A combination of metabolome and transcriptome analyses reveals new targets of the Corynebacterium glutamicum nitrogen regulator AmtR

Journal of Biotechnology 140 (2009) 68–74

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

A combination of metabolome and transcriptome analyses reveals new targets of the Corynebacterium glutamicum nitrogen regulator AmtR Sebastian Buchinger a,1 , Julia Strösser a,1 , Nadine Rehm b , Eva Hänßler b , Stephan Hans c , Brigitte Bathe c , Dietmar Schomburg a,d , Reinhard Krämer a , Andreas Burkovski b,∗ a

Institut für Biochemie, Universität zu Köln, Cologne, Germany Lehrstuhl für Mikrobiologie, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany Evonik Degussa GmbH, Halle-Künsebeck, Germany d Institut für Biochemie und Biotechnologie, Abt. Bioinformatik und Biochemie, Biozentrum der Technischen Universität Braunschweig, Braunschweig, Germany b c

a r t i c l e

i n f o

Article history: Received 9 July 2008 Received in revised form 30 September 2008 Accepted 21 October 2008 Keywords: AmtR GC–MS Metabolome analysis Nitrogen control Transcriptomics

a b s t r a c t The effects of a deletion of the amtR gene, encoding the master regulator of nitrogen control in Corynebacterium glutamicum, were investigated by metabolome and transcriptome analyses. Compared to the wild type, different metabolite patterns were observed in respect to glycolysis, pentose phosphate pathway, citric acid cycle, and most amino acid pools. Not all of these alterations could be attributed to changes at the level of mRNA and must be caused by posttranscriptional regulatory processes. However, subsequently carried out transcriptome analyses, which were confirmed by gel retardation experiments, revealed two new targets of AmtR, the dapD gene, encoding succinylase involved in m-diaminopimelate synthesis, and the mez gene, coding for malic enzyme. The regulation of dapD connects the AmtR-dependent nitrogen control with l-lysine biosynthesis, the regulation of mez with carbon metabolism. An increased l-glutamine pool in the amtR mutant compared to the wild type was correlated with deregulated expression of the AmtRregulated glnA gene and an increased glutamine synthetase activity. The glutamate pool was decreased in the mutant and also glutamate excretion was impaired. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Corynebacterium glutamicum was isolated in a screening program for l-glutamate-producing bacteria (Udaka, 1960, 2008) and subsequently used for the industrial production of amino acids. Today, large amounts of l-glutamate (more than 1,500,000 tons per year) and l-lysine (more than 700,000 tons per year) are produced by use of C. glutamicum strains, in addition to smaller amounts of l-alanine, l-isoleucine, and l-proline and in addition to different nucleotides (Takors et al., 2007). Due to the industrial importance of C. glutamicum, the genome sequence of this bacterium was determined and published independently by different industrysupported groups (Ikeda and Nakagawa, 2003; Kalinowski et al., 2003). Based on these data, the generation of DNA microarrays for global transcriptome analyses became possible (Wendisch, 2003; Hüser et al., 2003). In parallel, other global analysis techniques

∗ Corresponding author at: Lehrstuhl für Mikrobiologie, Friedrich-AlexanderUniversität Erlangen-Nürnberg, Staudtstr. 5, 91058 Erlangen, Germany. Tel.: +49 9131 85 28086; fax: +49 9131 85 28082. E-mail address: [email protected] (A. Burkovski). 1 These authors contributed equally to this manuscript. 0168-1656/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2008.10.009

like proteome (Schaffer and Burkovski, 2005; Burkovski, 2006) and metabolome (Strelkov et al., 2004) analyses were established for C. glutamicum. We are interested in nitrogen metabolism and nitrogen regulation in corynebacteria with a focus on C. glutamicum (for recent reviews, see Burkovski, 2005, 2007; Hänßler and Burkovski, 2008). In C. glutamicum, expression of genes in response to nitrogen limitation is governed by the TetR-type regulator AmtR (Jakoby et al., 2000), which blocks transcription of various genes during growth in nitrogen-rich medium. The AmtR regulon was characterized by a combination of bioinformatics and molecular biology approaches (Beckers et al., 2005). At least 33 genes are directly controlled by the AmtR repressor. These genes encode transporters and enzymes for ammonium assimilation (amtA, amtB, glnA, gltBD), creatinine (codA, crnT) and urea metabolism (urtABCDE, ureABCEFGD), a number of biochemically uncharacterized enzymes and transport systems as well as signal transduction proteins (glnD, glnK). An aim of this study was to provide first insights into the interplay of transcriptome and metabolome profiles using the C. glutamicum nitrogen control network as a model. For this purpose, the well-balanced nitrogen metabolism of the wild type was disturbed by deregulation of nitrogen-related transcriptional control due to an amtR deletion.

S. Buchinger et al. / Journal of Biotechnology 140 (2009) 68–74

2. Materials and methods

69

2.4. Glutamine synthetase and glutamate dehydrogenase activity measurements

2.1. Bacterial strains and growth conditions C. glutamicum wild type ATCC 13032 (Abe et al., 1967) and amtR deletion mutant MJ6-18 (Jakoby et al., 2000) were grown at 30 ◦ C in MOPS-buffered minimal medium with glucose as carbon source as described (Beckers et al., 2005).

Glutamine synthetase (GS) activity was determined according to the protocol of Shapiro and Stadtman (1970), glutamate dehydrogenase (GDH) activity as described by Meers et al. (1970). Cell extracts were prepared using the FastPrep FP120 instrument (QBIOgene, Heidelberg) and glass beads as described above. Protein concentrations of cell extracts were determined using a Bradford assay (BioRad, Munich).

2.2. RNA preparation and DNA microarrays analyses C. glutamicum RNA was prepared from 0.5 ml culture samples using the NucleoSpin RNA II kit (Macherey-Nagel, Düren). The cells were suspended in 700 ␮l RA1 buffer and immediately disrupted using glass beads and a Q-BIOgene FastPrep FP120 instrument (QBIOgene, Heidelberg). Disruption was performed by two 30 s cycles at a speed of 6.5 m s−1 . After the cell debris was separated, the RNA was isolated following the supplier’s recommendations. Absence of DNA contaminations was tested by PCR. If necessary, a second DNase digestion was performed to completely remove the chromosomal DNA. RNA samples were stored at −80 ◦ C. For DNA microarray analyses cDNA synthesis, fragmentation, and biotin labelling was carried out as described for samples from prokaryotes in the Affymetrix technical support manual [http://www.affymetrix.com/support/technical/manual/ expression manual.affx]. Labeled cDNA samples were hybridized to Affymetrix GeneChip Corynea520112F Genome Arrays (customspecific design). This array consists of 3571 probe sets which can be divided in genes and hypothetical ORFs (3221), intergenic probe sets (305) and control probe sets (45). Hybridized arrays were stained with streptavidin–phycoerythrin using the Affymetrix Fluidic station and scanned. Two biological and two technical replicates were performed for the analysis of ATCC 13032 and MJ6-18. The experiment was designed to minimize both falsepositive and false-negative results for expressed genes. Statistical expression analysis was performed with Genedata Expressionist 3.1 software on the probe-level data from Affymetrix’s CEL files condensed with the MAS 5.0 algorithm. Data quality pValue threshold was set to 0.04. To test for significant differences in expression between the strains, one-way analysis of variance (ANOVA) was performed at a significance level of 0.001; thus, of every thousand genes tested, only one false positive would be expected.

2.5. Metabolome analysis by gas chromatography/mass spectrometry Sample preparation and mass spectrometry was carried out using the protocol described by Strelkov et al. (2004) with slight modifications. In short, approximately 5 × 1010 cells were harvested at the exponential growth phase. Samples were centrifuged (4500 × g, 3 min, 4 ◦ C) and cells were washed with 20 ml 0.9% NaCl at 4 ◦ C. Intracellular metabolites were extracted by ultrasonification of the harvested cells for 15 min at 70 ◦ C in 1.5 ml methanol (containing 8 mg ml−1 ribitol as internal standard). Samples were chilled on ice for 2 min, 1.5 ml of water was added and the samples were mixed thoroughly. Subsequently, 1 ml of chloroform was added and samples were mixed again in order to remove lipophilic compounds from the polar phase. Finally, phases were separated by centrifugation 5 min at 3900 × g and 1 ml of the polar methanol/water phase was transferred into a new 2 ml sample tube and dried under vacuum. For derivatization dried samples were resolved in 20 ␮l pyridine containing 20 mg ml−1 methoxyamine and incubated for 90 min at 30 ◦ C under agitation. Subsequently, 32 ␮l N-methyl-N-trimethylsilyltrifluoroacetamide (MSTFA) were added, followed by incubation for 30 min at 37 ◦ C and 2 h at 25 ◦ C. Four microliters of a mixture of eight different alkanes (C10 , C12 , C15 , C19 , C22 , C28 , C32 , C36 , 0.2% in cyclohexane each) was added for the calibration of retention indices according to van den Dool and Kratz (1963). Two microliters of the derivatized samples were injected in a Finnigan Trace gas chromatograph (ThermoFinnigan, San Jose, USA) equipped with a DB-5MS column (J&W Scientific, Folsom, USA). Eluted compounds were analysed with a Trace mass spectrometer (ThermoFinnigan, San Jose, USA) after electron impact ionization. Parameters for sample injection, gas chromatography and mass spectrometry were set as described previously (Strelkov et al., 2004). 2.6. Determination of intracellular glutamate concentration

2.3. Gel retardation assays To investigate AmtR binding gel-shift assays were carried out as described recently (Beckers et al., 2005). For the upstream region of the dapD and mez gene PCR-generated DNA fragment spanning the corresponding putative AmtR binding sites were labeled with digoxigenin using the DIG Oligonucleotide 3 -End Labeling Kit, 2nd Generation (Roche, Mannheim). The labeled DNA was incubated for 20 min at room temperature with different amounts of purified AmtR protein. DNA–protein complexes were separated from free DNA on a non-denaturing 6% polyacrylamide-TBE gel by electrophoresis at 20 mA. The DNA was blotted onto a positively charged nylon membrane (Roche, Mannheim) and the digoxigeninlabeled DNA was detected using X-ray films. Competitive gel retardation assays were performed according to the protocol described above. To the labeled DNA fragments of the mez and dapD promoter regions, unlabeled, overlapping 50 bp oligonucleotides were added in 1900-fold excess. For sequence information of unlabeled DNA fragments see Table 1.

Intracellular glutamate was quantified using a l-glutamate determination kit as described by the supplier (r-biopharm, Mannheim). For this purpose cells were grown as described above. Two milliliters of cell culture was harvested at the exponential growth phase and immediately mixed with 4 ml 80% (v/v) ethanol previously heated to 80 ◦ C. After incubation at 80 ◦ C for 30 min, samples were centrifuged, again mixed with ethanol and incubated for 1 h at 80 ◦ C. Ethanolic supernatants containing the extracted metabolites were merged and dried under vacuum (speedvac concentrator, Eppendorf, Hamburg). Dried samples were resolved in water and directly applied for determination of glutamate. Intracellular concentrations were calculated as described (Botzenhardt et al., 2004). 2.7. Glutamate excretion Glutamate excretion was induced using Tween 60 as described previously (Nampoothiri et al., 2002). Cells were cultured until the

70

S. Buchinger et al. / Journal of Biotechnology 140 (2009) 68–74

Table 1 Oligonucleotides used for gel retardation assays. Sequences are given in 5 → 3 direction, putative AmtR binding sites are shown in bold. mez fwd mez rev Mez1 fwd Mez1 rev Mez2 fwd Mez2 rev Mez3 fwd Mez3 rev Mez4 fwd Mez4 rev Mez5 fwd Mez5 rev Mez6 fwd Mez6 rev Mez7 fwd Mez7 rev Mez8 fwd Mez8 rev Mez9 fwd Mez9 rev Mez10 fwd Mez10 rev Mez11 fwd Mez11 rev Mez12 fwd Mez12 rev dapD fwd dapD rev dapD1 fwd dapD1 rev dapD2 fwd dapD2 rev dapD3 fwd dapD3 rev dapD4 fwd dapD4 rev dapD5 fwd dapD5 rev dapD6 fwd dapD6 rev dapD7 fwd dapD7 rev dapD8 fwd dapD8 rev

early exponential growth phase (OD600 3–4) and 20% Tween 60 was added to a final concentration of 1.5%. Samples were taken at different time points and centrifuged in order to remove cells from the supernatants. The supernatants were then subjected to an enzymatic glutamate quantification as described above. 3. Results 3.1. Metabolome analyses Global metabolomic alterations caused by an amtR deletion were studied by GC–MS (Strelkov et al., 2004; Börner et al., 2007). In this study, major changes of intermediates of glycolysis, pentose phosphate pathway, TCA cycle, and amino acids pools were detected (Fig. 1). The changes were often clustered; i.e. metabolites of one part of a distinct pathway were altered in the mutant in the same way. Changes of all metabolites of a single pathway were never observed. Compared to the wild type metabolites of the preparatory part of glycolysis, i.e. glucose-6-phosphate, fructose-6-phosphate, and fructose-1,6-bisphosphate pools were strongly increased in MJ6-18, while the concentrations of metabolites in the energy-delivering part of glycolysis, i.e. phosphoenol pyruvate and pyruvate were decreased. For pentose phosphate pathway metabolites xylulose5-phosphate, ribulose-5-phosphate, and ribose-5-phosphate an

CCGCCCGCTACTGAAGTAG ACGCTGCAGGTCGATGGTC CCGCCCGCTACTGAAGTAGCAGCCCAAATTCAGCCCACTGAATCAACCCC GGGGTTGATTCAGTGGGCTGAATTTGGGCTGCTACTTCAGTAGCGGGCGG AAATTCAGCCCACTGAATCAACCCCAAAACCACCCAAAAGTCACACTTAG CTAAGTGTGACTTTTGGGTGGTTTTGGGGTTGATTCAGTGGGCTGAATTT AAAACCACCCAAAAGTCACACTTAGCAAACAATTAAATTCATCACAAACC GGTTTGTGATGAATTTAATTGTTTGCTAAGTGTGACTTTTGGGTGGTTTT CAAACAATTAAATTCATCACAAACCACCCCTGTACAAAATTAGCAATAAA TTTATTGCTAATTTTGTACAGGGGTGGTTTGTGATGAATTTAATTGTTTG ACCCCTGTACAAAATTAGCAATAAAGGTCAGGGGTGTTTTGCAAATGTTC GAACATTTGCAAAACACCCCTGACCTTTATTGCTAATTTTGTACAGGGGT GGTCAGGGGTGTTTTGCAAATGTTCACATTGCGAAATTTTTGTTGAGCTA TAGCTCAACAAAAATTTCGCAATGTGAACATTTGCAAAACACCCCTGACC ACATTGCGAAATTTTTGTTGAGCTACAGATTTAGCTAGTGTTTTTGTTCC GGAACAAAAACACTAGCTAAATCTGTAGCTCAACAAAAATTTCGCAATGT CAGATTTAGCTAGTGTTTTTGTTCCAGAACCCTAAATGAGGTTCTACCCT AGGGTAGAACCTCATTTAGGGTTCTGGAACAAAAACACTAGCTAAATCTG AGAACCCTAAATGAGGTTCTACCCTTAACAGAGCTTCCCGCAAAAACACC GGTGTTTTTGCGGGAAGCTCTGTTAAGGGTAGAACCTCATTTAGGGTTCT TAACAGAGCTTCCCGCAAAAACACCGATTAACAAGGCTAAATGATATGAC GTCATATCATTTAGCCTTGTTAATCGGTGTTTTTGCGGGAAGCTCTGTTA GATTAACAAGGCTAAATGATATGACCATCGACCTGCAGCGTTCCACCCAA TTGGGTGGAACGCTGCAGGTCGATGGTCATATCATTTAGCCTTGTTAATC CATCGACCTGCAGCGTTCCACCCAAAACCTCACCCATGAGGAAATCTTCG CGAAGATTTCCTCATGGGTGAGGTTTTGGGTGGAACGCTGCAGGTCGATG TCCTCACCTTGGTTTTGTTGG AGCAGTAGTCATGACGTCCAG TCCTCACCTTGGTTTTGTTGGCAGGACTCGTTGCTCTCATGCTCGGCGAC GTCGCCGAGCATGAGAGCAACGAGTCCTGCCAACAAAACCAAGGTGAGGA ACTCGTTGCTCTCATGCTCGGCGACGCAGCCTCCCGCAGCCAGGTTTACT AGTAAACCTGGCTGCGGGAGGCTGCGTCGCCGAGCATGAGAGCAACGAGT GCAGCCTCCCGCAGCCAGGTTTACTCAGTGGCAATTGTGTACGGATTCTT AAGAATCCGTACACAATTGCCACTGAGTAAACCTGGCTGCGGGAGGCTGC CAGTGGCAATTGTGTACGGATTCTTGGTTCTTTTGTCCTTCGTCACAGTT AACTGTGACGAAGGACAAAAGAACCAAGAATCCGTACACAATTGCCACTG GGTTCTTTTGTCCTTCGTCACAGTTAACAGCCCATTGCGCGGAGGTCGCA TGCGACCTCCGCGCAATGGGCTGTTAACTGTGACGAAGGACAAAAGAACC AACAGCCCATTGCGCGGAGGTCGCACCCCTTCCGACTTGAACTGATAGGC GCCTATCAGTTCAAGTCGGAAGGGGTGCGACCTCCGCGCAATGGGCTGTT CCCCTTCCGACTTGAACTGATAGGCCGATAGAAATTATTCTGGACGTCAT TCTATCG ATGACGTCCAGAATAATTTCTATCGGCCTATCAGTTCAAGTCGGAAGGGG CGATAGAAATTATTCTGGACGTCATGACTACTGCTTCCGCAACCGGAATT AATTCCGGTTGCGGAAGCAGTAGTCATGACGTCCAGAATAATT

increased signal was observed for MJ6-18. In contrast, TCA cycle metabolites succinate, fumarate, and malate showed a lower abundance in the mutant compared to the wild type. Furthermore, different amino acids and closely related metabolites were influenced by the deletion of amtR. Glutamate and the aspartate-derived metabolites ␤-alanine, homoserine, methionine, and isoleucine showed the higher pools in the wild type compared to MJ6-18, while lysine and glutamine concentrations were strongly increased in the mutant cells. The intracellular l-glutamate pools were measured enzymatically to verify the GC–MS data obtained by an independent method and to get quantitative results. A concentration of 222 ± 16 mM of lglutamate was observed in the wild type, which matches perfectly with earlier published results (Krämer and Lambert, 1990). In amtR deletion strain MJ6-18 l-glutamate concentration was decreased to 174 ± 11 mM. These results confirm the qualitative data obtained by GC–MS. 3.2. Effect of amtR deletion on transcriptome patterns In order to find out, if the observed changes in metabolite concentrations can be correlated with alterations in gene expression, transcriptome profiles of wild type and amtR deletion strain MJ618 were compared using DNA microarrays. For this purpose, newly designed oligonucleotide chips were applied in this study, in con-

S. Buchinger et al. / Journal of Biotechnology 140 (2009) 68–74

71

Fig. 1. Alterations of metabolites. Metabolome analyses of wild type (white) and amtR deletion mutant MJ6-18 (black) grown in minimal medium. Columns show relative amounts of the indicated substances determined by GC–MS. Experiments were carried out in triplicate (independent biological replicates).

trast to the DNA fragments-based microarrays used previously. In general, altered transcript level of the same genes were observed as in a recently carried out study (Beckers et al., 2005), however, the new data revealed a much higher dynamic range (Table 2). As expected for strain MJ6-18 (amtR) genes which are part of the AmtR regulon were fully transcribed although cells grew in the presence of high ammonium and urea concentrations. Only a few members of the regulon were missing, namely amtA, gluB, and the urtBDE genes. Due to a very low transcript level, these genes did not meet the strict threshold level applied here (see Section 2). However, they were represented by other members of respective operons. Interestingly, a polar effect on expression of the genes for the amtB–glnK–glnD operon was observed in this study. amtB, the first gene of the operon, showed a seven-fold higher increase than glnD. This might hint to an instable mRNA or to weak termination signals between the different genes of the operon.

A small number of genes, namely dapD, ssuB, pyrG, mez, NCgl1564, and NCgl2523, showed an increased transcription in amtR deletion strain MJ6-18, although they were not characterized as members of the AmtR regulon before (Beckers et al., 2005). In the case of dapD, encoding succinylase involved in m-diaminopimelate synthesis, a typical AmtR binding motif, comprising the sequence 5 -ATAATTTCTATCGGCCTATCAGTTCAAG3 (highly conserved residues shown in bold) was detected. This motif was not found in a bioinformatic screening carried out earlier (Beckers et al., 2005), since it overlaps with the aroP gene sequence. The mez upstream sequence comprises a less conserved AmtR binding site with the sequence 5 -GTTGAGCTACAGATTTAGCTAGTGTT-3 . Gel retardation experiments revealed binding of AmtR to the respective promoter regions (Figs. 2 and 3). In case of dapD, an 0.2 kb upstream DNA fragment was applied in gel retardation exper-

72

S. Buchinger et al. / Journal of Biotechnology 140 (2009) 68–74

Table 2 Comparison of transcript levels of MJ6-18 (amtR) versus wild type. Two biological and two technical replicates were performed for the analysis of ATCC 13032 and MJ6-18. Statistical expression analysis was performed with Genedata Expressionist(R) 3.1 software on the probe-level data from Affymetrix’s CEL files condensed with the MAS 5.0 algorithm. Data quality pValue threshold was set to 0.04. To test for significant differences in expression between the strains, one-way analysis of variance (ANOVA) was performed at a significance level of 0.001. NCgl number

cg number

Gene

Factor MJ6-18 vs. wild type

Function (experimentally verified genetic organization)

Reference

NCgl0074 NCgl0075 NCgl0083 NCgl0084 NCgl0085 NCgl0086 NCgl0087 NCgl0088 NCgl0089 NCgl0181 NCgl0182 NCgl0784 NCgl0893 NCgl0895 NCgl1061 NCgl1099 NCgl1175 NCgl1362 NCgl1519 NCgl1520 NCgl1564 NCgl1875 NCgl1877 NCgl1878 NCgl1915 NCgl1916 NCgl1917 NCgl1918 NCgl1981

cg0103 cg0104 cg0113 cg0114 cg0115 cg0116 cg0117 cg0118 cg0119 cg0229 cg0230 cg0935 cg1061 cg1064 cg1256 cg1295 cg1379 cg1606 cg1783 cg1784 cg1832 cg2136 cg2138 cg2139 cg2181 cg2182 cg2183 cg2184 cg2258

crnT codA ureA ureB ureC ureE ureF ureG ureD gltB gltD

Creatinine transporter Creatinine deaminase Urease (ureABCEFGD)

Bendt et al. (2004) Bendt et al. (2004) Nolden et al. (2000)

Glutamate synthase gltBD

Beckers et al. (2001)

Hypothetical protein Urea uptake system (urtABCDE)

Beckers et al. (2004)

glnD

73.76 47.93 21.99 25.32 15.68 23.77 24.80 18.28 20.14 105.66 110.17 −2.74 299.31 438.37 2.87 39.85 3.25 2.79 114.43 93.84 6.04 2.71 2.75 2.78 8.05 8.06 9.01 7.87 18.59

NCgl1982

cg2260

glnK

36.95

NCgl1983 NCgl2133 NCgl2301 NCgl2523 NCgl2850 NCgl2904

cg2261 cg2429 cg2617 cg2894 cg3266 cg3335

amtB glnA vanB

137.81 4.03 3.98 3.52 −9.02 3.46

urtA urtC dapD ssuB pyrG soxA ocd gluA gluC gluD

mez

Tetrahydrodipicolinate succinylase Predicted hydrolase ABC transporter, ATPase component CTP synthase Putative sarcosine oxidase (amtA-ocd-soxA) Putative ornithine cyclodeaminase (amtA-ocd-soxA) ABC transporter, permease component Glutamate uptake system (gluABCD)

Wehrmann et al. (1998) Koch et al. (2005) Jakoby et al. (2000) Jakoby et al. (2000) Kronemeyer et al. (1995)

Putative oligopeptide uptake system

Adenylyltransferase (amtB-glnK-glnD) PII -type signal transduction protein (amtB-glnK-glnD) Ammonium uptake system (amtB-glnK-glnD) Glutamine synthetase Vanillate demethylase (vanABK) Putative TetR-type regulator Predicted transposase Malic enzyme

iments, which showed a decreased electrophoretic motility upon AmtR addition (Fig. 2A). Competitive gel retardation assays were used in order to arrow the exact AmtR binding site. For this purpose, unlabeled DNA fragments were added to the retardation assay. In fact, fragment 7, containing the AmtR binding motif identified bioinformaticallly, competed with the labeled DNA about AmtR binding (Fig. 2B, for schematic representation, see Fig. 2C). Similar experiments were carried out using an 0.3 kb mez upstream fragment. Also in the case, the putative AmtR binding site could be verified (Fig. 3A–C).

Jakoby et al. (1999, 2000), Nolden et al. (2001b), Strösser et al. (2004) Jakoby et al. (1999, 2000), Nolden et al. (2001b) Jakoby et al. (1999, 2000) Jakoby et al. (1997) Merkens et al. (2005)

Gourdon et al. (2000)

3.3. Changes in enzyme activity and content caused by amtR deletion The transcript level of glnA encoding the only active glutamine synthetase (GS) in C. glutamicum (Nolden et al., 2001a) was increased by a factor of 4 in strain MJ6-18 compared to the wild type and subsequently carried out Western blot experiments using GS-specific polyclonal antibodies revealed an increased amount of this protein in strain MJ6-18 (data not shown). GS activity of 0.21 ± 0.11 U (mg protein)−1 was determined for the wild type,

Fig. 2. Binding of AmtR to the dapD upstream region. Rising amounts of AmtR (0, 5, 50, and 100 ng) were added to the labeled promoter DNA of dapD (A). For competitive gel retardation assays 50 ng of purified AmtR protein was used and 50 bp DNA fragments were added (numbers indicate primer pairs as listed in Table 1). A schematic representation of DNA fragments used is shown in (C), the AmtR binding site is indicated by an asterisk.

S. Buchinger et al. / Journal of Biotechnology 140 (2009) 68–74

73

Fig. 3. Binding of AmtR to the mez promoter region. Rising amounts of AmtR (0, 5, 50, and 100 ng) were added to the labeled promoter DNA of mez (A). For competitive gel retardation assays, 50 ng of purified AmtR protein was used and 50 bp DNA fragments were added (numbers indicate primer pairs as listed in Table 1). A schematic representation of DNA fragments used is shown in (C), the AmtR binding site is indicated by an asterisk.

while activity reached 0.55 ± 0.10 U (mg protein)−1 in amtR deletion strain MJ6-18. Obviously, the increased transcription of glnA in MJ6-18 is not fully counteracted by inactivation of GS via adenylyltransferase on the level of activity. The resulting high GS activity is also most likely the reason for the increased glutamine pool in the mutant (see Fig. 1). Simultaneously, glutamate was decreased, which might also be caused by its consumption via GS, since glutamate dehydrogenase (GDH) expression and activity was not significantly decreased in amtR deletion strain MJ6-18 (1.55 ± 0.25 U vs. 1.95 ± 0.15 U).

tocatechuate catabolism (Beckers et al., 2005; Merkens et al., 2005). When the metabolome pattern of the wild type and strain MJ618 were compared, distinct differences in metabolites of glycolysis, pentose phosphate pathway, and citric acid cycle were detected, although the transcript levels of corresponding genes were not affected by the amtR mutation. Obviously, transcriptional control

3.4. Glutamate production The differences in transcript and metabolite patterns also had influences on glutamate production in C. glutamicum. When glutamate excretion of log-phase cells was induced by addition of 1.5% Tween 60, the specific glutamate production rate was decreased in the mutant by 15–20% over a time period of 24 h (Fig. 4), which is in accordance with the lowered glutamate pool of strain MJ6-18 compared to the wild type. 4. Discussion In this study, the effect of an amtR mutation on the metabolism of C. glutamicum was investigated by global analyses of metabolome and transcriptome profiles. As expected for strain MJ6-18 (amtR), the AmtR regulon was transcribed although cells grew in the presence of high ammonium and urea concentrations. In frame of the transcriptome analyses carried out, indications for new targets of AmtR were obtained, which could be verified subsequently. Newly detected members of the AmtR regulon are dapD, and mez. The dapD gene product succinylase is involved in the adaptation of lysine synthesis to low nitrogen supply (Wehrmann et al., 1998) and consequently, a regulation by AmtR seems to be of physiological relevance. In contrast, the reason for regulation of mez, coding for malic enzyme, which connects AmtR to carbon metabolism, is unclear. This is also the case for the indirect regulation of the vanABK operon for vanillate and pro-

Fig. 4. Glutamate production. Wild type ATCC 13032 (black squares) and amtR mutant MJ-6-18 (open triangles) were grown until the early exponential growth phase was reached. Glutamate excretion was induced (at time point 0) by addition of 1.5% Tween 60 and glutamate was determined in the supernatant.

74

S. Buchinger et al. / Journal of Biotechnology 140 (2009) 68–74

is important for the regulation of metabolism, but not sufficient to explain all alterations of metabolite pools observed. A similar observation was made in a study concerning the adaptation of B. subtilis to the availability of organic acids (Schilling et al., 2007). However, not only a distinct metabolite concentration might be crucial for the coordination and plasticity of metabolism, but also flux rates of different metabolic pathways. An important step for future approaches might be to combine transcriptome and metabolome data with flux and proteome analyses. A combination of transcriptome, metabolome, and fluxome data was already presented for a lysine-producing C. glutamicum strain (Krömer et al., 2004). Other studies integrating more global analysis techniques might follow, which might lead to a more holistic view on the cell. Acknowledgements This work was supported by the Bundesministerium für Bildung und Forschung (GenoMik+ initiative and Cologne University Bioinformatics Center) and the Deutsche Forschungsgemeinschaft (SFB 473, TP C12). References Abe, S., Takayama, K., Kinoshita, S., 1967. Taxonomical studies on glutamic acidproducing bacteria. J. Gen. Microbiol. 13, 279–301. Beckers, G., Nolden, L., Burkovski, A., 2001. Glutamate synthase of Corynebacterium glutamicum is not essential for glutamate synthesis and is regulated by the nitrogen status. Microbiology 147, 2961–2970. Beckers, G., Bendt, A.K., Krämer, R., Burkovski, A., 2004. Molecular identification of the urea uptake system and transcriptional analysis of urea transporterand urease-encoding genes in Corynebacterium glutamicum. J. Bacteriol. 186, 7645–7652. Beckers, G., Strösser, J., Hildebrandt, U., Kalinowski, J., Farwick, M., Krämer, R., Burkovski, A., 2005. Regulation of AmtR-controlled gene expression in Corynebacterium glutamicum: mechanism and characterization of the AmtR regulon. Mol. Microbiol. 58, 580–595. Bendt, A.K., Beckers, G., Silberbach, M., Wittmann, A., Burkovski, A., 2004. Utilization of creatinine as an alternative nitrogen source in Corynebacterium glutamicum. Arch. Microbiol. 181, 443–450. Börner, J., Buchinger, S., Schomburg, D., 2007. A high-throughput method for microbial metabolome analysis using gas chromatography/mass spectrometry. Anal. Biochem. 367, 143–151. Botzenhardt, J., Morbach, S., Krämer, R., 2004. Activity regulation of the betaine transporter BetP of Corynebacterium glutamicum in response to osmotic compensation. Biochim. Biophys. Acta 1667, 229–240. Burkovski, A., 2005. Nitrogen metabolism and its regulation. In: Bott, M., Eggeling, L. (Eds.), Handbook of Corynebacterium glutamicum. CRC Press LLC, Boca Raton, FL, pp. 333–349. Burkovski, A., 2006. Proteomics of Corynebacterium glutamicum: essential industrial bacterium. Methods Biochem. Anal. 49, 137–147. Burkovski, A., 2007. Nitrogen control in Corynebacterium glutamicum: proteins, mechanisms, signals. J. Microbiol. Biotechnol. 17, 187–194. Gourdon, P., Boucher, M.-F., Lindley, N., Guyonvarch, A., 2000. Cloning of the malic enzyme gene from Corynebacterium glutamicum and role of the enzyme in lactate metabolism. Appl. Environ. Microbiol. 66, 2981–2987. Hänßler, E., Burkovski, A., 2008. Molecular mechanisms of nitrogen control in corynebacteria. In: Burkovski, A. (Ed.), Corynebacteria: Genomics and Molecular Biology. Caister Academic Press, Norwich, pp. 183–201. Hüser, A., Becker, A., Brune, I., Dondrup, M., Kalinowski, J., Plassmeier, J., Pühler, A., Wiegräbe, I., Tauch, A., 2003. Development of a Corynebacterium glutamicum DNA microarray and validation by genome-wide expression profiling during growth with propionate as carbon source. J. Biotechnol. 106, 269– 286. Ikeda, M., Nakagawa, S., 2003. The Corynebacterium glutamicum genome: features and impacts on biotechnological processes. Appl. Microbiol. Biotechnol. 62, 99–109. Jakoby, M., Tesch, M., Sahm, H., Krämer, R., Burkovski, A., 1997. Isolation of the Corynebacterium glutamicum glnA gene encoding glutamine synthetase I. FEMS Microbiol. Lett. 154, 81–88.

Jakoby, M., Krämer, R., Burkovski, A., 1999. Nitrogen regulation in Corynebacterium glutamicum: isolation of genes involved and biochemical characterization of corresponding proteins. FEMS Microbiol. Lett. 173, 303–310. Jakoby, M., Nolden, L., Meier-Wagner, J., Krämer, R., Burkovski, A., 2000. AmtR, a global repressor in the nitrogen regulation system of Corynebacterium glutamicum. Mol. Microbiol. 37, 964–977. Kalinowski, J., Bathe, B., Bischoff, N., Bott, M., Burkovski, A., Dusch, N., Eggeling, L., Eikmanns, B.J., Gaigalat, L., Goesmann, A., Hartmann, M., Huthmacher, K., Krämer, R., Linke, B., McHardy, A.C., Meyer, F., Möckel, B., Pfefferle, W., Pühler, A., Rey, D., Rückert, C., Sahm, H., Wendisch, V.F., Wiegräbe, I., Tauch, A., 2003. The complete Corynebacterium glutamicum ATCC 13032 genome sequence and its impact on the production of l-aspartate-derived amino acids and vitamins. J. Biotechnol. 104, 5–25. Koch, D.J., Rückert, C., Rey, D.A., Mix, A., Pühler, A., Kalinowski, J., 2005. Role of the ssu and seu genes of Corynebacterium glutamicum ATCC 13032 in utilization of sulfonates and sulfonate esters as sulfur sources. Appl. Environ. Microbiol. 71, 6104–6114. Krämer, R., Lambert, C., 1990. Uptake of glutamate in Corynebacterium glutamicum. 2. Evidence for a primary active transport system. Eur. J. Biochem. 194, 937–944. Krömer, J.O., Sorgenfrei, O., Klopprogge, K., Heinzle, E., Wittmann, C., 2004. In-depth profiling of lysine-producing Corynebacterium glutamicum by combined analysis of the transcriptome, metabolome, and fluxome. J. Bacteriol. 186, 1769–1784. Kronemeyer, W., Peekhaus, N., Krämer, R., Eggeling, L., Sahm, H., 1995. Structure of the gluABCD cluster encoding the glutamate uptake system of Corynebacterium glutamicum. J. Bacteriol. 177, 1152–1158. Meers, J.L., Tempest, D.W., Brown, C.M., 1970. Glutamine(amide): 2-oxoglutarate amino transferase oxido-reductase (NADP); an enzyme involved in the synthesis of glutamate by some bacteria. J. Gen. Microbiol. 64, 187–194. Merkens, H., Beckers, G., Wirtz, A., Burkovski, A., 2005. Vanillate metabolism in Corynebacterium glutamicum. Curr. Microbiol. 51, 59–65. Nampoothiri, K.M., Hoischen, C., Bathe, B., Möckel, B., Pfefferle, W., Krumbach, K., Sahm, H., Eggeling, L., 2002. Expression of genes of lipid synthesis and altered lipid composition modulates l-glutamate efflux of Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 58, 89–96. Nolden, L., Beckers, G., Möckel, B., Pfefferle, W., Nampoothiri, K.M., Krämer, R., Burkovski, A., 2000. Urease of Corynebacterium glutamicum: organization of corresponding genes and investigation of activity. FEMS Microbiol. Lett. 189, 305–310. Nolden, L., Farwick, M., Krämer, R., Burkovski, A., 2001a. Glutamine synthetases in Corynebacterium glutamicum: transcriptional control and regulation of activity. FEMS Microbiol. Lett. 201, 91–98. Nolden, L., Ngouoto-Nkili, C.-E., Bendt, A.K., Krämer, R., Burkovski, A., 2001b. Sensing nitrogen limitation in Corynebacterium glutamicum: the role of glnK and glnD. Mol. Microbiol. 42, 1281–1295. Schaffer, S., Burkovski, A., 2005. Genome-based approaches: proteomics. In: Bott, M., Eggeling, L. (Eds.), Handbook of Corynebacterium glutamicum. CRC Press LLC, Boca Raton, FL, pp. 99–118. Schilling, O., Frick, O., Herzberg, C., Ehrenreich, A., Heinzle, E., Wittmann, C., Stülke, J., 2007. Transcriptional and metabolomic responses of Bacillus subtilis to the availability of organic acids: transcription regulation is important but not sufficient to account for metabolic adaptation. Appl. Environ. Microbiol. 73, 499–507. Shapiro, B.M., Stadtman, E.R., 1970. The regulation of glutamine synthesis in microorganisms. Annu. Rev. Microbiol. 24, 504–521. Strelkov, S., von Elstermann, M., Schomburg, D., 2004. Comprehensive analysis of metabolites in Corynebacterium glutamicum by gas chromatography/mass spectrometry. Biol. Chem. 385, 853–861. Strösser, J., Lüdke, A., Schaffer, S., Krämer, R., Burkovski, A., 2004. Regulation of GlnK activity: modification, membrane sequestration, and proteolysis as regulatory principles in the network of nitrogen control in Corynebacterium glutamicum. Mol. Microbiol. 54, 132–147. Takors, R., Bathe, B., Rieping, M., Hans, S., Kelle, R., Huthmacher, K., 2007. Systems biology for industrial strains and fermentation processes—example: amino acids. J. Biotechnol. 129, 181–190. Udaka, S., 1960. Screening method for microorganisms accumulating metabolites and its use in the isolation of Micrococcus glutamicus. J. Bacteriol. 79, 745–755. Udaka, S., 2008. The discovery of Corynebacterium glutamicum and birth of amino acid fermentation industry in Japan. In: Burkovski, A. (Ed.), Corynebacteria: Genomics and Molecular Biology. Caister Academic Press, Norwich, pp. 1–6. van den Dool, H., Kratz, P.D., 1963. A generalization of the retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. 11, 463–471. Wehrmann, A., Phillipp, B., Sahm, H., Eggeling, L., 1998. Different modes of diaminopimelate synthesis and their role in cell wall integrity: a study with Corynebacterium glutamicum. J. Bacteriol. 180, 182–184. Wendisch, V.F., 2003. Genome-wide expression analysis in Corynebacterium glutamicum using DNA microarrays. J. Biotechnol. 104, 273–285.