, since various constructs containing no eukaryotic promoter gave high CAT activities (data not shown), we conclude that many transcripts initiate on prokaryotic sequences. Therefore, we measured the transcription of injected genes at the RNA level using the primer extension analysis that
et al.
allowed us to map the site of transcription initiation (Fig. 6(a)). These mapping experiments showed that there are two predominant start sites of transcription (Fig. 6(b), lanes 1 and 2), i.e. the expected extension product of 104 nt and a 12 nt shorter product of 92 nt. The shorter extension product was not due to premature termination during the extension reaction, because the same transcript was also seen with a SP6 probe covering the albumin promoter area (data not shown). Therefore, the initiation of transcription in oocytes is not as accurate as in wivo. Quite surprisingly the short -50 albumin-CAT fusion gene gave similar amounts of transcripts as the long -662 albuminCAT construct (Fig. 6(b), lanes 1 and 2). This finding was verified in another series of injections where we coinjected, as an internal control, a CAT vector containing the thymidine kinase promoter ( - 105 to + 51). This vector gene gives an extension product of 125 nt as expected (McKnight $ Kingsbury, 1982). Comparing the intensity of this thymidine kinase promoter activity with the signal of the two different albumin-CAT constructs (Fig. 6(b), lanes 3 to 6) we conclude that the -662 and -50 albumin-CAT fusion genes have an identical transcriptional activity. Therefore, the albumin sequences from -50 to + 19 contain all the information that is necessary to confer constitutive expression in oocytes. A further reduction of these 69 bp by deleting the 3’ end from + 19 to -4 does seriously impair the transcriptional activity in microinjected Xenopus oocytes (Fig. 6(b), lanes 7 to 10). The remaining transcripts give an extension product of about 70 nt, which is some 15 nt too short for the normal transcript initiated 32 nt downstream from the TATA box. The loss of the proper positioned t,ranscriptional start site possibly reflects t,he removal of the natural cap site. 4. Discussion (a) The rezationship of the Xenopus albumin the albumin and AFP genes of mammals chicken
genes to and
Albumin and AFP are secreted proteins and therefore synthesized with a prepeptide consisting of 18 or 19 amino acids (for a review, see Tilghman, 1985). In contrast to the AFP, the albumins have an additional basic propeptide of six amino acids (8
Figure 6. 69 bp are sufficient for the constitutive expression of the albumin--CAT fusion gene in Xenopus oocytes. (a) To measure correctly initiated transcripts a 30-mer oligonucleotide was used that has its complementary sequence in the CAT gene. This primer is shown with its sequence and position in respect to the CAT gene. The extension products observed are shown as broken lines with arrows at the end (sizes are given in nt). (b) Transcripts from oocytes injected each with either 1 ng of albumin-CAT fusion gene or with 0.8 ng of albumin-CAT construct with 0.2 ng thymidine kinase-CAT gene as internal marker ( + tk, pBLCATS+ : Klein-Hitpass et al., 1986) were identified by primer extension analysis. The microinjected gene constructs are indicated above the slots and the numbers refer either to the 5’ endpoints (lanes 1 to 6) or to the 3’ endpoints (lanes 7 to 10) of the albumin insert in t,he albumin-CAT fusion genes. The extension products of 104 and 92 nt, corresponding to transcripts initiated at the albumin promoter and the product of 133 nt representing pBLCATS+ transcripts, are indicated by an arrow. The size marker m is pBR322 digested with HaeIII.
Xenopus Albumin for the chicken) that is cleaved off in the Golgi apparatus (Rradshaw & Peters, 1969; Peters, 1977). Pre- and propeptide are both encoded by the first exon. Sequence comparisons revealed that the
Genes
91
Xerwpus genes have a limited homology in the first exon with the known albumin and AFP genes of mammals and chicken. The structure of the first exon with a 38 nt C-leader sequence and 26 amino
(a) #
cap
‘h Q -5Oolb
TATAA /
CAT -50
+I
104
nt
CAT
l-f + 19
and
92
nt
-
-
f104
-.
-
-
-
----
*
Primer
/ \ TACCTCTTTTTTTAGTGACCTATATGGTGG ( b) + tk
+ tk
1
I
124 123
+tk
-
.-alb
80
c
-
64
-
I234
5
6
Fig. 6.
7
8
9
IO
alb
M. Sdwrpp et al.
92
acid codons is identical to the albumin genes of mammals. For the entire amino acid sequence encoded by the first exon the homology is mainly restricted to the amino-terminal end of the primary translation product, but also to the putative cleavage sites between the pre- and the propeptide as well as the mature protein. By comparing the amino acid composition at the cleavage sites between pre- and propeptide it becomes clear that the secretory signal sequence in Xenopus albumins obeys the “( -3, - 1)rule” (Von Heijne, 1986). Previous experiments have demonstrated that the Xenopus albumin contains a signal peptide that is cleaved off (Westley & Weber, 1982). However, there is no direct evidence that the propeptide of the Xenopus albumin, predicted by the sequence data, exists in viva. The presence of a propeptide sequence in Xenopus albumins suggest’s that they are more related to the albumins than to the AFPs of mammals. The previous observation that the 74kd Xenopus albumin is glycosylated (Westley & Weber, 1982), a modification restricted to the AFP in mammals, would argue t,hat the Xenopus albumins also have the characteristics of AFPs. (b) The chromatin structure of the albumin promoter Mapping of DNase I hypersensitive sites in the 68kd albumin gene has revealed a region sensitive to DNase I at the promoter which is specific for liver cells. Similar observations have been made for the rat albumin and AFP genes (Babiss et aE., 1986; Turcotte et al., 1986; Nahon et al., 1987; Tratner et al., 1987). Furthermore, in rat genes hypersensitive sites have been reported between 2 kb and 5 kb. Such sit,es, which are further upstream, may also be present in the Xenopus sequence but they would be outside the sequenced area and they are difficult to locate because of many repetitive DNA elements (Ryffel et al., 1983), which interfere with the analysis. The presence of a DNase I sensitive region, which is specific for liver cells, reflects a chromatin structure characteristic for an active gene. We have identified an open liver-specific chromatin structure of the albumin genes (Felber et aE., 1981) and t,his active chromatin structure has been correlated with liverspecific undermethylation (Gerber-Huber et al., 1983). It is interesting to note that the DNase 1 sensitive region persists after estrogen treatment (data not shown) although albumin expression is dramatically reduced (May et al., 19826). This suggests that the structure of the chromatin containing the albumin promoter is not affected by the hormone. This agrees with the run-on transcription experiments in isolated nuclei where albumin transcription remains constant throughout estrogen treatment (Kazmaier et al., 1985; Wolffe et al.: 1985; Riegel et aE., 1986). (c) Functional analysis of the Xenopus albumin promoter Microinjections of albumin-CAT fusion genes into Xenopus oocytes have shown t’hat a 69 bp
albumin sequence from -50 to + 19 is sufficient to confer full transcriptional activity. The finding that the deletion of sequences from -662 to + 50 did not lead to a loss in activity is astonishing because many other genes in this region contain &s-acting DNA elements that) stimulate transcription (for reviews, see Serfling et al., 1985; Briggs et al.. 1986). However, using the mouse AFP gene a short promoter has been identified that, is sufficient to confer correct and efficient transcription in an in&ro system as well as in transient transfections of cell cultures (Scott & Tilghman, 1983). Therefore, in the Xenopus albumin genes, as well as the mouse AFP gene, the TATA box seems to be sufficient for conferring constitutive expression. This result is in agreement with the sequence data where no other known conserved &acting element,, except the TATA box, can be found. This is in contrast to the mammalian albumin genes where a CCAAT box is present (Heard et al., 1987). Consequently the promoter structure of the Xenopus albumin genes is more homologous to one of the mammalian AFP genes. The authors are very grateful to F. May and I{. Westlry. who provided the albumin gmornic~ c*lones, and t’o (‘. ,Jonat for solving the problems inherent to work was supported by t’he Deutschr Forschungsgemeinschaft (Rp 5/l 1).
computer usage. This
References Rabiss, L. E., Bennett, A., Friedman, ,J. M. & Darneli, J. E. (1986). Proc. Nat. Acad. Sci., U.S. A. 83, 65046508. Bisbee, C. A., Baker, M. A., Wilson, A. C., Hadji-Azami, I. & Fischberg, M. (1977). Science, 195, 785-787. Bradshaw, R. A. & Peters, T., Jr (1969). J. Riol. Ghem. 244, 5582-5589. Rriggs, M., Kadonaga, J.. Bell, S. & Tjian, R. (1986). Science, 234, 47-52. Chiu, J. F.. Massari, R. J., Schwartz, C. E., Meisler. N. T. & Thanassi, J. W. (1981). Nucl. Acids Rea. 9, 6917 6934. Dente, L.. Cesareni, G. & Cortese, R. (1983). Nucl. Acids Res. 11. 1645-1655. Dugaiczyk, A., Law, S. W. & Dennison, 0. E. (1982). Proc. Nat. Acad. Sk., ZJ.S.A. 79, 71-75. Felber. Il. K., Gerber-Huber, S., Meier, C., May, F. E. IS., Westley, B., Weber, R. & Ryffel, G. IT. (1981). ,Vucl. Acids Res. 9, 24552474. Gerber-Huber. S., May, F. B. E., Westley, H. R., Felbrr. R. K., Hosbach, H. A.. Andres. A.-C. & Ryffel, G. IT. (1983). Cell, 33, 43-51. Gorin, M. B., Cooper, D. L., Eiferman, F., Van der Rijn I’. & Tilghman. S. M. (1981). .J. Riol. Chem. 256. 195441959. Gorman, C., Moffat, I,. & Howard, H. (1982). Mol. f’rll. Aiol. 2, 104441051. Graves, J., Johnson, I’. F. & McKnight, S. L. (1986). Cell, 44, 565576. Hache, R. J. G., Wiskocil, R., Vasa, M., Roy, R. N., Lau, P. C. K. & Deeley. R. G. (1983). J. Riol. Chem. 258, 4556-4564. Heard, .J. M., Ott, M.-O., Herbomel, P., Mottura-Rallier. A.. Weiss, M. C. 8r Yaniv. M. (1987). Mol. Cell. Riol. 7 . d“4% 243-c.
Xenopus
Albumin
Jackson. (‘. 1,. & Shapiro, D.
Genes
93
Peters, T. (1977). Clin. Chem. 23. 5- 12. Reeves, R. (1984). B&him. Biophys. ilcta, 782, 343~-393. Riegel, A. T., Martin, M. B. & Schoenberg, I>. R. (1986). Mol. Cell. Endocrinol.
(‘hem,. 260, 5055-5060.
Sanger. F.. Micklen,
8. & Coulson. A. R. (1977). I’roc.
Nat. Acad. Sci., i’.S.A.
(lhwm. 256, 1!+60- 1967.
Klein-Hitpass. I,.. Schorpp, M.. Wagner, LT. & Ryffel, G. (1986). (‘rll, 46. 1053-1061. Krrssmann. A. & Birnstiel, M. L. (1980). In Transfer of (‘rll (‘onstiturnts into Eukaryotic Cells (Cellis, I. E., Grarsmann . :\. & Loyt,er, A.. eds), ,VATO advanced .sl udy iflSfitUtPS sfuies. pp. 383-407. Plenum Press. Xrw \‘ork. I ,aw. S. \V. & I)ugaiczyk. A. (1981). .Vatwp (London), 291. 201 ~205. Lawn. R. 11.. Ad(slman. J., Bock, 8. C., Franke. A. E., Hourk. (‘. M.. Najarian. R. C., Seeburg, I’. H. & LVion. li. 1,. (1981). Nucl. Acids Res. 9, 6103-6114. Maniatis, ‘I’.. Fritsc*h. E. & Sambrook, J. (1982). Molecular (‘loniny: A Laboratory Manual, Cold Spring Harbor Laborator), Press. Cold Spring Harbor, NY. Maxam. A. & (Gilbert. IV’. (1980). Methods Enzymol. 65, 4!,9 -560.
May. F. E. IS.. Weber, R. Hr Wrstley, H. R. (1982a). &cl. ,-Icids KP.v. 10. 2791-2807. May. F. E. B.. Ryffrl. 0. I‘., Weber, R. & Westley, B. R. ( 19820). ,1. Biol. (‘hem. 257. 13919--13923. May. F. E. I<.. n’rxtley. B. R.. Wyler. T. & Weber. R. (1983). J. Nol. Rid. 168, 229-247. McKnight. S. & Kingsbury. R. (1982). Science, 217. 3163’4. Morinaga. T., Sakai, M.. Wrgmann, T. G. & Tamaoki, T. (In%!). I’roc. ,Vat. Acad. Sci.. l’.A.A. 80, 4604-4608. Bahon. .J. I... VcLnetianer. A. & Sala-Trespat, J. M. (l!K). /‘r/Jr. ,I’&. .4cad. Sri.. f:.S.A. 84. 2135-2139.
Edited
44, 201-209.
Ryffel, G. IJ. (1976). Eur. J. B&hem. 62. 41 ‘i-423. Ryffel, G. C., Muellener. D. B.. Gerber-Huber. S.. Wyler. T. & Wahli. W. (1983). Nucl. ilcids Hrs. 11. 7707716. Sakai, M.. Morinaga, T., Crano. Y.. Watanabe. K., Wegmann, T. G. & Tamaoki. T. (198.5). .J. Biol.
Sargent, T. D., Jagodzinski, (1981).
Mol. Cell. Biol.
74. 5463-5467.
L. I,.. Yang. M. I% Konnrr. J. 1, 871-88X Dissertat,ion. l.nivrrsity of
Schorpp. M. (1987). Karlsruhr, F.R.G. Scot’t, R. W. & Tilghman, S. M. (I 983). .lfol. (‘~11. Rio/. 3. 1295p 1309. Serfling, E.. ,Jasin, M. & Schaffnrr. FV. (19%). ‘I’wnds Oenut. 1, 224--N). Southern, P. (1975). J. idol. Biol. 98, 503GSli. Tamaoki. T. & Fausto. K. (1984). In Recombinant DSA and (‘~11 Proliferation (Stein. (:. & Stein.
by P. Chambon
1. Introduction
Xenopus albumin genes have been cloned (May et al., 1982a) and their exon-intron structure has been determined (May et al., 1983). Based on electron microscopy of R-loops the Xenopus albumin genes are known to contain 15 exons. The same number has been reported for the albumin and AFP genes of mammals. Furthermore, the size of the corresponding exons between the Xenopu,s and mammalian genes is very similar. The difference in molecular weight of the t’wo Xenopus albumins reflects differences in both the length and modification of the primary translation product (Westley & Weber, 1982). As a modification glycosylation, which is specific for the 74kd albumin, has been found. Glycosylation is also a general feature of mammalian AFP but is absent in mammalian albumins (Tilghman, 1985). All these characteristics make the Xenopus albumin genes an attractive system to study their relationship t,o the mammalian albumin and AFP genes. Furthermore, the Xenopus albumin genes are an interesting model to analyze the molecular mechanism involved in their regulated expression. The genes are tissue-specifically expressed in the
Albumin and alpha-fetoprotein (AFP)t are the major serum proteins in adult and fetal life, respectively. in all vertebrates (Tilghman, 1985). Both genes coding for these proteins are very similar in their exon-intron structure (Kioussis et wl., 1981; Sargent et al., 1981; Tamaoki & Fausto, 1984; Sakai et al., 1985) as well as in their coding seyuence (Gorin et al., 1981; Morinaga et al., 1983; Lawn et al., 1981; Dugaiczyk et al., 1982; Law & Dugaiczyk, 1981; Jagodzinski et al., 1981; Sargent et al., 1981). In contrast to the mammals, the frog Xenopus laelris has two albumin genes that code for a 68kd and a 74kd serum albumin protein (Westley et al.. 1981). It has been proposed that both genes have arisen from a genomic duplication about 30 million years ago (Kisbee et al., 1977). Both t Abbreviations used: AFI’, alpha-fetoprotein; 68kd and 74kd albumins, those species of albumin of M, 68,000 and 74,000, respectively; 68kd and 74kd genes. t,hose coding for the 68kd and 74kd albumins, rrspeotively: bp, base-pair(s): nt. nucleotide(s); kb, IO3 baws or base-pairs.
83 CC’)IWi
Acadrrnic
Press Limited
M. Schorpp
84
liver and their expression is modulated by various hormones. It has been documented that Xenopus albumin gene expression is stimulated by glucocorticoids and thyroid hormones (Wangh, 1982; Jackson & Shapiro, 1986). In contrast to mammalian albumin gene expression, which is not influenced by estrogen (Chiu et al., 1981), the synthesis of albumin is down-regulated by estrogen in Xenopus (May et al., 1982b; Kazmaier et al., 1985; Wolffe et al., 1985; Riegel et al., 1986). In order to determine transcriptional control elements we report here for both genes the sequence of the 5’ region including the first two exons. The sequence data and identification of the transcriptional start site enabled us to construct hybrid genes that could be used to analyze the promoter function in microinjected Xenopus oocytes.
2. Materials and Methods (a) DNA sequence determination
To generate 5’ deletion mutants, fragments of the albumin genes (clones IX 68,201 and LX 74a 101; May et al., 1982a) were treated with BaZ31 (Klein-Hitpass et al., 1986) and cloned into the EcoRI-BamHI restriction sites of pEMBLS+ or 8+, respectively (Dente et al., 1983). The sequence was determined according to the method of Sanger et a2. (1977) and was confirmed in some parts by the method of Maxam & Gilbert (1980). Further details are given by Schorpp (1987). DNA sequences were assembled and analyzed by the MICROGENIE program (Beckman). (b) Primer extension anulysis Extraction of poly(A)+ RNA was performed according to Ryffel (1976). The primer extension analysis was done as described by McKnight & Kingsbury (1982).
(c) Isolation of nuclei and, analysis of DNase I hypersensitive sites
et al. A small transferred fraction in Samples
portion of liver and blood cells was directly to 2 x SET prior to homogenization to get a which endogenous nucleases was inhibited. (5 pg) of DNA were digested by restriction enzymes, analyzed on agarose gels and transferred to nitrocellulose filters (Southern, 1975). The filters were incubated for 3 h in 10 ml of prehybridization solution and 3 days in 5 ml of hybridization solution as described (Felber et al., 1981). Following hybridization filters were washed twice for 30min at 65°C in 2xSSC (SSC is 150 mbr-NaCl, 15 mu-sodium citrate, pH 7), 0.1 ye (w/v) SDS and 10 pg calf thymus DNA/ml, twice for 45 min at 37°C in 2 x SSC, 0.1 y0 SDS, and once for 45 min at 65°C in 0.1 x SSC, 0.2% SDS. Filters were exposed to X-ray film for 7 to 14 days at -70°C using intensifying screens.
(d) Injection of DNA into Xenopus oocyte nuclei Large oocytes of X. Eaevis mature females were isolated in modified Barth saline (Maniatis et al., 1982) and centrifuged as described by Kressmann & Birnstiel (1980). In general, 40 to 60 oocyte nuclei were injected each with 50 nl of DNA solution (20 pg/ml). The injected oocytes were incubated at 25°C for 24 h. Surviving oocytes were selected and groups of 20 oocytes were used for RNA extraction. Albumin-CAT transcripts were measured by primer extension analysis using 2Opg of RNA, an equivalent of about
4 oocytes.
3. Results (a) Sequence and exon-intron structure of the 5’ ends of both Xenopus albumin genes
The exon-intron structure of both Xenopus albumin genes has been characterized in R-loop experiments by May et al. (1983). By alignment of this structure with the restriction map of the genomic clones (May et al., 1982a), as well as of the cDNA clones (Westley et al., 1981), we identified the restriction fragment containing the 5’ end of the albumin genes. These fragments were subcloned and a series of progressive 5’ BaZ31 deletion mutants were constructed. The obtained sequences for the 5’ end of the 68kd and 74kd albumin gene are given in Figures 1 and 2, respectively. To locate the transcriptional start site, we have chosen the primer extension analysis which should allow us to discriminate between the two very homologous albumin mRNAs (Westley et al., 1981). Based on the DNA sequence data (Figs 1 and 2) and initial SP6 mapping experiments (data not shown) we synthesized oligonucleotide primers complementary to parts of the albumin genes thought to be transcribed as albumin mRNAs (Fig. 3). The size of the extension product given in
Frog livers were perfused by 3.2% (w/v) sodium citrate to remove blood cells, cut to small pieces and homogenized in RSB/aucrose (10 mm-Tris, 10 m&r-NaCl, 5 mbr-MgCl,, 0.25 M-sucrose). The homogenate was passed at 4°C through 2 layers of gauze to remove connective tissue. The filtrate contained 60 to 80% hepatocytes and approximately 20% erythrocytes. Cells were centrifuged for 10 min at 2000 revs/min, lysed in ice-cold RSB/ sucrose with 0.5% NP40 (Shell) in a Dounce apparatus and the nuclei washed twice. Blood cells were recovered by heart puncture and processed as described for liver cells. Nuclei were resuspended at a concentration of 0.5 to 1 mg DNA/ml. Portions (300 ~1) were incubated for 10 min at 25°C with varying amounts of DNase I. The reaction was stopped by the addition of 2.7 ml of 2 x SET Figure 3 showed that the cap site is for both genes (SET is 150 m&r-NaCl, 5 mru-EDTA, 50 mnr-Tris . HCl at the homologous location, i.e. 32 bp 3’ from the (pH 8.0)). DNA was purified by treatment with RNase A TATA box and 38 nt upstream from the putative and proteinase K and subsequent extraction with AUG initiation codon (Figs 1 and 2). Primer b, phenol/chloroform (1 : 1, v/v). _----_-Figure 1. The nucleotide sequence of the 5’ end of the 68kd albumin gene of Xenopus. The TATA homology is boxed. The start site of transcription is indicated by an arrow. The exon-intron boundaries are indicated by brackets. The ATG codon is boxed and the conserved pentanucleotide and its complementary sequence are underlined. The beginning and the endpoints of homologous regions between the 2 albumin sequences are indicated by small arrows. The numbering of nucleotides refers to the cap site.
Xenopus Albumin
Genes
86
M. Schmpp et al.
86
-iSO!
GGATCCiTCCTGAGATC
Figure 2. The nucleotide Fig. 1.
sequence
of the 5’ end of the 74kd albumin
genes of Xenopus.
For further
explanation
see
Xenopus Albumin
Genes
87
TGTC TACiiTCTGGTA
+I I
AUG I
+ 670 68 kd
,3!jn++---------------TGGTAGTGTTCG
53”t f ------1 io0 TACTTCACCTAGTGG
f722 I
AUG I
,26nt----------------
+7m I
74kd
---TGTC TACZTCTGGTA
Figure 3. Determination of the transcriptional start site present in viva and specific identification of the 68kd and 74kd albumin mRNA. The sequence and position of the oligonucleotides used for primer extension analysis are given. Primers b and d cover the exon I-exon 2 junction with 4 nucleotides complementary to exon 1. The nucleotide difference in primers b and d is marked by an asterisk. The numbers above the coding sequence indicate the beginning and end of the exons; the thin brackets symbolize the intron sequences. The extension products are shown by broken lines and the sizes determined on sequencing gels are indicated.
which is expected to be specific for the 68kd albumin gene and should hybridize over the exonexon border, gave the predicted extension product of 128 nt (Fig, 3). The fact that this primer hybridizes to the mRNA confirms our suggestions about the location of the exon-exon boundaries. The result with primer b, however, could also be attributed to a cross-hybridization with the 74kd mRNA, because t,his 68kd-specific primer b differs only in one nucleotide from the 74kd sequence (compare wit.h Fig. 3). To prove that primer b specifically hybridizes to the 68kd mRNA we performed primer extension sequencing of the mRNA using primer 6. In parallel, sequencing was also done with primer d that differed in one nucleotide from primer b and should recognize the 74kd mRNA only. This RNA sequencing revealed that the primers used hybridize correctly with either the 68kd or the 74kd DNA sequence (data not shown). In summary, the RNA analysis showed that the studied 5’ region of both Xenopus albumin genes contain the first t,wo exons, and that in vivo the used st,art sit,e of transcription is for both genes at
the same position, i.e. 32 bp 3’ from the TATA box. The first exon coding for 26 amino acids has a size of 117 nt for both genes and it ends with thr sequence AG/GT, a consensus sequence for exonintron borders, which also had been observed for the chicken albumin (HachB et al., 1903) and the human AFP gene (Sakai et al., 1985). Based on SP6 analysis the second exon of the 68kd gene is 67 bp in length (data not shown), and we assume the same size for the 74kd gene. Using a dot matrix analysis. we detected extensive sequence homologies between the 68kd and 74kd albumin genes. A first homology region spans 550 bp. It contains about 400 bp of 5’-flanking sequences with the promoter region, first exon and 40 bp of the first intron. Within t,he region of the TATA box, the cap site and the first exon, the homology is very great, i.e. 91 “/o; otherwise the homology is 86%. Some further homology of 709’, extends 213 bp into the intron. Another conserved region with 75% homology begins in the first intron about 180 bp in front of the second exon and ends 30 bp downstream from the exon. The fact that the homology includes about 400 bp of the 5’.flanking
M. Schorpp et al.
88
region suggests that it contains important regulatory elements. A computer search for known conserved regulatory sequences reveals only the TATA box as a conserved element. (b) The first exon of the albumin genes shows the same structure for Xenopus, chicken and mammals
By the comparison of the Xenupus albumin sequences with known 5’.flanking sequences of the albumin and AFP genes of chicken and mammals, no obvious homologies were found. Comparing the 5’-non-translated sequences of the first exon of the Xenopus gene with the genes of chicken and mammals we detected the pentanucleotide CCCAC (Figs 1 and 2) that had been reported for the albumin genes of mammals and chicken (Sargent et al., 1981; Dugaiczyk et aE., 1982; Hache et aZ., 1983) and that is also present in mouse AFP mRNA (Scott & Tilghman, 1983). This pentanucleotide has its complementary sequence GTGGG (for Xenopus only GTGG (see Figs I and 2)) within the translated region of the mRNA. From the comparison of the deduced amino acid sequences of Xenopus albumins with the albumins of mammals and chicken, some further homologies have been found (Fig. 4). The first three amino acids are
identical for all albumins and AFPs. The homology to the mouse AFP includes even the first five amino acids. More important, however, is the observation that the amino acid codons at the putative cleavage sites between prepeptide and propeptide, as well as between propeptide and mature protein, have been conserved. The result of the comparison suggests that the first exon of Xenopus albumins has an albumin-typical structure specifying the prepeptide (18 amino acids), the propeptide (6 amino acids) and the first two amino acids of the mature protein (Fig. 4). Such an arrangement is identical to that found for the mammalian albumins, and it is distinct from the structure observed in chicken albumin and mammalian AFPs, which contain either a propeptide of eight amino acids or no propeptide at all, respectively. (c) The promoter region of the 6&d albumin gene contains a DNase I hypersensitive site specific for liver cells Since DNase I hypersensitive sites may indicate regions important for gene regulation (for a review, see Reeves, 1984), we searched for such sites in the sequenced part of the 68kd albumin gene. Therefore, we isolated liver nuclei from a male Xenopus
Exon 1
Prepeptide
Xenopus 68kd:
I-
MKWITLICLLISSTLIES
<
Propeptide 1
Mature
Exon 2
>
protein
DT
I DVDHHKHIADMYNLLTERTFKG
---
--
-A--------V-TA--------
-NLQR-A-
-A
-GV
-R-
EA
HKSEIAHRFKDLGEQHFKGLVL..
-GV
-R-
__
HKSEIAHRFKDLGEEHFKGLVL..
-GV
-R-
-A
HKSEVAHRFKDLGEENFKALVL..
: ~ I
74kd:
-------------SF---
;
-- L
I
Chicken
alb:
---V-A-SFIFLFSSAT-
Rat
alb:
---V-FLL--FI-GSAF-
: I I :
Bovine
alb:
---V-F-S--LLFSSAY-
i
N.D.
I
Human
alb:
---V-F-S--FLFSSAY-
:
Mouse
AFP:
-----PAS-ILLLHFAA-
KALHENEFGI
ASTLDSSQCVTEKNVLS..
Rat*
AFP:
---SASISF-LLLNFAEP
-VLHTNEFGI
ESTLDSSQCPTEKNMFN..
Human
AFP:
---VESIF-IFLLNFTE-
-TLHRNEYGI
ASILDSYQCTAEISLAD
Figure 4. The first exon of the Xenopus albumin genes shows an albumin-typical structure. The amino acid sequences of the first and second exon of different species are shown in alignment with the amino acid sequence of the Xenopus albumin genes. All sequences except that of the bovine serum albumin are deduced from the DNA sequence (for a review, see Tilghman, 1985). The pre- and propeptide borders are indicated. (-) Identical amino acid; (*) for this alignment we used the second possible start codon for translation; (. .) the exact end of the second exon is not known in these cases.
Albumin
Xenopus
Genes I.0 kb i
t
I
*
i
I
Probe b
Probe u V
3.4 kb
I
4 2.6
kb
(0) I
2
3
4
5
6
2-6 kb 3.4 k.b
(b)
Figure 5. A liver-specific 1)Nase I hypersensitive site at the promoter of the 68kd albumin gene. (a) The restriction sites used for mapping the DNase 1 hypersensitive regions are given. The I kb KpnI- XhoI fragment (probe a) and the 0.5 kb BglII-f’.stI fragment (probe b) were used as 5’ and 3’.end-labeling probes, respectively. The sizes of DNase Igenerated fragment,s are given b-Y arrows and the DNase I hypersensitive region is located by an asterisk. (b) and Dh’A digested with either (b) KpnI or (c) PstI were separated on agarose gels and hybridized with (c) 5 pp of liwr (b) probe o or (c) probe b. In lanes I, DNA immediately isolated from the tissue was used, whereas in lanes 2 t,o 6 DNA extracted from nucl4 and inc%ubated for 10 min at 25°C was separated. The DNase T roncentration was 0. 0.75. 1.5, 3.0 and 1.5 pg,‘ml in lanes 2 to 6. respectively.
and treated portions of these nuclei with increasing amounts of DNase I. Then the isolated DNA was digested with KpnI, separated on an agarose gel, blotted to a nitrocellulose filter and hybridized with the S-end-labeling probe a. i.e. the KpnI-XhoI fragment, shown in Figure 5(a). Figure 5(b) illustrates that, a specific band appears wit’h increasing I)Xasc 1 digestion (lanes 5 and 6). From the 3.4 kb
size of this fragment we calculate that a DNase I sensitive site is close to the cap site. By the same approach using erythrocyte nuclei we cannot observe the appearance of any specific band upon DNase T digestion (data not> shown). This implies that the DNase I hypersensitive site at, the promoter is specific for liver cells. where the albumin genes are active. Since probe (I rross-
90
M. Schmpp
hybridizes with restriction fragments that are not specific for the 68kd albumin gene (Fig. 5(b), lane l), we repeated the location of the DNase I hypersensitive site with P&I-digested DNA that was hybridized with the 3’-end-labeling probe b (Fig. 5(a)). From the size of the fragment generated by DNase I digestion (2.6 kb in Fig. 5(c), lanes 4 and 5) we located the DNase I hypersensitive site to the cap site, thus confirming the location obtained in the KpnI digests. Again no hypersensitive sites could be seen in DNA derived from erythrocytes (data not shown). From this result we conclude that the 68kd Xenopus albumin gene has a tissue-specific hypersensitive site close to the cap site. (d) 69 by are sugicient for expression of the albumin gene in Xenopus oocytes To identify, by a functional assay, regulatory DNA elements in the 5’-flanking region of the Xenopus albumin genes we constructed albumin fusion genes and studied their expression in microinjected Xenopua oocytes. Promoters of other genes have been analyzed extensively by this method, most notably the Herpes simplex virus thymidine kinase promoter (McKnight & Kingsbury, 1982; Graves et al., 1986). We linked the 5’-flanking region of the 68kd albumin gene to the CAT indicator gene coding for chloramphenicol acetyltransferase (Gorman et al., 1982). For that purpose a 3’ deletion mutant was cloned that still contained the albumin promoter and cap site ending at position + 19 with an introduced BamHI linker. The region from -662 to + 19 was cut out of the deletion mutant by restriction enzymes Hind111 and BamHI and cloned into the vector pBLCAT3 in front of the CAT gene (Jantzen et al., 1987). The fusion gene was designated -662 albumin-CAT. To construct a shorter albuminCAT gene the HindIII-BglII fragment from -662 to -50 was removed yielding -50 albumin-CAT as vector. These albumin-CAT constructs were injected into the nucleus of Xenopus oocytes. Initially the expression of the injected genes was monitored by measuring the CAT activity. However, since various constructs containing no eukaryotic promoter gave high CAT activities (data not shown), we conclude that many transcripts initiate on prokaryotic sequences. Therefore, we measured the transcription of injected genes at the RNA level using the primer extension analysis that
et al.
allowed us to map the site of transcription initiation (Fig. 6(a)). These mapping experiments showed that there are two predominant start sites of transcription (Fig. 6(b), lanes 1 and 2), i.e. the expected extension product of 104 nt and a 12 nt shorter product of 92 nt. The shorter extension product was not due to premature termination during the extension reaction, because the same transcript was also seen with a SP6 probe covering the albumin promoter area (data not shown). Therefore, the initiation of transcription in oocytes is not as accurate as in wivo. Quite surprisingly the short -50 albumin-CAT fusion gene gave similar amounts of transcripts as the long -662 albuminCAT construct (Fig. 6(b), lanes 1 and 2). This finding was verified in another series of injections where we coinjected, as an internal control, a CAT vector containing the thymidine kinase promoter ( - 105 to + 51). This vector gene gives an extension product of 125 nt as expected (McKnight $ Kingsbury, 1982). Comparing the intensity of this thymidine kinase promoter activity with the signal of the two different albumin-CAT constructs (Fig. 6(b), lanes 3 to 6) we conclude that the -662 and -50 albumin-CAT fusion genes have an identical transcriptional activity. Therefore, the albumin sequences from -50 to + 19 contain all the information that is necessary to confer constitutive expression in oocytes. A further reduction of these 69 bp by deleting the 3’ end from + 19 to -4 does seriously impair the transcriptional activity in microinjected Xenopus oocytes (Fig. 6(b), lanes 7 to 10). The remaining transcripts give an extension product of about 70 nt, which is some 15 nt too short for the normal transcript initiated 32 nt downstream from the TATA box. The loss of the proper positioned t,ranscriptional start site possibly reflects t,he removal of the natural cap site. 4. Discussion (a) The rezationship of the Xenopus albumin the albumin and AFP genes of mammals chicken
genes to and
Albumin and AFP are secreted proteins and therefore synthesized with a prepeptide consisting of 18 or 19 amino acids (for a review, see Tilghman, 1985). In contrast to the AFP, the albumins have an additional basic propeptide of six amino acids (8
Figure 6. 69 bp are sufficient for the constitutive expression of the albumin--CAT fusion gene in Xenopus oocytes. (a) To measure correctly initiated transcripts a 30-mer oligonucleotide was used that has its complementary sequence in the CAT gene. This primer is shown with its sequence and position in respect to the CAT gene. The extension products observed are shown as broken lines with arrows at the end (sizes are given in nt). (b) Transcripts from oocytes injected each with either 1 ng of albumin-CAT fusion gene or with 0.8 ng of albumin-CAT construct with 0.2 ng thymidine kinase-CAT gene as internal marker ( + tk, pBLCATS+ : Klein-Hitpass et al., 1986) were identified by primer extension analysis. The microinjected gene constructs are indicated above the slots and the numbers refer either to the 5’ endpoints (lanes 1 to 6) or to the 3’ endpoints (lanes 7 to 10) of the albumin insert in t,he albumin-CAT fusion genes. The extension products of 104 and 92 nt, corresponding to transcripts initiated at the albumin promoter and the product of 133 nt representing pBLCATS+ transcripts, are indicated by an arrow. The size marker m is pBR322 digested with HaeIII.
Xenopus Albumin for the chicken) that is cleaved off in the Golgi apparatus (Rradshaw & Peters, 1969; Peters, 1977). Pre- and propeptide are both encoded by the first exon. Sequence comparisons revealed that the
Genes
91
Xerwpus genes have a limited homology in the first exon with the known albumin and AFP genes of mammals and chicken. The structure of the first exon with a 38 nt C-leader sequence and 26 amino
(a) #
cap
‘h Q -5Oolb
TATAA /
CAT -50
+I
104
nt
CAT
l-f + 19
and
92
nt
-
-
f104
-.
-
-
-
----
*
Primer
/ \ TACCTCTTTTTTTAGTGACCTATATGGTGG ( b) + tk
+ tk
1
I
124 123
+tk
-
.-alb
80
c
-
64
-
I234
5
6
Fig. 6.
7
8
9
IO
alb
M. Sdwrpp et al.
92
acid codons is identical to the albumin genes of mammals. For the entire amino acid sequence encoded by the first exon the homology is mainly restricted to the amino-terminal end of the primary translation product, but also to the putative cleavage sites between the pre- and the propeptide as well as the mature protein. By comparing the amino acid composition at the cleavage sites between pre- and propeptide it becomes clear that the secretory signal sequence in Xenopus albumins obeys the “( -3, - 1)rule” (Von Heijne, 1986). Previous experiments have demonstrated that the Xenopus albumin contains a signal peptide that is cleaved off (Westley & Weber, 1982). However, there is no direct evidence that the propeptide of the Xenopus albumin, predicted by the sequence data, exists in viva. The presence of a propeptide sequence in Xenopus albumins suggest’s that they are more related to the albumins than to the AFPs of mammals. The previous observation that the 74kd Xenopus albumin is glycosylated (Westley & Weber, 1982), a modification restricted to the AFP in mammals, would argue t,hat the Xenopus albumins also have the characteristics of AFPs. (b) The chromatin structure of the albumin promoter Mapping of DNase I hypersensitive sites in the 68kd albumin gene has revealed a region sensitive to DNase I at the promoter which is specific for liver cells. Similar observations have been made for the rat albumin and AFP genes (Babiss et aE., 1986; Turcotte et al., 1986; Nahon et al., 1987; Tratner et al., 1987). Furthermore, in rat genes hypersensitive sites have been reported between 2 kb and 5 kb. Such sit,es, which are further upstream, may also be present in the Xenopus sequence but they would be outside the sequenced area and they are difficult to locate because of many repetitive DNA elements (Ryffel et al., 1983), which interfere with the analysis. The presence of a DNase I sensitive region, which is specific for liver cells, reflects a chromatin structure characteristic for an active gene. We have identified an open liver-specific chromatin structure of the albumin genes (Felber et aE., 1981) and t,his active chromatin structure has been correlated with liverspecific undermethylation (Gerber-Huber et al., 1983). It is interesting to note that the DNase 1 sensitive region persists after estrogen treatment (data not shown) although albumin expression is dramatically reduced (May et al., 19826). This suggests that the structure of the chromatin containing the albumin promoter is not affected by the hormone. This agrees with the run-on transcription experiments in isolated nuclei where albumin transcription remains constant throughout estrogen treatment (Kazmaier et al., 1985; Wolffe et al.: 1985; Riegel et aE., 1986). (c) Functional analysis of the Xenopus albumin promoter Microinjections of albumin-CAT fusion genes into Xenopus oocytes have shown t’hat a 69 bp
albumin sequence from -50 to + 19 is sufficient to confer full transcriptional activity. The finding that the deletion of sequences from -662 to + 50 did not lead to a loss in activity is astonishing because many other genes in this region contain &s-acting DNA elements that) stimulate transcription (for reviews, see Serfling et al., 1985; Briggs et al.. 1986). However, using the mouse AFP gene a short promoter has been identified that, is sufficient to confer correct and efficient transcription in an in&ro system as well as in transient transfections of cell cultures (Scott & Tilghman, 1983). Therefore, in the Xenopus albumin genes, as well as the mouse AFP gene, the TATA box seems to be sufficient for conferring constitutive expression. This result is in agreement with the sequence data where no other known conserved &acting element,, except the TATA box, can be found. This is in contrast to the mammalian albumin genes where a CCAAT box is present (Heard et al., 1987). Consequently the promoter structure of the Xenopus albumin genes is more homologous to one of the mammalian AFP genes. The authors are very grateful to F. May and I{. Westlry. who provided the albumin gmornic~ c*lones, and t’o (‘. ,Jonat for solving the problems inherent to work was supported by t’he Deutschr Forschungsgemeinschaft (Rp 5/l 1).
computer usage. This
References Rabiss, L. E., Bennett, A., Friedman, ,J. M. & Darneli, J. E. (1986). Proc. Nat. Acad. Sci., U.S. A. 83, 65046508. Bisbee, C. A., Baker, M. A., Wilson, A. C., Hadji-Azami, I. & Fischberg, M. (1977). Science, 195, 785-787. Bradshaw, R. A. & Peters, T., Jr (1969). J. Riol. Ghem. 244, 5582-5589. Rriggs, M., Kadonaga, J.. Bell, S. & Tjian, R. (1986). Science, 234, 47-52. Chiu, J. F.. Massari, R. J., Schwartz, C. E., Meisler. N. T. & Thanassi, J. W. (1981). Nucl. Acids Rea. 9, 6917 6934. Dente, L.. Cesareni, G. & Cortese, R. (1983). Nucl. Acids Res. 11. 1645-1655. Dugaiczyk, A., Law, S. W. & Dennison, 0. E. (1982). Proc. Nat. Acad. Sk., ZJ.S.A. 79, 71-75. Felber. Il. K., Gerber-Huber, S., Meier, C., May, F. E. IS., Westley, B., Weber, R. & Ryffel, G. IT. (1981). ,Vucl. Acids Res. 9, 24552474. Gerber-Huber. S., May, F. B. E., Westley, H. R., Felbrr. R. K., Hosbach, H. A.. Andres. A.-C. & Ryffel, G. IT. (1983). Cell, 33, 43-51. Gorin, M. B., Cooper, D. L., Eiferman, F., Van der Rijn I’. & Tilghman. S. M. (1981). .J. Riol. Chem. 256. 195441959. Gorman, C., Moffat, I,. & Howard, H. (1982). Mol. f’rll. Aiol. 2, 104441051. Graves, J., Johnson, I’. F. & McKnight, S. L. (1986). Cell, 44, 565576. Hache, R. J. G., Wiskocil, R., Vasa, M., Roy, R. N., Lau, P. C. K. & Deeley. R. G. (1983). J. Riol. Chem. 258, 4556-4564. Heard, .J. M., Ott, M.-O., Herbomel, P., Mottura-Rallier. A.. Weiss, M. C. 8r Yaniv. M. (1987). Mol. Cell. Riol. 7 . d“4% 243-c.
Xenopus
Albumin
Jackson. (‘. 1,. & Shapiro, D.
Genes
93
Peters, T. (1977). Clin. Chem. 23. 5- 12. Reeves, R. (1984). B&him. Biophys. ilcta, 782, 343~-393. Riegel, A. T., Martin, M. B. & Schoenberg, I>. R. (1986). Mol. Cell. Endocrinol.
(‘hem,. 260, 5055-5060.
Sanger. F.. Micklen,
8. & Coulson. A. R. (1977). I’roc.
Nat. Acad. Sci., i’.S.A.
(lhwm. 256, 1!+60- 1967.
Klein-Hitpass. I,.. Schorpp, M.. Wagner, LT. & Ryffel, G. (1986). (‘rll, 46. 1053-1061. Krrssmann. A. & Birnstiel, M. L. (1980). In Transfer of (‘rll (‘onstiturnts into Eukaryotic Cells (Cellis, I. E., Grarsmann . :\. & Loyt,er, A.. eds), ,VATO advanced .sl udy iflSfitUtPS sfuies. pp. 383-407. Plenum Press. Xrw \‘ork. I ,aw. S. \V. & I)ugaiczyk. A. (1981). .Vatwp (London), 291. 201 ~205. Lawn. R. 11.. Ad(slman. J., Bock, 8. C., Franke. A. E., Hourk. (‘. M.. Najarian. R. C., Seeburg, I’. H. & LVion. li. 1,. (1981). Nucl. Acids Res. 9, 6103-6114. Maniatis, ‘I’.. Fritsc*h. E. & Sambrook, J. (1982). Molecular (‘loniny: A Laboratory Manual, Cold Spring Harbor Laborator), Press. Cold Spring Harbor, NY. Maxam. A. & (Gilbert. IV’. (1980). Methods Enzymol. 65, 4!,9 -560.
May. F. E. IS.. Weber, R. Hr Wrstley, H. R. (1982a). &cl. ,-Icids KP.v. 10. 2791-2807. May. F. E. B.. Ryffrl. 0. I‘., Weber, R. & Westley, B. R. ( 19820). ,1. Biol. (‘hem. 257. 13919--13923. May. F. E. I<.. n’rxtley. B. R.. Wyler. T. & Weber. R. (1983). J. Nol. Rid. 168, 229-247. McKnight. S. & Kingsbury. R. (1982). Science, 217. 3163’4. Morinaga. T., Sakai, M.. Wrgmann, T. G. & Tamaoki, T. (In%!). I’roc. ,Vat. Acad. Sci.. l’.A.A. 80, 4604-4608. Bahon. .J. I... VcLnetianer. A. & Sala-Trespat, J. M. (l!K). /‘r/Jr. ,I’&. .4cad. Sri.. f:.S.A. 84. 2135-2139.
Edited
44, 201-209.
Ryffel, G. IJ. (1976). Eur. J. B&hem. 62. 41 ‘i-423. Ryffel, G. C., Muellener. D. B.. Gerber-Huber. S.. Wyler. T. & Wahli. W. (1983). Nucl. ilcids Hrs. 11. 7707716. Sakai, M.. Morinaga, T., Crano. Y.. Watanabe. K., Wegmann, T. G. & Tamaoki. T. (198.5). .J. Biol.
Sargent, T. D., Jagodzinski, (1981).
Mol. Cell. Biol.
74. 5463-5467.
L. I,.. Yang. M. I% Konnrr. J. 1, 871-88X Dissertat,ion. l.nivrrsity of
Schorpp. M. (1987). Karlsruhr, F.R.G. Scot’t, R. W. & Tilghman, S. M. (I 983). .lfol. (‘~11. Rio/. 3. 1295p 1309. Serfling, E.. ,Jasin, M. & Schaffnrr. FV. (19%). ‘I’wnds Oenut. 1, 224--N). Southern, P. (1975). J. idol. Biol. 98, 503GSli. Tamaoki. T. & Fausto. K. (1984). In Recombinant DSA and (‘~11 Proliferation (Stein. (:. & Stein.
by P. Chambon