- Email: [email protected]
A cotton LIM domain-containing protein (GhWLIM5) is involved in bundling actin filaments
Plant Physiology and Biochemistry 66 (2013) 34e40
Contents lists available at SciVerse ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
A cotton LIM domain-containing protein (GhWLIM5) is involved in bundling actin filaments Yang Li 1, Jia Jiang 1, Lan Li, Xiu-Lan Wang, Na-Na Wang, Deng-Di Li, Xue-Bao Li* Hubei Key Laboratory of Genetic Regulation and Integrative Biology, College of Life Sciences, Central China Normal University, Wuhan 430079, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 September 2012 Accepted 18 January 2013 Available online 12 February 2013
LIM-domain proteins play important roles in cellular processes in eukaryotes. In this study, a LIM protein gene, GhWLIM5, was identified in cotton. Quantitative RT-PCR analysis showed that GhWLIM5 was expressed widely in different cotton tissues and had a peak in expression during fiber elongation. GFP fluorescence assay revealed that cotton cells expressing GhWLIM5:eGFP fusion gene displayed a network distribution of eGFP fluorescence, suggesting that GhWLIM5 protein is mainly localized to the cell cytoskeleton. When GhWLIM5:eGFP transformed cells were stained with rhodamine-phalloidin there was consistent overlap in eGFP and rhodamine-palloidin signals, demonstrating that GhWLIM5 protein is colocalized with the F-actin cytoskeleton. In addition, high-speed cosedimentation assay verified that GhWLIM5 directly bound actin filaments, while low cosedimentation assay and microscopic observation indicated that GhWLIM5 bundled F-actin in vitro. Increasing amounts of GhWLIM5 protein were able to protect F-actin from depolymerization in vitro in the presence of Lat B (an F-actin depolymerizer). Our results contribute to a better understanding of the biochemical role of GhWLIM5 in modulating the dynamic F-actin network in cotton. Ó 2013 Elsevier Masson SAS. All rights reserved.
Keywords: Cotton (Gossypium hirsutum) Actin filaments Bundling LIM domain-containing protein
1. Introduction Actin cytoskeleton, consisting of the filamentous actin (F-actin) that assembles from monomeric subunits (G-actin), plays a succession of vital roles (such as intracellular transport, signaling, cell growth and division, etc.) in all eukaryotic cells [1]. Actin cytoskeleton is a dynamic and intricate structure, and thereby a sophisticated regulatory system has developed to modulate this dynamic structure in cells. Actin-binding proteins (ABPs) functionally interact with monomeric and/or polymerized actin for regulating F-actin nucleation, polymerization, depolymerization, crosslinking, stabilization and capping [2]. ABPs are divided into several classes based on their biochemical functions, and each class includes several ABP families according to their domain composition and/or organization. The first large class comprises the proteins which adjust dynamics and attributes of actin subunits or filaments. For example, nucleation-promoting factors form a stable seed of actin subunits which initiates actin assembly. Arp2/3 complex activated by Rho GTPases and WASP proteins is competent for nucleating actin assembly from free or profilin-bound * Corresponding author. Tel./fax: þ86 27 67862443. E-mail address: [email protected] (X.-B. Li). 1 These authors contributed equally to this work. 0981-9428/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2013.01.018
monomeric actin [3,4]. Capping and/or severing factors are crucial for regulating the availability and quantity of F-actin ends for subunit addition or loss. The proteins of ADF/cofilin family are highly conserved actin-modulating proteins in eukaryotic cells [5]. These proteins interact with both polymerized actin and monomeric actin and sever F-actin into fragments [6]. Previous study revealed that overexpression of GhADF7, a member of cotton ADF/ cofilin family, altered the balance of actin depolymerization and polymerization, causing the defective cytokinesis and multinucleate formation in cells [7]. Dynamizing proteins (such as cofilin) function in facilitating the loss of subunits from the pointed end of F-actin and changing the conformation of F-actin [8]. Monomerbinding proteins control assembly and disassembly of F-actin by directly binding to G-actin for promoting or inhibiting the G-actin to be added to the ends of actin filaments. As the main monomer actin-binding protein, profilin plays critical roles in many cellular processes and is considered to be one of the most important modulators [9,10]. The second major class of actin-binding proteins contains the members that participate in building actin filaments into high-order structures as orthogonal networks or parallel arrays. For instance, Arabidopsis FORMIN14 (AFH14) regulates both microtubule and microfilament arrays [11]. AtFim1, belonging to fimbrin/plastin family, functions in cross-linking actin filaments of pollen in a calcium-independent manner in vivo and in vitro [12].
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
LIM proteins are named by the initials of the three firstdiscovered LIM homeodomain proteins (LIN11, ISL1, and MEC3) [13e15], and usually contain one or more LIM domains in their sequences. The LIM domain, with the consensus sequence [C-X2-CX16e23-H-X2-C]-X2-[C-X2-C-X16e21C-X2e3-(C/D/H)] which essentially comprises two zinc fingers linked together by a short twoamino acid spacer, functions as a proteineprotein interaction module [16]. Animal genomes encode numerous LIM domain-containing proteins (LIMs) that are diverse in structure and function [17]. In contrast, plants only contain a limited number of LIMs, a majority of which belongs to Cys-rich protein (CRP) LIM subfamily [18,19]. It has been reported that animal CRP1 and CRP2 directly bind F-actin in vitro [20,21]. Similarly, previous studies indicated that plant CRP LIM proteins (such as lily LlLIM1, tobacco WLIM1 and six Arabidopsis LIM proteins) function as ABPs in plant cells. LlLIM1 promotes the assembly of rigid F-actin bundles, controls actin dynamics and protects F-actin from depolymerization [22]. Tobacco WLIM1 and six Arabidopsis LIM proteins are vital to bundle actin filaments and protect the actin cytoskeleton from disassembly [23,24]. In addition, plant LIM proteins also play other roles in development. Tobacco NtLIM1, for example, is a key trans-acting factor regulating gene expression in phenylpropanoid biosynthesis [25]. Cotton fibers are single-cell trichomes (seed hairs) derived from epidermal cells of the ovules. The processes of fiber elongation and secondary wall synthesis are associated with active changes in the organization of F-actin and microtubule cytoskeleton [26e28]. During the stages from cell elongation to secondary wall formation, the cortical microtubules alter from transverse to oblique and helical orientations, and are coupled with directing the deposition of the secondary wall cellulose [27,29]. In line with the cytological observations, a number of genes have been found to be expressed specifically/preferentially in developing fibers. Recently, a study showed that overexpression of the actin monomer-binding profilin gene GhPFN2 in cotton promoted the progression of fiber developmental phases [30]. Although these studies revealed that the actin cytoskeleton plays an essential role in fiber development and is regulated by some ABPs, little is known in detail of how LIM protein modulates F-actin cytoskeleton during cell growth and/or fiber development in cotton. In this study, a gene, GhWLIM5, encoding a LIM domain-containing protein was identified in cotton. Transient expression studies in plant with GFP-tagged GhWLIM5 indicate that this protein is able to bind to the filamentous actin network. Furthermore, it has been shown to directly bundle actin filaments and protect F-actin from depolymerization in vitro and to be expressed during fiber elongation so may be an important player in regulating cell growth in cotton.
35
2. Results 2.1. Characterization of three fiber-expressed GhLIM genes To investigate the role of actin-binding proteins (ABPs) in regulating dynamics of actin cytoskeleton during fiber development, three genes (cDNA) (designated as GhWLIM2, GhWLIM5 and GhXLIM6, accession numbers in GenBank: JX290318, JX290321 and JX290322) encoding LIM domain-containing proteins were isolated from cotton fiber cDNA library. Both GhWLIM2 and GhWLIM5, like previously reported GhLIM1 [31], contain 570 bp of open reading frame (ORF) encoding LIM protein of 189 amino acids, while GhXLIM6 encodes a polypeptide with 196 amino acid residues. At nucleotide acid level, the three isolated GhLIM genes show relatively low homology. GhWLIM2 show relatively high identity (58%) with GhXLIM6, whereas GhWLIM2 and GhXLIM6 share relatively low similarity (41% and 28%, respectively) with GhWLIM5. In addition, GhWLIM5 show high identity (96%) with GhLIM1. At amino acid level, there is a high identity (88%) between GhWLIM2 and GhWLIM5, but both of them share relatively lower homology (less than 60%) with GhXLIM6. Moreover, each of the three GhLIM proteins has two LIM domains of around 52 amino acids separated by a more variable spacer region (Fig. 1). 2.2. Phylogenetic relationship of GhWLIM5 with other LIM proteins To determine divergence of the isolated GhWLIM5 protein with the other plant LIM proteins during evolution, the phylogenetic relationship of 19 LIM domain proteins was analyzed by MEGA3.1 program. Plant LIM proteins can be divided into seven subgroups: XLIM1, WLIM1, WLIM2, bLIM1, PLIM1, PLIM2 and PLIM2-like [32]. As shown in Fig. 2, the tree is divided into six distinct branches. Thereinto, GhLIM1, GhWLIM2 and GhWLIM5 form an independent branch which is positioned in the WLIM2 subgroup. Furthermore, GhLIM1 and GhWLIM5 form a distinct clade which is basal to GhWLIM2, implying that GhWLIM2 and GhWLIM5 have close evolutional relationship with GhLIM1. On the other hand, GhXLIM6 occupies a distinct clade in XLIM1 subgroup, indicating that GhXLIM6 diverged earlier from GhLIM1, GhWLIM2 and GhWLIM5 during evolution. 2.3. Expression profiling of GhWLIM5 gene Quantitative RT-PCR analysis revealed that GhWLIM5 displayed broad expression in different organs/tissues including roots, hypocotyls, cotyledons, leaves, petals, anthers, ovules and fibers. In
Fig. 1. Alignment and sequence comparison among GhLIM1, GhWLIM2, GhWLIM5 and GhXLIM6 proteins. Numbers on the right indicate the protein length in amino acids. LIM domains are indicated by the line above the alignments. The amino acid residues identical among the sequences are indicated in black. GhWLIM2, GhWLIM5 and GhXLIM6 are identified from this work, and GhLIM1 was selected from GenBank. The accession number of GhLIM1 sequence in GenBank is AAL38006.
36
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
via Agrobacterium-mediated transformation. Seven independent transformed cell lines (calli) were generated on the selective medium. Stable transformed cells expressing GhWLIM5:eGFP fusion proteins were examined with a Leica confocal laser scanning microscope (see Methods). The network distribution of eGFP fluorescence was clearly observed in the cotton cells harboring GhWLIM5:eGFP reporter construct (Fig. 4AeC), suggesting that GhWLIM5 protein is mainly localized on the cell cytoskeleton and nucleus. To further confirm our deduction, the transformed cells expressing GhWLIM5:eGFP protein were stained with actin-specific rhodamine-phalloidin. There was a consistent overlap in the fluorescent signals for GhWLIM5:eGFP and that for the actin cytoskeleton stained with rhodamine-phalloidin (Fig. 4DeF), demonstrating that GhWLIM5 protein is colocalized with filamentous actin. 2.5. GhWLIM5 protein directly interacts with F-actin
Fig. 2. Phylogenetic relationship of GhWLIM5 with other LIM proteins. GhWLIM2, GhWLIM5 and GhXLIM6 are identified from this work, and the others are selected from GenBank. The accession numbers of the protein sequences in GenBank are as follows: GhLIM1 (AAL38006), AtPLIM2 (AAC28544), AtPLIM2b (ABF83669), AtPLIM2c (AAY34164), AtWLIM1 (AAM62606), AtWLIM2 (AAB95275), AtWLIM2b (NP_191136), PtXLIM1a (ABK95336), PtXLIM1b (EEE83585), PtPLIM2a (EEE99098), PtPLIM2b (EEE81847), PtWLIM1a (EEE99002), PtWLIM1b (EEE81678), PtWLIM2a (EEE89506), PtWLIM2b (EEE01351), PtLIM1a (EEE96244), PtLIM1b (EEF05698), PtPLIM2c (EEE82853), PtPLIM2d (EEE79462).
elongating fibers, GhWLIM5 displayed relatively low levels at the early stage (3 days post anthesis, DPA), and reached its peak at 9 DPA. As fibers further developed, its expression was gradually decreased to relatively low level (Fig. 3), suggesting that it may play a role in cotton development, including fiber elongation. 2.4. Subcelluar localization of GhWLIM5 protein To investigate whether GhWLIM5 protein interacts with actin cytoskeleton in cotton cells, eGFP-tagged GhWLIM5 driven by cauliflower mosaic virus (CaMV) 35S promoter was introduced into cotton
His-tagged GhWLIM5 protein was expressed in Escherichia coli, and purified on a nickel-nitrilotriacetic acid agarose (Ni-NTA) matrix. High-speed cosedimentation assay indicated that GhWLIM5 proteins directly bound F-actin in vitro. Actin filaments (F-actin) were copolymerized with GhWLIM5 proteins and then centrifuged. The pellet and supernatant fractions were detected by SDS-PAGE. The experimental results revealed that GhWLIM5 proteins were mainly accumulated in the pellets when F-actin was present, but little GhWLIM5 protein was found in the pellets in the absence of Factin (Fig. 5). These results demonstrated that GhWLIM5 proteins could directly bind F-actin in vitro. 2.6. GhWLIM5 protein bundles actin filaments To determine whether GhWLIM5 function as an actin bundler, we employed the low-speed cosedimentation assay. Actin filaments were copolymerized with GhWLIM5 and centrifuged. The supernatant and pellet fractions were analyzed by SDS-PAGE. As shown in Fig. 6A, most F-actin remained in the supernatant in the absence of GhWLIM5 proteins and vice versa. On the contrary, the amount of F-actin in the pellets was gradually increased with increasing GhWLIM5 protein concentration, indicating that GhWLIM5 promotes F-actin bundling. As an alternative, the role of GhWLIM5 in bundling F-actin was directly visualized under confocal microscope. As shown in Fig. 6B, rhodamine-phalloidinlabeled actin filaments, as the negative control, were scattered individually in the absence of GhWLIM5 protein. After prepolymerized F-actin was incubated with GhWLIM5 proteins, however, high-ordered F-actin net-structure was observed when the reactive products were stained with rhodamine-phalloidin (Fig. 6C). These data demonstrated that GhWLIM5 proteins could bundle actin filaments. 2.7. GhWLIM5 stabilizes F-actin in vitro
Fig. 3. Quantitative RT-PCR analysis of GhWLIM5 expression in cotton tissues. Total RNA was isolated from cotton tissues: (1) roots; (2) hypocotyls; (3) cotyledons; (4) leaves; (5) petals; (6) anthers; (7) 9 DPA ovules; (8e14) 3, 6, 9, 12, 15, 18 and 21 DPA fibers, respectively. Relative values of GhWLIM5 expression in cotton are shown as a percentage of GhUBI1 expression activity. The experiments were repeated three times, and error bars represent standard deviation. DPA, day post anthesis.
The data on tobacco WLIM1 and lily LlLIM1 suggested that plant LIM proteins play a role in regulation of F-actin stabilization [22,23]. To investigate whether GhWLIM5 affects F-actin stability, we employed Lat B (latrunculin B) to depolymerize F-actin, using DMSO as a negative control. High-speed cosedimentation assay indicated that the most of actin was accumulated in the supernatant after 20 h treatment with Lat B (Fig. 7, lane 2), but F-actin in the control (DMSO) occurred in the pellet (Fig. 7, lane 1). On the other hand, when treated with Lat B, the amount of F-actin in the pellet increased with increasing amounts of GhWLIM5 (Fig. 7, lane 3e7), indicating that GhWLIM5 protein can protect F-actin against depolymerization by Lat B.
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
37
Fig. 4. Subcellular localization of GhWLIM5. (AeC) Localization of GhWLIM5:eGFP fusion proteins in cotton callus cells. (A) Bright-field micrograph of a cotton cell; (B) GFP signals in the same cell; (C) image B was merged with image A. (DeF) Staining assay of cotton callus cells with expressing GhWLIM5:eGFP fusion proteins. (D) GFP signals in the cotton cell; (E) actin cytoskeleton stained with rhodamine-phalloidin of the same cotton cell in image D; (F) image D was merged with image E. Bar ¼ 10 mm.
3. Discussion In eukaryotic cells, actin-binding proteins (ABPs) play important roles, ranging from changing the polymerization property and dynamics of actin subunits and filaments to establishing the actin network and bundles, in precisely modulating dynamic actin cytoskeleton [2,33e35]. The LIM domain is a conserved domain found in a variety of different proteins. Thus far, quite a few publications reported some LIM domain-containing proteins belong to
Fig. 5. High-speed cosedimentation assay of GhWLIM5 binding F-actin. GhWLIM5 (16.7 mM) and control BSA (2 mM) were respectively incubated with or without F-actin (10 mM), and centrifuged at 200,000 g for 1 h. Subsequently, the pellet (PEL) and supernatant (SUP) were analyzed by SDS-PAGE. GhWLIM5 bound to F-actin as indicated by their presence in the pellet after centrifugation. Control BSA did not cosedimentate with F-actin.
ABP family. In animals, LIM proteins differ in their functions and are grouped into four classes: LIM-hd, LMO, LIM-kinase and other LIM proteins [36]. Several LMO and LIM-hd proteins are localized in the cell nucleus, where they function as transcriptional factors of developmental genes [37,38], while other LIM proteins (such as CRP1, CRP2 and CRP3) are involved in bundling F-actin [20,21]. In plants, two LIM proteins, NtWLIM1 and LlLIM1, bind directly to actin filaments for stabilizing actin cytoskeleton [22,23]. Similarly, our data also demonstrated that cotton LIM5 protein, belonging to CRP-related family, functions in bundling and stabilizing F-actin. Recently, plant LIM proteins have been divided into 4 groups: aLIM1 which containing three subgroups (XLIM1, WLIM1 and PLIM1), bLIM1, gLIM2 and dLIM2 containing PLIM2 and PLIM2-like subgroups [32]. Previous studies reported that the LIM proteins in PLIM1, PLIM2 and PLIM2-like subgroups (including SF3, LILIM1, AtPLIM2a, AtPLIM2b and AtPLIM2c) are predominantly expressed in pollen [18,22,24]. However, the LIM proteins in WLIM1, WLIM2 and bLIM1 subgroups (such as cotton GhLIM1, sunflower WLIM1, tobacco WLIM1 and the remaining Arabidopsis LIMs) are expressed in a wide range of organs [19,23,24,31]. In addition, XLIM proteins were expressed in secondary xylem [32]. In this work, quantitative RT-PCR analysis revealed that GhWLIM5 gene was expressed widely in cotton tissues, although it displayed a relatively higher expression level in anthers and had a peak in expression during fiber elongation at 9 DPA. Microscopic observation indicated that eGFP-tagged GhWLIM5 protein localized to both cell nucleus and cytoplasm. Likewise, tobacco WLIM1 and six Arabidopsis LIMs were also shown to have dual localization [23,24], but the role of these LIMs in cell nucleus is not clear. A lot of studies on LIM domain-containing proteins in animals (such as CRPs) and in plants (such as tobacco WLIM1, LILIM1 and AtLIMs) revealed the roles of LIM proteins in binding to and bundling F-actin in cells [19,21e24]. On the other hand, it was reported that cotton fiber-preferential ACTIN1 functions in fiber elongation [28]. In this study, we demonstrated that GhWLIM5 was also expressed in elongating fibers, colocalized with actin cytoskeleton in cells, and directly bundled actin filaments. These results
38
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
Fig. 6. Analysis of GhWLIM5 bundling actin filaments. (A) Low-speed cosedimentation assay of GhWLIM5 and F-actin. 10 mM F-actin in the absence of GhWLIM5 or in the presence of different concentrations (0.5e16 mM) of GhWLIM5 were polymerized and centrifuged at 14,000 g. The supernatant (SUP) and pellet (PEL) were analyzed by SDS-PAGE. Actin filaments were accumulated in the sediment in the presence of GhWLIM5, but not in the absence of GhWLIM5. (B, C) Micrographs of actin bundles polymerized in the presence of GhWLIM5. The effect of GhWLIM5 on bundling actin filaments stained with rhodamine-phalloidin was directly visualized under fluorescence microscope. (B) Actin filaments polymerized in absence of GhWLIM5 as control; (C) high magnification of an F-actin bundling structure formed in presence of 16 mM GhWLIM5. Bar ¼ 15 mm.
suggested that GhWLIM5 may be involved in fiber elongation via modulating the dynamic F-actin network. According to the quantity of actin-binding domains, ABPs could be divided into two groups: (1) containing two discrete actinbinding domains within its sequence (such as fimbrin/plastin) [39], and (2) containing a single actin-binding domain and usually forming multimers (such as a-actinin) [40]. Cosedimentation assay and electron microscopy revealed that two LIM domains of tobacco WLIM1 individually function in bundling F-actin, indicating that each of the two LIM domains is independent [41]. Some animal
CRPs and plant LIM proteins may require dimer formation to start their actin-bundling activity as they only have a single actin binding site. For instance, MLP and hCRP have been shown to dimerize through their LIM domains [42,43]. Recently, further study revealed that tobacco WLIM1 protein containing two LIM domains also forms dimer/oligomer for its function [44]. However, yeast twohybrid assay revealed that GhWLIM5 protein could not interact with the other two GhLIM proteins. In brief, our data will contribute to the understanding of the biochemical role of GhWLIM5 in modulating and stabilizing the dynamic F-actin in cotton. 4. Materials and methods 4.1. Collection of plant materials Cotton (Gossypium hirsutum cv. Coker312) seeds were surface sterilized with 70% (v/v) ethanol for 1 min and 10% (v/v) H2O2 for 2 h, followed by washing with sterile water. The sterilized seeds were germinated on half-strength Murashige and Skoog (MS) medium (pH 5.8) under a 16 h light/8 h dark cycle at 28 C for 6 days. Roots, hypocotyls and cotyledons were collected from these seedlings. The other tissues (such as leaves, petals, anthers, ovules, and fibers) were derived from cotton plants grown in field.
Fig. 7. Assay of the effect of GhWLIM5 in stabilizing F-actin. F-actin was depolymerized by latrunculin B (Lat B) in the absence of GhWLIM5 or in the presence of different concentrations (2e32 mM) of GhWLIM5. The equal volume DMSO was used as control. The samples were centrifuged at 200,000 g for 1 h, and then the pellet (PEL) and supernatant (SUP) were analyzed by SDS-PAGE. With Lat B treatment, actin filaments were still accumulated in the sediment in the presence of GhWLIM5 proteins.
4.2. Sequence and phylogenetic analysis To identify the genes that are functionally expressed in cotton fibers, 4000 cDNA clones were randomly selected from cotton fiber cDNA library. Some cotton LIM cDNAs were identified from these
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
clones. The sequences of the isolated cotton LIM genes (cDNAs) and their deduced proteins were analyzed using DNAstar (DNAstar Inc). The GhLIM peptide sequences were aligned with ClustalW (http:// www.ebi.ac.uk/clustalw/), and phylogenetic analysis was performed to show the evolutionary relationship among GhLIM genes. A NeighboreJoining tree was generated by MEGA3.1 program. A bootstrap analysis with 1000 replicates was performed to assess the statistical reliability of the tree topology. 4.3. RT-PCR analysis Total RNA was isolated from cotton tissues. Expression of GhWLIM5 gene in cotton tissues was analyzed by real-time quantitative reverse transcriptase (RT)-PCR using the fluorescent intercalating dye SYBR-Green in a detection system (MJ Research, Opticon 2) by the method described earlier [28]. A cotton polyubiquitin gene (GhUBI1) was served as a standard control in RT-PCR. The gene-specific primers are as follows: GhWLIM5-P1, TCAAGGAGACGGGTAACTTCAAC; GhWLIM5-P2, GTTCCCCTCCCGAGCATAAATC. The experiments were repeated three times. 4.4. Subcellular localization and staining The coding sequence of eGFP (enhanced green fluorescent protein) gene was cloned into pBluescript II SKþ vector to form an intermediate construct pSK-eGFP. Subsequently, GhWLIM5 ORF (open reading frame, without the stop codon) was cloned into the pSK-eGFP vector at a position upstream of the eGFP gene. The constructed GhWLIM5:eGFP fusion gene was cloned into pBI121 vector, replacing the GUS gene. Cotton hypocotyl explants were transformed with the GhWLIM5:eGFP construct by Agrobacterium-mediated DNA transfer as described previously [45]. Stable transformed cells expressing GhWLIM5:eGFP were selected for detecting GFP fluorescence on a SP5 Meta confocal laser microscope (Leica, Germany) with a filter set of 488 nm for excitation and 506e538 nm for emission. SP5 software (Leica, Germany) was employed to record and process the digital images taken. Meanwhile, the GhWLIM5-eGFP transformed cells were stained with rhodamine-phalloidin, an F-actin-specific dye, using the method described previously [28]. The staining cells were observed on a SP5 Meta confocal laser microscope as described above. 4.5. High- and low-speed cosedimentation assays The coding sequence of GhWLIM5 was amplified by PCR, using gene-specific primers (GhWLIM5ExP1: GGGGGATCCATGTCATTTATTGGTACCCA; GhWLIM5ExP2: GGGTCTAGATCAAGCTTCAGGAACG GATG), and cloned into pET-28a vector. The 6 His-tagged GhWLIM5 was expressed in E. coli strain BL21 cells and purified by a Ni-NTA resin following a procedure described by the user manual. The purified proteins were respectively concentrated and buffer-exchanged (100 mM NaH2PO4 and 10 mM TriseHCl, pH 7.4) using 10 K molecular weight cutoff dialysis cassettes (Pierce). High- and low-speed cosedimentation assays were carried out using Actin Bing Protein Biochem Kit (Cytoskeleton). Rabbit muscle actin was diluted at 0.4 mg/ mL (10 mM) in General Actin Buffer (5 mM TriseHCl, pH 8.0 and 0.2 mM CaCl2). Polymerization was induced in actin polymerization buffer (5 mM TriseHCl, pH 8.0, 0.2 mM CaCl2, 0.2 mM ATP,1.0 mM DTT, and 2 mM MgCl2). Proteins were preclarified at 100,000 g prior to experiments. High-speed cosedimentation assay was performed to determine the F-actin-binding activity of GhWLIM5. In brief, GhWLIM5 were mixed with the preassembled F-actin, using BSA as control. The samples were incubated at 24 C for 30 min, and then centrifuged at 200,000 g for 1 h in an Optima TLX ultracentrifuge
39
(Beckman) at 4 C. After the supernatant was removed, pellets were resuspended by 30 ml Milli-Q water. Pellet and supernatant samples were analyzed by 12% SDS-PAGE and Coomassie Brilliant Blue R (SigmaeAldrich) staining. In low-speed cosedimentation assay, increasing amounts (0.5, 1, 2, 4, 8 and 16 mM) of GhWLIM5 were incubated with 10 mM preassembled F-actin for 30 min at 24 C, respectively, and then centrifuged at 14,000 g for 1 h. Pellet and supernatant samples were analyzed by SDS-PAGE as described above. Lat B (latrunculin B, an F-actin depolymerizer) was used to examine the effect of GhWLIM5 on stabilizing F-actin. In this highspeed cosedimentation assay, 4 mM actin was polymerized at 25 C for 1 h in the absence (control) and the presence of various amounts (2, 4, 8, 16 and 32 mM) of GhWLIM5, respectively, and then 100 mM Lat B was added into each sample, using DMSO as control. After 20 h of incubation at 25 C, the samples were centrifuged at high speed (200,000 g) at 4 C for 1 h, and analyzed by SDS-PAGE as described above. 4.6. Visualization of F-actin bundling under confocal microscope Preassembled actin alone or in presence of GhWLIM5 was reacted in a buffer consisting of 5 mM TriseHCl (pH 8.0), 0.2 mM CaCl2, 50 mM KCl, 2 mM MgCl2, 1 mM ATP and 0.5 mM DTT, and labeled with 4 mM rhodamine-phalloidin. Then, 1 ml of each sample was diluted and applied to a cover slip coated with poly-L-lysine (0.01%). Images were recorded with a SP5 Meta confocal laser microscope (Leica, Germany) using a pinhole set to produce optical sections about 2 mm thick. Acknowledgment This work was supported by National Natural Sciences Foundation of China (Grant No. 31070281, 31171174) and the project from the Ministry of Agriculture of China for transgenic research (Grant No. 2011ZX08009-003). References [1] B. Kost, N.H. Chua, The plant cytoskeleton: vacuoles and cell walls make the difference, Cell 108 (2002) 9e12. [2] S.J. Winder, K.R. Ayscough, Actin-binding proteins, J. Cell Sci. 118 (2005) 651e654. [3] M.D. Welch, The world according to Arp: regulation of actin nucleation by the Arp2/3 complex, Trends Cell Biol. 9 (1999) 423e427. [4] M.D. Welch, R.D. Mullins, Cellular control of actin nucleation, Annu. Rev. Cell Dev. Biol. 18 (2002) 247e288. [5] I. Mabuchi, An actin-depolymerizing protein (depactin) from starfish oocytes: properties and interaction with actin, J. Cell Biol. 97 (1983) 1612e1621. [6] H. Chen, B.W. Bernstein, J.R. Bamburg, Regulating actin filament dynamics in vivo, Trends Biochem. Sci. 25 (2000) 19e23. [7] X.B. Li, D. Xu, X.L. Wang, G.Q. Huang, J. Luo, D.D. Li, Z.T. Zhang, W.L. Xu, Three cotton genes preferentially expressed in flower tissues encode actindepolymerizing factors which are involved in F-actin dynamics in cells, J. Exp. Bot. 61 (2009) 41e53. [8] M. Van Troys, L. Huyck, S. Leyman, S. Dhaese, J. Vandekerkhove, C. Ampe, Ins and outs of ADF/cofilin activity and regulation, Eur. J. Cell Biol. 87 (2008) 649e667. [9] C.J. Staiger, B.C. Gibbon, D.R. Kovar, L.E. Zonia, Profilin and actindepolymerizing factor: modulators of actin organization in plants, Trends Plant Sci. 2 (1997) 275e281. [10] D.W. McCurdy, D.R. Kovar, C.J. Staiger, Actin and actin-biding proteins in higher plants, Protoplasma 215 (2001) 89e104. [11] Y. Li, Y. Shen, C. Cai, C. Zhong, L. Zhu, M. Yuan, H. Ren, The type II Arabidopsis formin14 interacts with microtubules and microfilaments to regulate cell division, Plant Cell 22 (2010) 2710e2726. [12] D.R. Kovar, C.J. Staiger, E.A. Weaver, D.W. McCurdy, AtFim1 is an actin filament crosslinking protein from Arabidopsis thaliana, Plant J. 24 (2000) 625e636. [13] J.C. Way, M. Chalfie, Mec-3, a homeobox containing gene that specifies differentiation of the touch receptor neurons in C. elegans, Cell 54 (1988) 5e16. [14] G. Freyd, S.K. Kim, H.R. Horvitz, Novel cysteine-rich motif and homeodomain in the product of the Caenorhabditis elegans cell lineage gene lin-II, Nature 344 (1990) 876e879. [15] O. Karlsson, S. Thor, T. Norberg, H. Ohlsson, T. Edlund, Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeo- and a CyseHis domain, Nature 344 (1990) 879e882.
40
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
[16] K.L. Schmeichel, M.C. Beckerle, Molecular dissection of a LIM domain, Mol. Biol. Cell. 8 (1997) 219e230. [17] J.L. Kadrmas, M.C. Beckerle, The LIM domain: from the cytoskeleton to the nucleus, Nat. Rev. Mol. Cell. Biol. 5 (2004) 920e931. [18] R. Baltz, J.L. Evrard, C. Domon, A. Steinmetz, A LIM motif is present in a pollenspecific protein, Plant Cell 4 (1992) 1465e1466. [19] A. Eliasson, N. Gass, C. Mundel, R. Baltz, R. Kräuter, J.L. Evrard, A. Steinmetz, Molecular and expression analysis of a LIM protein gene family from flowering plants, Mol. Genet. Genomics 264 (2000) 257e267. [20] M. Grubinger, M. Gimona, CRP2 is an autonomous actin-binding protein, FEBS Lett. 557 (2004) 88e92. [21] T.C. Tran, C. Singleton, T.S. Fraley, J.A. Greenwood, Cysteine-rich protein 1 (CRP1) regulates actin filament bundling, BMC Cell Biol. 6 (2005) 45. [22] H.J. Wang, A.R. Wan, G.Y. Jauh, An actin-binding protein, LlLIM1, mediates calcium and hydrogen regulation of actin dynamics in pollen tubes, Plant Physiol. 147 (2008) 1619e1636. [23] C. Thomas, C. Hoffmann, M. Dieterle, M. Van Troys, C. Ampe, A. Steinmetza, Tobacco WLIM1 is a novel F-Actin binding protein involved in actin cytoskeleton remodeling, Plant Cell 18 (2006) 2194e2206. [24] J. Papuga, C. Hoffmann, M. Dieterle, D. Moes, F. Moreau, S. Tholl, A. Steinmetz, C. Thomas, Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns and modes of regulation, Plant Cell 22 (2010) 3034e3052. [25] A. Kawaoka, P. Kaothien, K. Yoshida, S. Endo, K. Yamada, H. Ebinuma, Functional analysis of tobacco LIM protein Ntlim1 involved in lignin biosynthesis, Plant J. 22 (2000) 289e301. [26] H. Quader, W. Herth, U. Ryser, E. Schnepf, Cytoskeletal elements in cotton seed hair development in vitro: their possible regulatory role in cell wall organization, Protoplasma 137 (1987) 56e62. [27] R.W. Seagull, The effects of microtubule and microfilament disrupting agents on cytoskeletal arrays and wall deposition in developing cotton fibers, Protoplasma 159 (1990) 44e59. [28] X.B. Li, X.P. Fan, X.L. Wang, L. Cai, W.C. Yang, The cotton ACTIN1 gene is functionally expressed in fibers and participates in fiber elongation, Plant Cell 17 (2005) 859e875. [29] R.W. Seagull, A quantitative electron microscopic study of changes in microtubule arrays and wall microfibril orientation during in vitro cotton fiber development, J. Cell Sci. 101 (1992) 561e577. [30] J. Wang, H.Y. Wang, P.M. Zhao, L.B. Han, G.L. Jiao, Y.Y. Zheng, S.J. Huang, G.X. Xia, Overexpression of a profilin (GhPFN2) promotes the progression of developmental phases in cotton fibers, Cell Physiol. 51 (2010) 1276e1290.
[31] M. Luo, Y.H. Xiao, L. Hou, X.Y. Luo, D.M. Li, Y. Pei, Cloning and expression analysis of a LIM-domain protein gene from cotton (Gossypium hirsuturm L.), Yi Chuan Xue Bao 30 (2003) 175e182. [32] D. Arnaud, A. Déjardin, J.C. Leplé, M.C. Lesage-Descauses, N. Boizot, M. Villar, H. Bénédetti, G. Pilate, Expression analysis of LIM gene family in poplar, toward an updated phylogenetic classification, BMC Res. Notes 5 (2012) 102. [33] A.Y. Cheung, H.M. Wu, Structural and signaling networks for the polar cell growth machinery in pollen tubes, Annu. Rev. Plant Biol. 59 (2008) 547e572. [34] C.J. Staiger, L. Blanchoin, Actin dynamics: old friends with new stories, Curr. Opin. Plant Biol. 9 (2006) 554e562. [35] P.J. Hussey, T. Ketelaar, M.J. Deeks, Control of the actin cytoskeleton in plant cell growth, Annu. Rev. Plant Biol. 57 (2006) 109e125. [36] I. Bach, The LIM domain: regulation by association, Mech. Dev. 91 (2000) 5e17. [37] L.W. Jurata, G.N. Gill, Structure and function of LIM domains, Curr. Top. Microbiol. Immunol. 228 (1998) 75e118. [38] J.P. Thaler, S.K. Lee, L.W. Jurata, G.N. Gill, S.L. Pfaff, LIM factor Lhx3 contributes to the specification of motor neuron and interneuron identity through celltype-specific proteineprotein interactions, Cell 110 (2002) 237e249. [39] M.V. de Arruda, S. Watson, C.S. Lin, J. Leavitt, P. Matsudaira, Fimbrin is a homologue of the cytoplasmic phosphoprotein plastin and has domains homologous with calmodulin and actin gelation proteins, J. Cell Biol. 111 (1990) 1069e1079. [40] N. Mimura, A. Asano, Isolation and characterization of a conserved actinbinding domain from rat hepatic actinogelin, rat skeletal muscle, and chicken gizzard alpha-actinins, J. Cell Biol. 261 (1986) 10680e10687. [41] C. Thomas, F. Moreau, M. Dieterle, C. Hoffmann, S. Gatti, C. Hofmann, M. Van Troys, C. Ampe, A. Steinmetz, The LIM domains of WLIM1 define a new class of actin bundling modules, J. Biol. Chem. 282 (2007) 33599e33608. [42] R. Feuerstein, X. Wang, D. Song, N.E. Cooke, S.A. Liebhaber, The LIM/double zinc-finger motif functions as a protein dimerization domain, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 10655e10659. [43] S. Arber, P. Caroni, Specificity of single LIM motifs in targeting and LIM/LIM interactions in situ, Gene Dev. 10 (1996) 289e300. [44] D. Moes, S. Gatti, C. Hoffmann, M. Dieterle, F. Moreau, K. Neumann, M. Schumacher, M. Diederich, E. Grill, W.H. Shen, A. Steinmetz, C. Thomas, A LIM domain protein from tobacco involved in actin-bundling and histone gene transcription, Mol. Plant (2012) (online). [45] X.L. Wang, X.B. Li, The GhACS1 gene encodes an acyl-CoA synthetase which is essential for normal microsporogenesis in early anther development of cotton, Plant J. 57 (2009) 473e486.
Contents lists available at SciVerse ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
A cotton LIM domain-containing protein (GhWLIM5) is involved in bundling actin filaments Yang Li 1, Jia Jiang 1, Lan Li, Xiu-Lan Wang, Na-Na Wang, Deng-Di Li, Xue-Bao Li* Hubei Key Laboratory of Genetic Regulation and Integrative Biology, College of Life Sciences, Central China Normal University, Wuhan 430079, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 September 2012 Accepted 18 January 2013 Available online 12 February 2013
LIM-domain proteins play important roles in cellular processes in eukaryotes. In this study, a LIM protein gene, GhWLIM5, was identified in cotton. Quantitative RT-PCR analysis showed that GhWLIM5 was expressed widely in different cotton tissues and had a peak in expression during fiber elongation. GFP fluorescence assay revealed that cotton cells expressing GhWLIM5:eGFP fusion gene displayed a network distribution of eGFP fluorescence, suggesting that GhWLIM5 protein is mainly localized to the cell cytoskeleton. When GhWLIM5:eGFP transformed cells were stained with rhodamine-phalloidin there was consistent overlap in eGFP and rhodamine-palloidin signals, demonstrating that GhWLIM5 protein is colocalized with the F-actin cytoskeleton. In addition, high-speed cosedimentation assay verified that GhWLIM5 directly bound actin filaments, while low cosedimentation assay and microscopic observation indicated that GhWLIM5 bundled F-actin in vitro. Increasing amounts of GhWLIM5 protein were able to protect F-actin from depolymerization in vitro in the presence of Lat B (an F-actin depolymerizer). Our results contribute to a better understanding of the biochemical role of GhWLIM5 in modulating the dynamic F-actin network in cotton. Ó 2013 Elsevier Masson SAS. All rights reserved.
Keywords: Cotton (Gossypium hirsutum) Actin filaments Bundling LIM domain-containing protein
1. Introduction Actin cytoskeleton, consisting of the filamentous actin (F-actin) that assembles from monomeric subunits (G-actin), plays a succession of vital roles (such as intracellular transport, signaling, cell growth and division, etc.) in all eukaryotic cells [1]. Actin cytoskeleton is a dynamic and intricate structure, and thereby a sophisticated regulatory system has developed to modulate this dynamic structure in cells. Actin-binding proteins (ABPs) functionally interact with monomeric and/or polymerized actin for regulating F-actin nucleation, polymerization, depolymerization, crosslinking, stabilization and capping [2]. ABPs are divided into several classes based on their biochemical functions, and each class includes several ABP families according to their domain composition and/or organization. The first large class comprises the proteins which adjust dynamics and attributes of actin subunits or filaments. For example, nucleation-promoting factors form a stable seed of actin subunits which initiates actin assembly. Arp2/3 complex activated by Rho GTPases and WASP proteins is competent for nucleating actin assembly from free or profilin-bound * Corresponding author. Tel./fax: þ86 27 67862443. E-mail address: [email protected] (X.-B. Li). 1 These authors contributed equally to this work. 0981-9428/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2013.01.018
monomeric actin [3,4]. Capping and/or severing factors are crucial for regulating the availability and quantity of F-actin ends for subunit addition or loss. The proteins of ADF/cofilin family are highly conserved actin-modulating proteins in eukaryotic cells [5]. These proteins interact with both polymerized actin and monomeric actin and sever F-actin into fragments [6]. Previous study revealed that overexpression of GhADF7, a member of cotton ADF/ cofilin family, altered the balance of actin depolymerization and polymerization, causing the defective cytokinesis and multinucleate formation in cells [7]. Dynamizing proteins (such as cofilin) function in facilitating the loss of subunits from the pointed end of F-actin and changing the conformation of F-actin [8]. Monomerbinding proteins control assembly and disassembly of F-actin by directly binding to G-actin for promoting or inhibiting the G-actin to be added to the ends of actin filaments. As the main monomer actin-binding protein, profilin plays critical roles in many cellular processes and is considered to be one of the most important modulators [9,10]. The second major class of actin-binding proteins contains the members that participate in building actin filaments into high-order structures as orthogonal networks or parallel arrays. For instance, Arabidopsis FORMIN14 (AFH14) regulates both microtubule and microfilament arrays [11]. AtFim1, belonging to fimbrin/plastin family, functions in cross-linking actin filaments of pollen in a calcium-independent manner in vivo and in vitro [12].
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
LIM proteins are named by the initials of the three firstdiscovered LIM homeodomain proteins (LIN11, ISL1, and MEC3) [13e15], and usually contain one or more LIM domains in their sequences. The LIM domain, with the consensus sequence [C-X2-CX16e23-H-X2-C]-X2-[C-X2-C-X16e21C-X2e3-(C/D/H)] which essentially comprises two zinc fingers linked together by a short twoamino acid spacer, functions as a proteineprotein interaction module [16]. Animal genomes encode numerous LIM domain-containing proteins (LIMs) that are diverse in structure and function [17]. In contrast, plants only contain a limited number of LIMs, a majority of which belongs to Cys-rich protein (CRP) LIM subfamily [18,19]. It has been reported that animal CRP1 and CRP2 directly bind F-actin in vitro [20,21]. Similarly, previous studies indicated that plant CRP LIM proteins (such as lily LlLIM1, tobacco WLIM1 and six Arabidopsis LIM proteins) function as ABPs in plant cells. LlLIM1 promotes the assembly of rigid F-actin bundles, controls actin dynamics and protects F-actin from depolymerization [22]. Tobacco WLIM1 and six Arabidopsis LIM proteins are vital to bundle actin filaments and protect the actin cytoskeleton from disassembly [23,24]. In addition, plant LIM proteins also play other roles in development. Tobacco NtLIM1, for example, is a key trans-acting factor regulating gene expression in phenylpropanoid biosynthesis [25]. Cotton fibers are single-cell trichomes (seed hairs) derived from epidermal cells of the ovules. The processes of fiber elongation and secondary wall synthesis are associated with active changes in the organization of F-actin and microtubule cytoskeleton [26e28]. During the stages from cell elongation to secondary wall formation, the cortical microtubules alter from transverse to oblique and helical orientations, and are coupled with directing the deposition of the secondary wall cellulose [27,29]. In line with the cytological observations, a number of genes have been found to be expressed specifically/preferentially in developing fibers. Recently, a study showed that overexpression of the actin monomer-binding profilin gene GhPFN2 in cotton promoted the progression of fiber developmental phases [30]. Although these studies revealed that the actin cytoskeleton plays an essential role in fiber development and is regulated by some ABPs, little is known in detail of how LIM protein modulates F-actin cytoskeleton during cell growth and/or fiber development in cotton. In this study, a gene, GhWLIM5, encoding a LIM domain-containing protein was identified in cotton. Transient expression studies in plant with GFP-tagged GhWLIM5 indicate that this protein is able to bind to the filamentous actin network. Furthermore, it has been shown to directly bundle actin filaments and protect F-actin from depolymerization in vitro and to be expressed during fiber elongation so may be an important player in regulating cell growth in cotton.
35
2. Results 2.1. Characterization of three fiber-expressed GhLIM genes To investigate the role of actin-binding proteins (ABPs) in regulating dynamics of actin cytoskeleton during fiber development, three genes (cDNA) (designated as GhWLIM2, GhWLIM5 and GhXLIM6, accession numbers in GenBank: JX290318, JX290321 and JX290322) encoding LIM domain-containing proteins were isolated from cotton fiber cDNA library. Both GhWLIM2 and GhWLIM5, like previously reported GhLIM1 [31], contain 570 bp of open reading frame (ORF) encoding LIM protein of 189 amino acids, while GhXLIM6 encodes a polypeptide with 196 amino acid residues. At nucleotide acid level, the three isolated GhLIM genes show relatively low homology. GhWLIM2 show relatively high identity (58%) with GhXLIM6, whereas GhWLIM2 and GhXLIM6 share relatively low similarity (41% and 28%, respectively) with GhWLIM5. In addition, GhWLIM5 show high identity (96%) with GhLIM1. At amino acid level, there is a high identity (88%) between GhWLIM2 and GhWLIM5, but both of them share relatively lower homology (less than 60%) with GhXLIM6. Moreover, each of the three GhLIM proteins has two LIM domains of around 52 amino acids separated by a more variable spacer region (Fig. 1). 2.2. Phylogenetic relationship of GhWLIM5 with other LIM proteins To determine divergence of the isolated GhWLIM5 protein with the other plant LIM proteins during evolution, the phylogenetic relationship of 19 LIM domain proteins was analyzed by MEGA3.1 program. Plant LIM proteins can be divided into seven subgroups: XLIM1, WLIM1, WLIM2, bLIM1, PLIM1, PLIM2 and PLIM2-like [32]. As shown in Fig. 2, the tree is divided into six distinct branches. Thereinto, GhLIM1, GhWLIM2 and GhWLIM5 form an independent branch which is positioned in the WLIM2 subgroup. Furthermore, GhLIM1 and GhWLIM5 form a distinct clade which is basal to GhWLIM2, implying that GhWLIM2 and GhWLIM5 have close evolutional relationship with GhLIM1. On the other hand, GhXLIM6 occupies a distinct clade in XLIM1 subgroup, indicating that GhXLIM6 diverged earlier from GhLIM1, GhWLIM2 and GhWLIM5 during evolution. 2.3. Expression profiling of GhWLIM5 gene Quantitative RT-PCR analysis revealed that GhWLIM5 displayed broad expression in different organs/tissues including roots, hypocotyls, cotyledons, leaves, petals, anthers, ovules and fibers. In
Fig. 1. Alignment and sequence comparison among GhLIM1, GhWLIM2, GhWLIM5 and GhXLIM6 proteins. Numbers on the right indicate the protein length in amino acids. LIM domains are indicated by the line above the alignments. The amino acid residues identical among the sequences are indicated in black. GhWLIM2, GhWLIM5 and GhXLIM6 are identified from this work, and GhLIM1 was selected from GenBank. The accession number of GhLIM1 sequence in GenBank is AAL38006.
36
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
via Agrobacterium-mediated transformation. Seven independent transformed cell lines (calli) were generated on the selective medium. Stable transformed cells expressing GhWLIM5:eGFP fusion proteins were examined with a Leica confocal laser scanning microscope (see Methods). The network distribution of eGFP fluorescence was clearly observed in the cotton cells harboring GhWLIM5:eGFP reporter construct (Fig. 4AeC), suggesting that GhWLIM5 protein is mainly localized on the cell cytoskeleton and nucleus. To further confirm our deduction, the transformed cells expressing GhWLIM5:eGFP protein were stained with actin-specific rhodamine-phalloidin. There was a consistent overlap in the fluorescent signals for GhWLIM5:eGFP and that for the actin cytoskeleton stained with rhodamine-phalloidin (Fig. 4DeF), demonstrating that GhWLIM5 protein is colocalized with filamentous actin. 2.5. GhWLIM5 protein directly interacts with F-actin
Fig. 2. Phylogenetic relationship of GhWLIM5 with other LIM proteins. GhWLIM2, GhWLIM5 and GhXLIM6 are identified from this work, and the others are selected from GenBank. The accession numbers of the protein sequences in GenBank are as follows: GhLIM1 (AAL38006), AtPLIM2 (AAC28544), AtPLIM2b (ABF83669), AtPLIM2c (AAY34164), AtWLIM1 (AAM62606), AtWLIM2 (AAB95275), AtWLIM2b (NP_191136), PtXLIM1a (ABK95336), PtXLIM1b (EEE83585), PtPLIM2a (EEE99098), PtPLIM2b (EEE81847), PtWLIM1a (EEE99002), PtWLIM1b (EEE81678), PtWLIM2a (EEE89506), PtWLIM2b (EEE01351), PtLIM1a (EEE96244), PtLIM1b (EEF05698), PtPLIM2c (EEE82853), PtPLIM2d (EEE79462).
elongating fibers, GhWLIM5 displayed relatively low levels at the early stage (3 days post anthesis, DPA), and reached its peak at 9 DPA. As fibers further developed, its expression was gradually decreased to relatively low level (Fig. 3), suggesting that it may play a role in cotton development, including fiber elongation. 2.4. Subcelluar localization of GhWLIM5 protein To investigate whether GhWLIM5 protein interacts with actin cytoskeleton in cotton cells, eGFP-tagged GhWLIM5 driven by cauliflower mosaic virus (CaMV) 35S promoter was introduced into cotton
His-tagged GhWLIM5 protein was expressed in Escherichia coli, and purified on a nickel-nitrilotriacetic acid agarose (Ni-NTA) matrix. High-speed cosedimentation assay indicated that GhWLIM5 proteins directly bound F-actin in vitro. Actin filaments (F-actin) were copolymerized with GhWLIM5 proteins and then centrifuged. The pellet and supernatant fractions were detected by SDS-PAGE. The experimental results revealed that GhWLIM5 proteins were mainly accumulated in the pellets when F-actin was present, but little GhWLIM5 protein was found in the pellets in the absence of Factin (Fig. 5). These results demonstrated that GhWLIM5 proteins could directly bind F-actin in vitro. 2.6. GhWLIM5 protein bundles actin filaments To determine whether GhWLIM5 function as an actin bundler, we employed the low-speed cosedimentation assay. Actin filaments were copolymerized with GhWLIM5 and centrifuged. The supernatant and pellet fractions were analyzed by SDS-PAGE. As shown in Fig. 6A, most F-actin remained in the supernatant in the absence of GhWLIM5 proteins and vice versa. On the contrary, the amount of F-actin in the pellets was gradually increased with increasing GhWLIM5 protein concentration, indicating that GhWLIM5 promotes F-actin bundling. As an alternative, the role of GhWLIM5 in bundling F-actin was directly visualized under confocal microscope. As shown in Fig. 6B, rhodamine-phalloidinlabeled actin filaments, as the negative control, were scattered individually in the absence of GhWLIM5 protein. After prepolymerized F-actin was incubated with GhWLIM5 proteins, however, high-ordered F-actin net-structure was observed when the reactive products were stained with rhodamine-phalloidin (Fig. 6C). These data demonstrated that GhWLIM5 proteins could bundle actin filaments. 2.7. GhWLIM5 stabilizes F-actin in vitro
Fig. 3. Quantitative RT-PCR analysis of GhWLIM5 expression in cotton tissues. Total RNA was isolated from cotton tissues: (1) roots; (2) hypocotyls; (3) cotyledons; (4) leaves; (5) petals; (6) anthers; (7) 9 DPA ovules; (8e14) 3, 6, 9, 12, 15, 18 and 21 DPA fibers, respectively. Relative values of GhWLIM5 expression in cotton are shown as a percentage of GhUBI1 expression activity. The experiments were repeated three times, and error bars represent standard deviation. DPA, day post anthesis.
The data on tobacco WLIM1 and lily LlLIM1 suggested that plant LIM proteins play a role in regulation of F-actin stabilization [22,23]. To investigate whether GhWLIM5 affects F-actin stability, we employed Lat B (latrunculin B) to depolymerize F-actin, using DMSO as a negative control. High-speed cosedimentation assay indicated that the most of actin was accumulated in the supernatant after 20 h treatment with Lat B (Fig. 7, lane 2), but F-actin in the control (DMSO) occurred in the pellet (Fig. 7, lane 1). On the other hand, when treated with Lat B, the amount of F-actin in the pellet increased with increasing amounts of GhWLIM5 (Fig. 7, lane 3e7), indicating that GhWLIM5 protein can protect F-actin against depolymerization by Lat B.
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
37
Fig. 4. Subcellular localization of GhWLIM5. (AeC) Localization of GhWLIM5:eGFP fusion proteins in cotton callus cells. (A) Bright-field micrograph of a cotton cell; (B) GFP signals in the same cell; (C) image B was merged with image A. (DeF) Staining assay of cotton callus cells with expressing GhWLIM5:eGFP fusion proteins. (D) GFP signals in the cotton cell; (E) actin cytoskeleton stained with rhodamine-phalloidin of the same cotton cell in image D; (F) image D was merged with image E. Bar ¼ 10 mm.
3. Discussion In eukaryotic cells, actin-binding proteins (ABPs) play important roles, ranging from changing the polymerization property and dynamics of actin subunits and filaments to establishing the actin network and bundles, in precisely modulating dynamic actin cytoskeleton [2,33e35]. The LIM domain is a conserved domain found in a variety of different proteins. Thus far, quite a few publications reported some LIM domain-containing proteins belong to
Fig. 5. High-speed cosedimentation assay of GhWLIM5 binding F-actin. GhWLIM5 (16.7 mM) and control BSA (2 mM) were respectively incubated with or without F-actin (10 mM), and centrifuged at 200,000 g for 1 h. Subsequently, the pellet (PEL) and supernatant (SUP) were analyzed by SDS-PAGE. GhWLIM5 bound to F-actin as indicated by their presence in the pellet after centrifugation. Control BSA did not cosedimentate with F-actin.
ABP family. In animals, LIM proteins differ in their functions and are grouped into four classes: LIM-hd, LMO, LIM-kinase and other LIM proteins [36]. Several LMO and LIM-hd proteins are localized in the cell nucleus, where they function as transcriptional factors of developmental genes [37,38], while other LIM proteins (such as CRP1, CRP2 and CRP3) are involved in bundling F-actin [20,21]. In plants, two LIM proteins, NtWLIM1 and LlLIM1, bind directly to actin filaments for stabilizing actin cytoskeleton [22,23]. Similarly, our data also demonstrated that cotton LIM5 protein, belonging to CRP-related family, functions in bundling and stabilizing F-actin. Recently, plant LIM proteins have been divided into 4 groups: aLIM1 which containing three subgroups (XLIM1, WLIM1 and PLIM1), bLIM1, gLIM2 and dLIM2 containing PLIM2 and PLIM2-like subgroups [32]. Previous studies reported that the LIM proteins in PLIM1, PLIM2 and PLIM2-like subgroups (including SF3, LILIM1, AtPLIM2a, AtPLIM2b and AtPLIM2c) are predominantly expressed in pollen [18,22,24]. However, the LIM proteins in WLIM1, WLIM2 and bLIM1 subgroups (such as cotton GhLIM1, sunflower WLIM1, tobacco WLIM1 and the remaining Arabidopsis LIMs) are expressed in a wide range of organs [19,23,24,31]. In addition, XLIM proteins were expressed in secondary xylem [32]. In this work, quantitative RT-PCR analysis revealed that GhWLIM5 gene was expressed widely in cotton tissues, although it displayed a relatively higher expression level in anthers and had a peak in expression during fiber elongation at 9 DPA. Microscopic observation indicated that eGFP-tagged GhWLIM5 protein localized to both cell nucleus and cytoplasm. Likewise, tobacco WLIM1 and six Arabidopsis LIMs were also shown to have dual localization [23,24], but the role of these LIMs in cell nucleus is not clear. A lot of studies on LIM domain-containing proteins in animals (such as CRPs) and in plants (such as tobacco WLIM1, LILIM1 and AtLIMs) revealed the roles of LIM proteins in binding to and bundling F-actin in cells [19,21e24]. On the other hand, it was reported that cotton fiber-preferential ACTIN1 functions in fiber elongation [28]. In this study, we demonstrated that GhWLIM5 was also expressed in elongating fibers, colocalized with actin cytoskeleton in cells, and directly bundled actin filaments. These results
38
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
Fig. 6. Analysis of GhWLIM5 bundling actin filaments. (A) Low-speed cosedimentation assay of GhWLIM5 and F-actin. 10 mM F-actin in the absence of GhWLIM5 or in the presence of different concentrations (0.5e16 mM) of GhWLIM5 were polymerized and centrifuged at 14,000 g. The supernatant (SUP) and pellet (PEL) were analyzed by SDS-PAGE. Actin filaments were accumulated in the sediment in the presence of GhWLIM5, but not in the absence of GhWLIM5. (B, C) Micrographs of actin bundles polymerized in the presence of GhWLIM5. The effect of GhWLIM5 on bundling actin filaments stained with rhodamine-phalloidin was directly visualized under fluorescence microscope. (B) Actin filaments polymerized in absence of GhWLIM5 as control; (C) high magnification of an F-actin bundling structure formed in presence of 16 mM GhWLIM5. Bar ¼ 15 mm.
suggested that GhWLIM5 may be involved in fiber elongation via modulating the dynamic F-actin network. According to the quantity of actin-binding domains, ABPs could be divided into two groups: (1) containing two discrete actinbinding domains within its sequence (such as fimbrin/plastin) [39], and (2) containing a single actin-binding domain and usually forming multimers (such as a-actinin) [40]. Cosedimentation assay and electron microscopy revealed that two LIM domains of tobacco WLIM1 individually function in bundling F-actin, indicating that each of the two LIM domains is independent [41]. Some animal
CRPs and plant LIM proteins may require dimer formation to start their actin-bundling activity as they only have a single actin binding site. For instance, MLP and hCRP have been shown to dimerize through their LIM domains [42,43]. Recently, further study revealed that tobacco WLIM1 protein containing two LIM domains also forms dimer/oligomer for its function [44]. However, yeast twohybrid assay revealed that GhWLIM5 protein could not interact with the other two GhLIM proteins. In brief, our data will contribute to the understanding of the biochemical role of GhWLIM5 in modulating and stabilizing the dynamic F-actin in cotton. 4. Materials and methods 4.1. Collection of plant materials Cotton (Gossypium hirsutum cv. Coker312) seeds were surface sterilized with 70% (v/v) ethanol for 1 min and 10% (v/v) H2O2 for 2 h, followed by washing with sterile water. The sterilized seeds were germinated on half-strength Murashige and Skoog (MS) medium (pH 5.8) under a 16 h light/8 h dark cycle at 28 C for 6 days. Roots, hypocotyls and cotyledons were collected from these seedlings. The other tissues (such as leaves, petals, anthers, ovules, and fibers) were derived from cotton plants grown in field.
Fig. 7. Assay of the effect of GhWLIM5 in stabilizing F-actin. F-actin was depolymerized by latrunculin B (Lat B) in the absence of GhWLIM5 or in the presence of different concentrations (2e32 mM) of GhWLIM5. The equal volume DMSO was used as control. The samples were centrifuged at 200,000 g for 1 h, and then the pellet (PEL) and supernatant (SUP) were analyzed by SDS-PAGE. With Lat B treatment, actin filaments were still accumulated in the sediment in the presence of GhWLIM5 proteins.
4.2. Sequence and phylogenetic analysis To identify the genes that are functionally expressed in cotton fibers, 4000 cDNA clones were randomly selected from cotton fiber cDNA library. Some cotton LIM cDNAs were identified from these
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
clones. The sequences of the isolated cotton LIM genes (cDNAs) and their deduced proteins were analyzed using DNAstar (DNAstar Inc). The GhLIM peptide sequences were aligned with ClustalW (http:// www.ebi.ac.uk/clustalw/), and phylogenetic analysis was performed to show the evolutionary relationship among GhLIM genes. A NeighboreJoining tree was generated by MEGA3.1 program. A bootstrap analysis with 1000 replicates was performed to assess the statistical reliability of the tree topology. 4.3. RT-PCR analysis Total RNA was isolated from cotton tissues. Expression of GhWLIM5 gene in cotton tissues was analyzed by real-time quantitative reverse transcriptase (RT)-PCR using the fluorescent intercalating dye SYBR-Green in a detection system (MJ Research, Opticon 2) by the method described earlier [28]. A cotton polyubiquitin gene (GhUBI1) was served as a standard control in RT-PCR. The gene-specific primers are as follows: GhWLIM5-P1, TCAAGGAGACGGGTAACTTCAAC; GhWLIM5-P2, GTTCCCCTCCCGAGCATAAATC. The experiments were repeated three times. 4.4. Subcellular localization and staining The coding sequence of eGFP (enhanced green fluorescent protein) gene was cloned into pBluescript II SKþ vector to form an intermediate construct pSK-eGFP. Subsequently, GhWLIM5 ORF (open reading frame, without the stop codon) was cloned into the pSK-eGFP vector at a position upstream of the eGFP gene. The constructed GhWLIM5:eGFP fusion gene was cloned into pBI121 vector, replacing the GUS gene. Cotton hypocotyl explants were transformed with the GhWLIM5:eGFP construct by Agrobacterium-mediated DNA transfer as described previously [45]. Stable transformed cells expressing GhWLIM5:eGFP were selected for detecting GFP fluorescence on a SP5 Meta confocal laser microscope (Leica, Germany) with a filter set of 488 nm for excitation and 506e538 nm for emission. SP5 software (Leica, Germany) was employed to record and process the digital images taken. Meanwhile, the GhWLIM5-eGFP transformed cells were stained with rhodamine-phalloidin, an F-actin-specific dye, using the method described previously [28]. The staining cells were observed on a SP5 Meta confocal laser microscope as described above. 4.5. High- and low-speed cosedimentation assays The coding sequence of GhWLIM5 was amplified by PCR, using gene-specific primers (GhWLIM5ExP1: GGGGGATCCATGTCATTTATTGGTACCCA; GhWLIM5ExP2: GGGTCTAGATCAAGCTTCAGGAACG GATG), and cloned into pET-28a vector. The 6 His-tagged GhWLIM5 was expressed in E. coli strain BL21 cells and purified by a Ni-NTA resin following a procedure described by the user manual. The purified proteins were respectively concentrated and buffer-exchanged (100 mM NaH2PO4 and 10 mM TriseHCl, pH 7.4) using 10 K molecular weight cutoff dialysis cassettes (Pierce). High- and low-speed cosedimentation assays were carried out using Actin Bing Protein Biochem Kit (Cytoskeleton). Rabbit muscle actin was diluted at 0.4 mg/ mL (10 mM) in General Actin Buffer (5 mM TriseHCl, pH 8.0 and 0.2 mM CaCl2). Polymerization was induced in actin polymerization buffer (5 mM TriseHCl, pH 8.0, 0.2 mM CaCl2, 0.2 mM ATP,1.0 mM DTT, and 2 mM MgCl2). Proteins were preclarified at 100,000 g prior to experiments. High-speed cosedimentation assay was performed to determine the F-actin-binding activity of GhWLIM5. In brief, GhWLIM5 were mixed with the preassembled F-actin, using BSA as control. The samples were incubated at 24 C for 30 min, and then centrifuged at 200,000 g for 1 h in an Optima TLX ultracentrifuge
39
(Beckman) at 4 C. After the supernatant was removed, pellets were resuspended by 30 ml Milli-Q water. Pellet and supernatant samples were analyzed by 12% SDS-PAGE and Coomassie Brilliant Blue R (SigmaeAldrich) staining. In low-speed cosedimentation assay, increasing amounts (0.5, 1, 2, 4, 8 and 16 mM) of GhWLIM5 were incubated with 10 mM preassembled F-actin for 30 min at 24 C, respectively, and then centrifuged at 14,000 g for 1 h. Pellet and supernatant samples were analyzed by SDS-PAGE as described above. Lat B (latrunculin B, an F-actin depolymerizer) was used to examine the effect of GhWLIM5 on stabilizing F-actin. In this highspeed cosedimentation assay, 4 mM actin was polymerized at 25 C for 1 h in the absence (control) and the presence of various amounts (2, 4, 8, 16 and 32 mM) of GhWLIM5, respectively, and then 100 mM Lat B was added into each sample, using DMSO as control. After 20 h of incubation at 25 C, the samples were centrifuged at high speed (200,000 g) at 4 C for 1 h, and analyzed by SDS-PAGE as described above. 4.6. Visualization of F-actin bundling under confocal microscope Preassembled actin alone or in presence of GhWLIM5 was reacted in a buffer consisting of 5 mM TriseHCl (pH 8.0), 0.2 mM CaCl2, 50 mM KCl, 2 mM MgCl2, 1 mM ATP and 0.5 mM DTT, and labeled with 4 mM rhodamine-phalloidin. Then, 1 ml of each sample was diluted and applied to a cover slip coated with poly-L-lysine (0.01%). Images were recorded with a SP5 Meta confocal laser microscope (Leica, Germany) using a pinhole set to produce optical sections about 2 mm thick. Acknowledgment This work was supported by National Natural Sciences Foundation of China (Grant No. 31070281, 31171174) and the project from the Ministry of Agriculture of China for transgenic research (Grant No. 2011ZX08009-003). References [1] B. Kost, N.H. Chua, The plant cytoskeleton: vacuoles and cell walls make the difference, Cell 108 (2002) 9e12. [2] S.J. Winder, K.R. Ayscough, Actin-binding proteins, J. Cell Sci. 118 (2005) 651e654. [3] M.D. Welch, The world according to Arp: regulation of actin nucleation by the Arp2/3 complex, Trends Cell Biol. 9 (1999) 423e427. [4] M.D. Welch, R.D. Mullins, Cellular control of actin nucleation, Annu. Rev. Cell Dev. Biol. 18 (2002) 247e288. [5] I. Mabuchi, An actin-depolymerizing protein (depactin) from starfish oocytes: properties and interaction with actin, J. Cell Biol. 97 (1983) 1612e1621. [6] H. Chen, B.W. Bernstein, J.R. Bamburg, Regulating actin filament dynamics in vivo, Trends Biochem. Sci. 25 (2000) 19e23. [7] X.B. Li, D. Xu, X.L. Wang, G.Q. Huang, J. Luo, D.D. Li, Z.T. Zhang, W.L. Xu, Three cotton genes preferentially expressed in flower tissues encode actindepolymerizing factors which are involved in F-actin dynamics in cells, J. Exp. Bot. 61 (2009) 41e53. [8] M. Van Troys, L. Huyck, S. Leyman, S. Dhaese, J. Vandekerkhove, C. Ampe, Ins and outs of ADF/cofilin activity and regulation, Eur. J. Cell Biol. 87 (2008) 649e667. [9] C.J. Staiger, B.C. Gibbon, D.R. Kovar, L.E. Zonia, Profilin and actindepolymerizing factor: modulators of actin organization in plants, Trends Plant Sci. 2 (1997) 275e281. [10] D.W. McCurdy, D.R. Kovar, C.J. Staiger, Actin and actin-biding proteins in higher plants, Protoplasma 215 (2001) 89e104. [11] Y. Li, Y. Shen, C. Cai, C. Zhong, L. Zhu, M. Yuan, H. Ren, The type II Arabidopsis formin14 interacts with microtubules and microfilaments to regulate cell division, Plant Cell 22 (2010) 2710e2726. [12] D.R. Kovar, C.J. Staiger, E.A. Weaver, D.W. McCurdy, AtFim1 is an actin filament crosslinking protein from Arabidopsis thaliana, Plant J. 24 (2000) 625e636. [13] J.C. Way, M. Chalfie, Mec-3, a homeobox containing gene that specifies differentiation of the touch receptor neurons in C. elegans, Cell 54 (1988) 5e16. [14] G. Freyd, S.K. Kim, H.R. Horvitz, Novel cysteine-rich motif and homeodomain in the product of the Caenorhabditis elegans cell lineage gene lin-II, Nature 344 (1990) 876e879. [15] O. Karlsson, S. Thor, T. Norberg, H. Ohlsson, T. Edlund, Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeo- and a CyseHis domain, Nature 344 (1990) 879e882.
40
Y. Li et al. / Plant Physiology and Biochemistry 66 (2013) 34e40
[16] K.L. Schmeichel, M.C. Beckerle, Molecular dissection of a LIM domain, Mol. Biol. Cell. 8 (1997) 219e230. [17] J.L. Kadrmas, M.C. Beckerle, The LIM domain: from the cytoskeleton to the nucleus, Nat. Rev. Mol. Cell. Biol. 5 (2004) 920e931. [18] R. Baltz, J.L. Evrard, C. Domon, A. Steinmetz, A LIM motif is present in a pollenspecific protein, Plant Cell 4 (1992) 1465e1466. [19] A. Eliasson, N. Gass, C. Mundel, R. Baltz, R. Kräuter, J.L. Evrard, A. Steinmetz, Molecular and expression analysis of a LIM protein gene family from flowering plants, Mol. Genet. Genomics 264 (2000) 257e267. [20] M. Grubinger, M. Gimona, CRP2 is an autonomous actin-binding protein, FEBS Lett. 557 (2004) 88e92. [21] T.C. Tran, C. Singleton, T.S. Fraley, J.A. Greenwood, Cysteine-rich protein 1 (CRP1) regulates actin filament bundling, BMC Cell Biol. 6 (2005) 45. [22] H.J. Wang, A.R. Wan, G.Y. Jauh, An actin-binding protein, LlLIM1, mediates calcium and hydrogen regulation of actin dynamics in pollen tubes, Plant Physiol. 147 (2008) 1619e1636. [23] C. Thomas, C. Hoffmann, M. Dieterle, M. Van Troys, C. Ampe, A. Steinmetza, Tobacco WLIM1 is a novel F-Actin binding protein involved in actin cytoskeleton remodeling, Plant Cell 18 (2006) 2194e2206. [24] J. Papuga, C. Hoffmann, M. Dieterle, D. Moes, F. Moreau, S. Tholl, A. Steinmetz, C. Thomas, Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns and modes of regulation, Plant Cell 22 (2010) 3034e3052. [25] A. Kawaoka, P. Kaothien, K. Yoshida, S. Endo, K. Yamada, H. Ebinuma, Functional analysis of tobacco LIM protein Ntlim1 involved in lignin biosynthesis, Plant J. 22 (2000) 289e301. [26] H. Quader, W. Herth, U. Ryser, E. Schnepf, Cytoskeletal elements in cotton seed hair development in vitro: their possible regulatory role in cell wall organization, Protoplasma 137 (1987) 56e62. [27] R.W. Seagull, The effects of microtubule and microfilament disrupting agents on cytoskeletal arrays and wall deposition in developing cotton fibers, Protoplasma 159 (1990) 44e59. [28] X.B. Li, X.P. Fan, X.L. Wang, L. Cai, W.C. Yang, The cotton ACTIN1 gene is functionally expressed in fibers and participates in fiber elongation, Plant Cell 17 (2005) 859e875. [29] R.W. Seagull, A quantitative electron microscopic study of changes in microtubule arrays and wall microfibril orientation during in vitro cotton fiber development, J. Cell Sci. 101 (1992) 561e577. [30] J. Wang, H.Y. Wang, P.M. Zhao, L.B. Han, G.L. Jiao, Y.Y. Zheng, S.J. Huang, G.X. Xia, Overexpression of a profilin (GhPFN2) promotes the progression of developmental phases in cotton fibers, Cell Physiol. 51 (2010) 1276e1290.
[31] M. Luo, Y.H. Xiao, L. Hou, X.Y. Luo, D.M. Li, Y. Pei, Cloning and expression analysis of a LIM-domain protein gene from cotton (Gossypium hirsuturm L.), Yi Chuan Xue Bao 30 (2003) 175e182. [32] D. Arnaud, A. Déjardin, J.C. Leplé, M.C. Lesage-Descauses, N. Boizot, M. Villar, H. Bénédetti, G. Pilate, Expression analysis of LIM gene family in poplar, toward an updated phylogenetic classification, BMC Res. Notes 5 (2012) 102. [33] A.Y. Cheung, H.M. Wu, Structural and signaling networks for the polar cell growth machinery in pollen tubes, Annu. Rev. Plant Biol. 59 (2008) 547e572. [34] C.J. Staiger, L. Blanchoin, Actin dynamics: old friends with new stories, Curr. Opin. Plant Biol. 9 (2006) 554e562. [35] P.J. Hussey, T. Ketelaar, M.J. Deeks, Control of the actin cytoskeleton in plant cell growth, Annu. Rev. Plant Biol. 57 (2006) 109e125. [36] I. Bach, The LIM domain: regulation by association, Mech. Dev. 91 (2000) 5e17. [37] L.W. Jurata, G.N. Gill, Structure and function of LIM domains, Curr. Top. Microbiol. Immunol. 228 (1998) 75e118. [38] J.P. Thaler, S.K. Lee, L.W. Jurata, G.N. Gill, S.L. Pfaff, LIM factor Lhx3 contributes to the specification of motor neuron and interneuron identity through celltype-specific proteineprotein interactions, Cell 110 (2002) 237e249. [39] M.V. de Arruda, S. Watson, C.S. Lin, J. Leavitt, P. Matsudaira, Fimbrin is a homologue of the cytoplasmic phosphoprotein plastin and has domains homologous with calmodulin and actin gelation proteins, J. Cell Biol. 111 (1990) 1069e1079. [40] N. Mimura, A. Asano, Isolation and characterization of a conserved actinbinding domain from rat hepatic actinogelin, rat skeletal muscle, and chicken gizzard alpha-actinins, J. Cell Biol. 261 (1986) 10680e10687. [41] C. Thomas, F. Moreau, M. Dieterle, C. Hoffmann, S. Gatti, C. Hofmann, M. Van Troys, C. Ampe, A. Steinmetz, The LIM domains of WLIM1 define a new class of actin bundling modules, J. Biol. Chem. 282 (2007) 33599e33608. [42] R. Feuerstein, X. Wang, D. Song, N.E. Cooke, S.A. Liebhaber, The LIM/double zinc-finger motif functions as a protein dimerization domain, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 10655e10659. [43] S. Arber, P. Caroni, Specificity of single LIM motifs in targeting and LIM/LIM interactions in situ, Gene Dev. 10 (1996) 289e300. [44] D. Moes, S. Gatti, C. Hoffmann, M. Dieterle, F. Moreau, K. Neumann, M. Schumacher, M. Diederich, E. Grill, W.H. Shen, A. Steinmetz, C. Thomas, A LIM domain protein from tobacco involved in actin-bundling and histone gene transcription, Mol. Plant (2012) (online). [45] X.L. Wang, X.B. Li, The GhACS1 gene encodes an acyl-CoA synthetase which is essential for normal microsporogenesis in early anther development of cotton, Plant J. 57 (2009) 473e486.