A designed recombinant fusion protein for targeted delivery of siRNA to the mouse brain

    A designed recombinant fusion protein for targeted delivery of siRNA to the mouse brain Mohamed Mohamed Haroon, Ghulam Hassan Dar, Durga Jeyalakshmi, Uthra Venkatraman, Kamal Saba, Nandini Rangaraj, Anant Bahadur Patel, Vijaya Gopal PII: DOI: Reference:

S0168-3659(16)30131-6 doi: 10.1016/j.jconrel.2016.03.007 COREL 8169

To appear in:

Journal of Controlled Release

Received date: Revised date: Accepted date:

24 September 2015 31 January 2016 3 March 2016

Please cite this article as: Mohamed Mohamed Haroon, Ghulam Hassan Dar, Durga Jeyalakshmi, Uthra Venkatraman, Kamal Saba, Nandini Rangaraj, Anant Bahadur Patel, Vijaya Gopal, A designed recombinant fusion protein for targeted delivery of siRNA to the mouse brain, Journal of Controlled Release (2016), doi: 10.1016/j.jconrel.2016.03.007

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT A designed recombinant fusion protein for targeted delivery

IP

T

of siRNA to the mouse brain

Mohamed Mohamed Haroon, Ghulam Hassan Dar, Durga Jeyalakshmi,

Gopal*

SC R

Uthra Venkatraman, Kamal Saba, Nandini Rangaraj, Anant Bahadur Patel, Vijaya

CSIR-Centre for Cellular and Molecular Biology, Uppal Road,

CE P

TE

D

MA

NU

Hyderabad, Telangana, India-500007

*Author for correspondence

CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Habshiguda, Hyderabad

AC

Email: [email protected] or [email protected] Ph# 91-40-27192545 Fax: 91-40-27160591

Abstract

1

ACCEPTED MANUSCRIPT RNA interference represents a novel therapeutic approach to modulate several neurodegenerative disease-related genes. However, exogenous delivery of siRNA restricts their transport into different tissues and specifically into the brain mainly due

T

to its large size and the presence of the blood-brain barrier (BBB). To overcome these

IP

challenges, we developed here a strategy wherein a peptide known to target specific gangliosides was fused to a double-stranded RNA binding protein to deliver siRNA to

SC R

the brain parenchyma. The designed fusion protein designated as TARBP-BTP consists of a double-stranded RNA-binding domain (dsRBD) of human Trans Activation response element (TAR) RNA Binding Protein (TARBP2) fused to a brain

NU

targeting peptide that binds to monosialoganglioside GM1. Conformation-specific binding of TARBP2 domain to siRNA led to the formation of homogenous serum-

MA

stable complex with targeting potential. Further, uptake of the complex in Neuro-2a, IMR32 and HepG2 cells analyzed by confocal microscopy and fluorescence activated cell sorting, revealed selective requirement of GM1 for entry. Remarkably, systemic

D

delivery of the fluorescently labeled complex (TARBP-BTP: siRNA) in ΑβPP-PS1

TE

mouse model of Alzheimer’s disease (AD) led to distinctive localization in the cerebral hemisphere. Further, the delivery of siRNA mediated by TARBP-BTP led to

CE P

significant knockdown of BACE1 in the brain, in both ΑβPP-PS1 mice and wild type C57BL/6. The study establishes the growing importance of fusion proteins in delivering therapeutic siRNA to brain tissues.

AC

Keywords: Monosialoganglioside GM1; TARBP2, RNAi, BBB, Alzheimer’s disease Running title: Targeting siRNA to the brain

1. Introduction 2

ACCEPTED MANUSCRIPT Short interfering RNAs (siRNA) as gene-specific therapeutic molecules are versatile tools to accurately modulate gene expression [1-3]. However, delivery of these molecules to specific tissues is challenged due to their anionic nature, large size [4, 5]

T

and non-specific effects [6-8] limiting their clinical utility. Besides, the delivery of

IP

siRNA to the brain parenchyma is inhibited by the blood-brain barrier [9] restricting treatment of neurodegenerative diseases. To overcome these limitations while aiming

SC R

for selectivity and non-toxicity, many peptide carriers were earlier established by conjugating antibody ligands and fusion proteins to nanoparticles through genetic engineering approaches, with the objective of targeting transferrin and insulin

NU

receptors of endothelial cells lining the brain capillaries [10, 11]. In a notable advancement, different from these studies, numerous cell-targeting peptides were

MA

chosen through phage display by virtue of inherent tropism, increased avidity to mammalian cell surface receptors and ease of production [12]. In an analogous strategy, peptides with the binding characteristics of tetanus toxin to

D

trisialoganglioside GT1b [13] led to the discovery of a 12-aa peptide Tet1, offering

TE

the possibility of conjugating short peptides to larger protein scaffolds to generate multi-functional fusion proteins with neuronal tropism. Succeeding these studies, in a

CE P

similar effort, Georgieva et al. [14] developed strategies to conjugate neurotropic peptides to lipid-based molecules to impart in vivo stability, which demonstrated remarkable transcytotic capacity in an in vitro BBB model, suggesting an identical mechanism in vivo. Upon systemic delivery, the targeting molecules, having affinity

AC

for GM1, were found to localize in the brain parenchyma [14] and additionally in the lungs [15] mandating further experiments to understand the impending potential of derivatized polymers displaying broad selectivity.

Majority of non-viral vectors for nucleic acid delivery were earlier developed using the cationic nature of molecules such as lipids [16], cell-penetrating peptides [17, 18], and dendrimers [19]. Spontaneous interaction of these molecules with nucleic acids led to the formation of stable non-covalent complexes [20]. Knowledge-based rational design strategies subsequently led to the usage of multiple components for superior delivery and stability [21] leading to successful target-specific gene silencing. Taking cues from neurotropic viruses, Kumar et al., fused the Arginine peptide (9-mer) to a peptide derived from rabies virus glycoprotein (RVG) to facilitate electrostatic interaction with siRNA and specifically target acetylcholine receptors [22]. The 3

ACCEPTED MANUSCRIPT synthetic peptide fusion RVG-9R facilitated transvascular delivery of siRNA resulting in target specific gene silencing. However, presence of high density cationic charge on the carrier could lead to the formation of heterogeneous particles, non-specific

IP

T

biodistribution and lower yield of protein in suitable host systems [23-25].

RNA-recognition motifs conserved among double-stranded RNA-binding proteins

SC R

[26] lend their attributes to the design of modular fusion proteins. In a study using an arginine-rich peptide, tandem repeats of TAT was fused to the double-stranded RNA Binding Domain (DRBD) to electrostatically bind siRNA. The approach, although

NU

facilitating the delivery of siRNA into several primary cells including glioma [27] lacked cell-specificity. It is thus evident that multiple DRBD motifs fused with

MA

cationic peptides may not confer additional in vivo advantage due to their likely interaction with serum proteins, lack of target selectivity and tendency to aggregate. Very recently we have established the versatility of TARBP2 fusion protein whose

D

conformation-dependent binding to double-stranded RNA abolished the prerequisite

TE

of positively charged peptides. The strong binding interactions led to the formation of neutral nanosized complex which were stable upon systemic administration [25]. In

CE P

the current study, we have extended the approach to deliver siRNA albeit to the brain, by fusing the TARBP domain with a 12 amino acid peptide, having affinity towards GM1 and GT1b, with the hypothesis that these receptors by virtue of their natural abundance in neuronal cells [13, 28, 29] will permit the selective accumulation of

AC

TARBP-BTP: siRNA complex. The chimeric fusion protein designated as TARBPBTP was hence overexpressed, purified and investigated for its targeting and gene silencing potential in the brain.

2. Materials and methods 2.1 Materials Monoclonal Anti-Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) antibody (MAB374) was purchased from Millipore. Anti-CD31 (ab28364), anti-ganglioside GM1 (ab23943), anti- BACE1 antibody (ab2077) and goat anti-rabbit IgG H&L antibodies were purchased from Abcam. Alexa Fluor633 protein labeling kit, Alexa Flour647-Cholera toxin B (AF647-CTB) conjugate was obtained from Molecular Probes, Ni Sepharose 6 Fast Flow was procured from GE Healthcare. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) was purchased from Calbiochem, Non-essential amino acid and Sodium 4

ACCEPTED MANUSCRIPT pyruvate supplements were from Lonza. GM1 was purchased from Sigma-Aldrich. Silencer® GAPDH siRNA (AM4631) was purchased from Life Technologies. BACE1 siRNA of sequence [30], non-targeting control ON TARGET plus SMART pool and siSTABLE non -

T

targeting siRNA #1 were purchased from GE Dharmacon. Plasmid pET28a (Novagen) was

IP

amplified from laboratory stocks. LysoTracker® Red DND-99, Lipofectamine 2000® was purchased from Life Technologies. PrimeScript TM. 1st Strand cDNA synthesis kit and SYBR

SC R

green kit was purchased from DSS Takara. Vectashield mounting media was procured from Vector Laboratories, Inc. All other chemicals used were of highest purity.

NU

2.2 Design, cloning and purification of recombinant proteins

To construct recombinant TARBP-BTP fusion, gene sequence from TRAF [25]

MA

corresponding to the second domain (TARBP2/TRBP2) of the mammalian homolog, a linker sequence encoding five glycine residues and DNA fragment encoding the brain targeting peptide sequence [13] together with a C-terminal cysteine codon was amplified by

D

overlapping PCR. DNA duplexes with and without the targeting ligand were cloned in

TE

pET28a plasmid to generate N-terminal His-tagged fusion constructs that were verified.The selected recombinants were expressed in E.coli BL21(DE3) and were purified to

CE P

homogeneity using Ni-NTA affinity chromatography [31, 32]. Briefly, E.coli BL21(DE3) cells overexpressing the recombinant proteins were lysed under denaturing conditions using lysis buffer (50mM sodium phosphate buffer pH 7.4 containing 300mM NaCl, 10mM Tris, 6 M urea and 1mM PMSF) followed by sonication. Following centrifugation of the lysate at

AC

18,000 rpm for 20 min to pellet cell debris, the supernatant was incubated with the preequilibrated Ni-NTA sepharose matrix for 1 h. The matrix was then loaded onto a column and washed with 0.1 % Triton X-114 in lysis buffer at 4 ºC to remove the bacterial endotoxins [33]. The matrix bound TARBP-BTP and TARBP proteins were refolded under native conditions by on-column refolding and eluted using sodium phosphate buffer (pH 7.4) containing 300mM imidazole. The eluted fractions were pooled, desalted and buffer exchanged in phosphate buffered saline (PBS) pH 7.4 using Sephadex G25 superfine column and validated by western blotting and mass spectrometry.

2.3 Circular Dichroic Spectroscopy Far UV CD spectrum (range 250 -200 nm) of purified TARBP-BTP (0.1mg/ml in PBS (pH 7.4) was recorded at room temperature using JASCO-J-815 spectropolarimeter equipped with Jasco Peltier-type temperature controller (CDF-426S/15). The spectrum, acquired in a 1cm 5

ACCEPTED MANUSCRIPT path length cuvette, was an average of five scans that was corrected for the buffer baseline and plotted using Origin 7 software (OriginLabCorp.). Similar measurements were carried out with purified TARBP protein. Spectra were recorded in ellipticity mode at a scan speed of

T

50nm/min, response time of 2 sec, band width of 2nm and data pitch of 0.2nm. Mean residual

SC R

2.4 Binding, protection and serum stability

IP

ellipticity was calculated as described before [25].

The ability of TARBP-BTP fusion protein to bind and protect siRNA was assessed by agarose gel-based assays. The complex was prepared by incubating 20pmol of siRNA to

NU

increasing concentrations of TARB-BTP fusion protein in PBS buffer to obtain the desired mole ratios and incubated for 20 min prior to electrophoresis. For the protection assay, the

MA

complex with and without the targeting ligand were incubated for 20 min followed by treatment with RNase A for 1 h at 37 °C. Samples were then extracted by phenol: chloroform: isoamyl alcohol (25:24:1) and precipitated using ethanol as described previously

D

[25] and resolved by gel electrophoresis. The stability of TARBP-BTP complex was further

TE

assessed by preparing the complex in PBS or DMEM media plus 10% serum followed by incubation for 1-6 h at 37 ºC. siRNA was then extracted by phenol-chloroform and resolved

CE P

on 2% agarose gel and visualized by ethidium bromide staining. siRNA alone and TARBPBTP alone loaded in separate lanes serve as controls.

2.5 Cell culture

AC

Mouse neuroblastoma Neuro-2a cells [34] was maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with non-essential amino acids, sodium pyruvate (Lonza) and 10 % FBS. Human neuroblastoma IMR32 and human hepatoma HepG2 cell lines were maintained in DMEM supplemented with 10 % FBS. All complete growth media contained 60µg/ml penicillin, 5 µg/ml streptomycin and 3µg/ml kanamycin. Cells were maintained and incubated at 37

with 5% CO2.

2.6 Determination of relative ganglioside GM1 expression levels by confocal microscopy and fluorescence activated cell sorting (FACS) The GM1 levels in HepG2, IMR-32 and Neuro-2a cells were determined by immunocytochemistry and FACS. All three cell lines were seeded on cover slips and upon 70% confluence, cells were fixed with 4% formaldehyde in PBS followed by blocking for 20 minutes in 5% FBS in PBS. The cells were then washed with PBS and incubated for 12 h at 6

ACCEPTED MANUSCRIPT 4

with either Anti GM1 antibody (1:250) or Alexa Fluor647-Cholera toxin B (AF647-CTB)

(2 µg/ml), diluted in PBS containing 0.05% Tween 20. For Anti GM1 antibody, cells were further treated with the secondary antibody conjugated with Alexa Flour647 diluted in PBS

T

(1:500). Following incubation for 1 h at 4°C, cells were counterstained with Hoechst 33342

IP

and mounted using VECTASHIELD mounting medium and visualized by confocal microscopy. Cells treated similarly but without primary antibody, served as a control. For

SC R

relative quantification of GM1 by FACS, HepG2, IMR-32 and Neuro-2a cells (1x105) were treated with 2.25µg/ml AF647-CTB for 1 h at 37 ºC,washed with PBS, trypsinized and then

NU

analyzed using DakoCytomation MoFlo Ultra-High Speed Cell Sorter.

2.7 Uptake and competitive receptor-binding assay:

MA

Neuro-2a, HepG2, IMR-32 cells grown on coverslips to 70% confluence, were treated with complex consisting of 20 pmol of FAM/Cy3- labelled siRNA mixed with 100 pmol of TARBP-BTP and incubated for 3 h at 37 °C. Cells were then fixed with 4% formaldehyde

D

solution, counterstained with Hoechst 33342 and mounted in VECTASHIELD mounting

TE

medium and analyzed by confocal laser scanning microscopy (Leica TCS-SP8) under 63x oil immersion objective lens. Similarly, in a separate experiment, cells (1x105) were seeded and

CE P

treated the following day with 200nM siRNAFAM complexed with 5-fold molar excess of TARBP-BTP and incubated for 3h at 37°C. Following incubation, cells were washed with PBS, trypsinized and analyzed by FACS. In the receptor-binding competition assay, equimolar or 5-fold molar excess of AF647-CTB was simultaneously added and incubated for

AC

1 h at 37 °C following which cells were fixed and counterstained with Hoechst 33342 and visualized as described above.

2.8 Treatment of cells with exogenous GM1 HepG2 cells were seeded and grown to 70% confluence on coverslips and incubated overnight with serum-free medium containing 80µg/ml GM1 [35]. Following day, the cells were washed with PBS to remove non-cell associated GM1 and subsequently treated with labeled complex (TARBP-BTP: Cy3-siRNA) prepared at 5:1 mole ratio. In a parallel experiment, cells were incubated with 1µg/ml AF647–CTB for 1 h as a positive control for GM1 staining followed by fixing and visualization by confocal microscopy.

2.9 Toxicity assay 7

ACCEPTED MANUSCRIPT HepG2, IMR-32 and Neuro-2a cells (1 × 104 cells/well) were cultured in a 96-well plate at 37 °C, in complete medium and exposed to varying mole ratios of TARBP-BTP: siRNA or PBS of identical volume (untreated cells) and incubated for 24h. Following this, the media was

T

removed and cells were washed twice with PBS and incubated in MTT solution [36] for a

IP

further period of 3 h. The resultant formazan crystals were dissolved in dimethyl sulfoxide (100 µl) and A540 was measured (Multiskan spectrum, Thermo Electron Corporation). All

SC R

experiments were performed in triplicate, and the relative cell viability (%) was expressed was normalized to values obtained from untreated control cells.

NU

2.10 In vitro gene silencing

For cellular knockdown experiments, Neuro-2a cells (2x105) seeded in 12-well plate were

MA

treated with complexes prepared with either TARBP-BTP or TARBP and BACE1 siRNA (200nM) at 5:1 mole ratio and incubated for 3h. Similarly, cells were transfected in parallel with non-targeting control siRNA, naked BACE1 siRNA as a control. Lipofectamine LTX

D

complexed with BACE1 siRNA served as a positive control. Cells were further incubated for

TE

48h and the knockdown efficiency with and without the targeting ligand was examined with

CE P

ABI 7900HT Real time PCR system (Applied Biosystem) as described in section 2.12.

2.11 In vivo studies

All the animal experiments were conducted in accordance with protocols approved by the Institute’s Animal Ethics Committee (IAEC) vide project # 81/2014. C57BL/6 and transgenic

AC

APP-PS1 mice [37] were obtained from the Jackson Laboratory, USA. The animals were bred, and maintained at the CCMB animal house facility. APP-PS1 mice of age 10-12 months were used in the study, as these mice show signs of significant plaque deposits at 9 months besides neurological and behavioral symptoms [38] comparable to human AD subjects [37].

2.11.1 Distribution of TARBP-BTP complex in vivo Alexa Fluor633 labeled TARBP-BTP was used to monitor the biodistribution of the complexes in vivo. TARBP-BTP was labeled with Alexa Fluor633 using Alexa Fluor633 protein labeling kit (Molecular Probes) according to manufacturer’s protocol. Briefly, complex containing 8.75 nmol of Alexa Fluor633-labeled TARBP-BTP and 1.75 nmol of siRNA (5:1) in 200l, equivalent to 0.5mg/kg body weight was injected intravenously into 10 month AD mice 8

ACCEPTED MANUSCRIPT (ΑβPP-PS1). The animals were euthanized after 6 h and the organs were collected and snap frozen in liquid nitrogen. The organs mounted in OCT medium were cryosectioned to 8µm thickness in a cryostat (Leica), fixed in isopropanol for 5 min at room temperature and

T

subjected to immunostaining or counterstained with Hoechst and visualized by fluorescence

IP

confocal microscopy. For immunostaining, the fixed brain sections were blocked in 5% BSA for 30 min followed by incubation with CD31 antibody diluted in PBS containing 0.05%

SC R

Tween 20 (1:300) for 12 h at 4°C. The sections were washed and incubated with Alexa Fluor488-conjugated secondary antibody followed by nuclear counterstain by Hoechst 33342. To remove general background fluorescence and autofluorescence resulting from fixing

NU

procedures and lipofuscin, brain sections were treated with freshly prepared 1% NaBH4 in PBS for 20 min before immunostaining, following immunostaining the sections were

MA

incubated in 1mM CuSO4 in 50mM ammonium acetate solution pH 5.0 for 1 h [39]. The authenticity of the fluorescence signal arising in 633-laser line was confirmed by xyƛ scan option in Leica TCS-SP8 confocal microscope. Briefly, the emission spectra of the sections

D

excited with 633-laser line were taken from 640 nm to 690 nm and compared with the

TE

emission spectra of Alexa Fluor 633-TARBP-BTP under similar instrument settings.

CE P

2.11.2 Gene silencing in vivo upon intravenous delivery Either C57BL/6 of 8-10 weeks or APP-PS1 transgenic mice of 10-12 months age were used for all the experiments. For GAPDH knockdown experiments, mice were randomly divided

AC

into two groups, each group receiving either PBS or TARBP-BTP: siRNA complex. For BACE1 knockdown, additionally, two groups of C57BL/6 mice receiving naked BACE1 siRNA or TARBP-BTP: non targeting control siRNA were included. For in vivo delivery, 20 nmol TARBP-BTP in a volume of 100l was added drop wise to equal volume of PBS buffer containing 4 nmol of corresponding siRNA maintained at 5:1 mole ratio. The effective dose of siRNA administered systemically is 1.3mg/kg and 2.3 mg/kg body weight in APP-PS1 and C57BL/6 mice respectively. The complex was incubated for 20 min at room temperature and administered intravenously via the lateral tail vein. After 48h mice were euthanized and the brain parts were dissected, washed in PBS and further analyzed by qRTPCR and Western blotting.

2.11.3 Immunoblotting 9

ACCEPTED MANUSCRIPT Radio Immunoprecipitation Assay buffer (RIPA, 50mM Tris.HCl pH 8.0, 150mM NaCl, 2mM EDTA,1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) containing protease inhibitor cocktail (G-Biosciences) was added to tissues and homogenized using handheld

T

homogenizer. Following sonication and centrifugation to remove insoluble debris, the protein

IP

content in the lysates were estimated using modified Lowry’s method [40] and 50 µg of protein was loaded in each well and resolved by SDS-PAGE gel electrophoresis and

SC R

transferred to nitrocellulose membrane. The membrane was subsequently blocked with BSA and probed with the respective primary antibody followed by secondary antibody conjugated with HRP. The blot was visualized by chemiluminescence using Pierce® ECL Western

NU

Blotting Substrate (Thermo Scientific).

MA

2.12 Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) Total RNA was isolated from cells, various parts of the brain and other organs using RNAiso plus (Takara Bio Inc.) according to the manufacturer’s protocol and quantitated by UV

D

absorption. 1 µg of RNA was converted to cDNA using Primescript™ first strand cDNA

TE

synthesis kit (Takara Bio Inc.) and oligo dT in a reaction volume of 20 µl. qRT-PCR was performed in ABI 7900HT Real time PCR system (Applied Biosystem) in a final volume of

CE P

10 µl using SYBR® Premix Ex Taq™ (Tli RNase H Plus) (Takara Bio Inc.). The reaction included 1l each of 1pmol/µl forward and reverse primers and 2 µl of cDNA corresponding to 25 ng of total RNA. DNA melting curve analysis was performed to check the specificity of

AC

the amplification. The data was analyzed by comparative CT method.

The sequences of primers used are as follows: Mouse GAPDH Forward: ATGGCCTTCCGTGTTCCTA Mouse GAPDH Reverse: TGAAGTCGCAGGAGACAACCT Mouse -actin Forward: AGTGTGACGTTGACATCCGTA Mouse -actin Reverse: GCCAGAGCAGTAATCTCCTTCT Mouse BACE1 Forward: CATTGCTGCCATCACTGAAT Mouse BACE1 Reverse: CAGTGCCTCAGTCTGGTTGA

2.13. Statistical analysis 10

ACCEPTED MANUSCRIPT All in vitro experiments were done in triplicate and graphs were represented using the Origin 7.0 software. Two tailed Student’s t tests were conducted appropriately to determine if significant differences occur between groups. For in vivo experiments, P<0.05 was

IP

T

considered significant.

3. Results

SC R

3.1 Characterization of recombinant TARBP-BTP fusion protein

TARBP having high affinity to double-stranded RNA (dsRNA) [25, 26] was fused to a ganglioside targeting peptide sequence, originally selected by phage display for

NU

GT1b [13] and GM1 [14] binding, with the rationale of targeting the brain to deliver siRNA. Termed as TARBP-BTP (123 amino acids), the fusion protein and the

MA

corresponding variant TARBP (106 amino acids), devoid of the targeting ligand were sub cloned as described in methods. The overall approach is depicted as a schematic (Fig. 1a). TARBP-BTP, a 13.378kDa N-terminus -tagged fusion protein was verified

D

by Western blotting (Fig. 1b) and matrix-assisted laser desorption ionization

TE

(MALDI) (Fig. 1c). Further, far-UV circular dichroism spectroscopy (Fig. 1d) suggested a well-defined secondary structure, consisting of both α-helices and β-

CE P

pleated sheets [25]. Binding of the fusion protein to siRNA indicated strong association and formation of homogenous non-covalent complex that upon electrophoresis indicated strong binding and near-complete masking of siRNA at 2.5:1 mole ratio with maximal binding at 5:1 mole ratio (Fig. 1e). At these ratios, the

AC

complex was resistant to degradation by RNaseA (Fig. 1f) and serum (not shown). Lack of binding to duplex DNA of similar length (not shown) reflects the ability of TARBP-BTP to bind dsRNA in a conformation-specific manner, an attribute essential for in vivo stability of the carrier. The variant, TARBP of molecular mass 11.534kDa exhibited similar binding characteristics (data not shown).

3.2 TARBP-BTP complex bind ganglioside GM1 3.2.1 Assessment of GM1 levels We first assessed GM1 levels in three different cell lines namely Neuro-2a, IMR32 and HepG2 by immunostaining using anti-GM1 antibody (Fig. 2a) and fluorescence activated cell sorting (FACS) using AF647-CTB (Fig. 2b). CTB is a useful indicator of GM1 levels due to its high binding affinity[41]. It is evident that the relative GM1 expression levels are of the rank order: Neuro-2a (67%) >> IMR32 (25%) cells > 11

ACCEPTED MANUSCRIPT HepG2 (0.1%) cells, Fig. 2b. The intense fluorescence in the plasma membrane and the cytoplasmic matrix in Neuro-2a, Fig. 2a clearly correlate with GM1 levels that were ascertained by FACS in all three cell lines (Fig. 2b). Isotype controls tested with

AC

CE P

TE

D

MA

NU

SC R

IP

T

each of these cells were found to be negative (data not shown).

Fig. 1. Characterization of recombinant TARBP-BTP fusion protein: a) Schematic of the construct TARBP-BTP and overall strategy. NC: Non-covalent complex, b) SDS gel electrophoresis followed by Western blotting of purified TARBP-BTP (13.378kDa) and the variant TARBP (11.53kDa), devoid of the targeting ligand using anti-his tag antibody along with protein molecular weight markers (MWM). c) Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) of TARBP-BTP. The major peak of predicted mass 13.378kDa, devoid of the N-terminal methionine, matches with the predicted size 13.527 kDa since N-terminal methionine is cleaved by methionylaminopeptidase upon overexpression, d) Far UV-Circular dichroic spectra of TARBP-BTP in PBS buffer, e-f) Agarose gel binding assays of complex consisting of 20 pmol siRNA and increasing mole concentration of TARBP-BTP fusion protein to obtain the mole ratio specified above each lane. Samples in f) were treated with RNaseA and extracted with phenol and resolved by agarose gel electrophoresis following extraction by phenol and electrophoresed. siRNA in e and f were visualized as bands by UV indicate the extent of protection as described in the methods section.

12

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

Fig. 2a. Determination of GM1 levels in Neuro-2a, IMR32 and HepG2 cells by immunocytochemistry and fluorescence confocal microscopy. a) Representative images of cells treated with either antiGM1 antibody (top panel) or CTB (Alexa Fluor 647-Cholera Toxin Bred) (bottom panel).

Fig. 2b) Relative levels of GM1 quantitated by flow cytometry using Alexa Fluor647-CTB and compared with cell controls. Details as described in methods. Graph represents data from two independent experiments n=2.

3.2.2 TARBP-BTP recognizes ganglioside GM1 Having ascertained the cellular GM1 levels, we next evaluated the ability of TARBPBTP complex to recognize GM1. The complex was prepared at 5:1 mole ratio, since maximal binding and protection of siRNA was observed, (Fig. 1e and f), as described 13

ACCEPTED MANUSCRIPT in methods and added to Neuro-2a, IMR32 and HepG2 cells exhibiting varying levels of GM1. Following 3h incubation, cellular entry with strong membrane-associated fluorescence was seen (Fig. 3). The lack of fluorescence in HepG2 cells is anticipated

T

since these cells have very little GM1. This was also supported in a FACS-based

IP

uptake assay evaluated in Neuro-2a, IMR32 and HepG2 cells using FAM-labeled siRNA complexed with TARBP-BTP. In such a scenario, 59.76%, 40.4% and 7.92%

SC R

of cells respectively were found to be FAM-positive clearly indicating that uptake is GM-1 dependent. Absence of fluorescence in cells treated with TARBP, devoid of the targeting ligand, incubated for the entire 3h incubation period (Supporting

NU

information Fig. S1) clearly indicates the requirement of the targeting ligand for mediating interactions with GM1. Furhter, in a functional knockdown assay in vitro

MA

in Neuro-2a cells, having the highest levels of GM1, TARBP-BTP:siRNA mediated 41% knockdown of BACE1 mRNA levels (Supporting information Fig. S2). In comparison, TARBP: siRNA treated cells showed no changes in mRNA levels, which

D

suggests the requirement of the targeting ligand for cell uptake and consequent gene

TE

silencing.

AC

CE P

a

Fig. 3a. Uptake of TARBP-BTP: siRNA complex in Neuro-2a, IMR32 and HepG2 cells Cells were treated with the complex consisting of 100 pmol TARBP-BTP: 20pmol FAM/Cy5- siRNA at 5:1 mole ratio and incubated for 3 h. Representative confocal images in (a) depict siRNA (pseudocolored green) and nuclei (blue) stained with Hoechst 33342. Scale bar=25m. (b) FACS profile of cells treated (green trace) with 200nM of siRNAFAM + 5-fold molar excess of TARBP-BTP.

14

ACCEPTED MANUSCRIPT We also performed the receptor-binding assay using AF647-CTB as a molecular competitor that binds GM1 [41, 42]. Neuro-2a and IMR32 cells were treated simultaneously with AF647-CTB and TARBP-BTP complex as described in the

T

methods section. Addition of CTB at 5-fold lower concentration than TARBP-BTP

IP

led to partial cell association (~50%) of complex in Neuro-2a cells (Fig. 4a) (top panel). Treatment with equimolar amounts of CTB and TARBP-BTP examined in

SC R

either Neuro-2a or IMR32 cells led to near-complete loss of binding as reflected by distinct fluorescence (Fig. 4b) reflecting interaction with GM1. TARBP-BTP complex was also found to be non-toxic to cells when evaluated in an MTT cell-

AC

CE P

TE

D

MA

NU

viability assay, which indicated ~90% viability at all the ratios examined (Fig. 5).

Fig. 4. Receptor-binding competition assay by confocal microscopy: Neuro2a and IMR32 cells were treated with TARBP-BTP: siRNAFAM- complex (green) at 5:1 mole ratio and concurrently treated with either a) 20 pmol (top panel) or b) 100 pmol of AF647–CTB (red) (middle and bottom panel) following incubation for 1 h. Cells were processed as described in the text. 63x mag. Scale bar=25m

15

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

D

MA

Fig. 5: Evaluation of cell viability: Cells were treated with TARBP-BTP: siRNA complex for 24h and assessed in the presence and absence of siRNA at the indicated mole ratios using MTT. Cells treated with PBS alone, as described in the methods, were considered as controls having 100% viability from absorption values measured using reduced formazan. Error bars indicate standard deviation of triplicate sets.

TE

3.2.3 Role of GM1

To conclusively establish the requirement of GM1, we performed an assay wherein

CE P

GM1 was exogenously added to HepG2 cells deficient in GM1. Since ganglioside GM1 is a lipid, it can be experimentally incorporated in membranes [35] through the incubation of external GM1 to simulate GM1 positive cells and analyzed using CTB as a positive control. HepG2 cells were first pretreated with GM1 [35], as described in

AC

methods and then treated with the complex. It is evident that under these conditions, cells treated with TARBP-BTP complex clearly exhibited membrane associated fluorescence compared to untreated cells (Fig. 6) reiterating target specificity of TARBP-BTP. The corresponding panel below depicts CTB binding to membraneintegrated GM1 added exogenously in the assay.

16

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

CE P

TE

Fig. 6: Effect of exogenous GM1 in GM1-deficient HepG2 Representative fluorescence images of HepG2 cells treated with 80 µg/ml GM1 overnight, in serum-free media, followed by treatment with either TARBP-BTP: siRNACy3 complex (green) or AF647-CTB (red) for 1 h (right panels). Scale bar=75m

3.3 In vivo studies

3.3.1Distribution of fluorescent TARBP-BTP: siRNA in ΑβPP-PS1 mouse brain upon intravenous delivery

AC

The specificity of TARBP-BTP was further tested for its in vivo potential to cross the BBB. This was executed by administering fluorescent complexes that were prepared by mixing corresponding amounts of AF633-TARBP-BTP and siRNA at 5:1 mole ratio. Mice injected with the same volume of PBS served as negative controls. Mice were euthanized 6h post delivery of the complex and all the major organs, including brain were dissected, sectioned and visualized. Even though AF633 signal originating from the labeled protein enabled collection of fluorescent signals in the far-red spectrum with minimum background noise, non-specific fluorescence arising from all laser lines in the brain sections (Supporting information Fig. S3 a-c) was eliminated by NaBH4 and CuSO4 treatment of tissue sections as described in the methods. In the representative brain sections of mice injected with Alexa Fluor633-TARBP-BTP: siRNA complex, the localization of fluorescent complex is distinctly visible in the cerebral cortex and the hippocampus region (Fig. 7a) (boxed area), (Supporting 17

ACCEPTED MANUSCRIPT information Fig S3a-c) which clearly indicates transcytosis of the complex across the BBB. To authenticate that the observed signal arising from the 633nm laser line is from the labeled protein, the emission spectrum was matched with that of AF633-

T

TARBP-BTP fusion protein spotted separately on a coverslip, using  scan option in

IP

Leica SP8 (Supporting information Fig. S3d). In contrast, the lack of fluorescence in the lung, liver and intestine (Fig. 7b) and other organs such as the heart and spleen

SC R

(not shown) indicated target specificity of TARBP-BTP. Fluorescence depicted in a different region of the brain i.e. brain cortex, is shown in (Supporting information Fig. S4). Representative sections stained with CD31 mark the endothelial cells of the

NU

brain capillaries (Fig. 7a) and (Supporting information Fig. S4) (bottom panel). Significant Alexa Fluor633 fluorescence originating from kidney tissue sections (Fig.

MA

7b) and urine (data not shown) indicated excretion of the labeled complex through renal filtration.

D

3.3.2 TARBP-BTP mediates RNAi in the mouse brain

TE

To further evaluate the functionality of TARBP-BTP and ascertain the ability to mediate RNAi across the BBB, we then delivered the complex to target GAPDH, an

CE P

endogenous housekeeping gene. We injected TARBP-BTP: GAPDH siRNA complex (20 and 4 nmol respectively) into APP-PS1 mice via the tail vein. Mice were euthanized 48 h post injection and evaluated for GAPDH mRNA levels in various

AC

brain tissues and other major organs by qRT-PCR (Supporting information Fig. S5a-c). It is evident that a single injection resulted in ~40% and ~20% reduction in GAPDH mRNA levels in the hippocampus and cerebral cortex respectively. Analysis of tissue lysates by western blotting indicated modest decrease in protein levels (Fig. S4c). Strikingly, under these experimental conditions, no significant change in mRNA levels was observed in the other brain regions namely olfactory bulb, striatum, prefrontal cortex (Fig. S4a-b). Moreover, we also did not observe any silencing of GAPDH in other tissues such as the lung, liver spleen and kidney (Fig S4a-b). Similar experiments conducted in C57BL/6 mice upon systemic delivery of the complex resulted in a modest knockdown (~25%) in GAPDH mRNA levels in the hippocampus and cerebral cortex. As in the AD mice, we did not observe any gene silencing in the other organs as depicted (Supporting information Fig. S5b).

18

ACCEPTED MANUSCRIPT

MA

NU

SC R

IP

T

a

AC

CE P

TE

D

b

Fig. 7: Biodistribution of systemically delivered TARBP-BTP: siRNA complex in APP- PS1 mouse brain 6 h post delivery. a) Partial projection of a representative tile scan of the mouse brain depicts strong fluorescence (AF633) in the hippocampus (boxed) and cerebral cortex (white arrows) in the top panel. The brain slice (8m thickness) was imaged using confocal microscopy with 40x Objective. The panels below depict the scan of the boxed expanse where fluorescence of brain microvessels stained with anti-CD31 antibody was visualized using secondary antibody tagged with Alexa Fluor 488 (AF488) (green). NaBH4 and CuSO4 treatments as described in methods section were crucial to the removal of autofluorescence. b) Organ biodistribution of TARBP-BTP: siRNA complex. Representative confocal images depict strong fluorescence in the kidney unlike lung, liver and intestine. Scale bar = 0-250m (top panel) and 0-100m (bottom panel). Note: Uninjected control brain sections did not show any autofluorescence upon NaBH 4 and 3.4.2 mediates RNAi in the mouse brain CuSOTARBP-BTP 4 treatments (data not shown).

19

ACCEPTED MANUSCRIPT Based on its role in the disease pathogenesis, we next targeted BACE1 since increased BACE1 activity is associated with neurodegeneration and accretion of amyloid precursor protein (APP) products [43]. We intravenously delivered TARBP-BTP complex prepared

T

with BACE1 siRNA at 5:1 mole ratio in both APP-PS1 and C57BL/6 mice and evaluated

IP

48h post administration by qRT-PCR and western blotting. In addition to PBS control, naked BACE1 siRNA and TARBP-BTP complexed with non-targeting control siRNA was also

SC R

injected into C57BL/6 mice. A single dose delivered intravenously in C57BL/6 mice (Fig. 8a-c) caused significant reduction in BACE1 mRNA levels i.e. 35%, 47%, 38% and 48% in the cortex, hippocampus, prefrontal cortex and olfactory bulb respectively. BACE1 mRNA

NU

levels in APP-PS1 mice indicated 35%, 43%, 24% and 50% reduction in the cortex, hippocampus, olfactory bulb and striatum respectively (p<0.05, except for hippocampus of

MA

APP-PS1 where p=0.078). The observed reduction in BACE1 mRNA levels evidently signifies in vivo brain targeting potential of TARBP-BTP, an exceptional carrier of siRNA. BACE1 mRNA levels in liver, lung, kidney and spleen (Fig. 8b-c) were unaltered. The two

D

additional controls i.e. naked BACE1 siRNA and non-targeting siRNA showed no significant

TE

changes in the BACE1 mRNA levels, which indicated that the observed reduction in BACE1 mRNA levels mediated by TARBP-BTP in the brain is significant. Put together, the proof-of-

CE P

concept experiments clearly indicate a) the in vivo stability, b) tissue-specific targeting across

brain.

AC

the BBB and importantly c) successful delivery of either GAPDH or BACE1 siRNA in the

20

TE

D

MA

NU

SC R

IP

T

ACCEPTED MANUSCRIPT

AC

CE P

Fig. 8: In vivo gene silencing of BACE1 mediated by TARBP-BTP: BACE1 mRNA levels of the different brain regions and organs were measured by qRT-PCR. a) 8-10 week old wild type C57BL/6 mice 48 h after i.v. injection with 20 nmol TARBP-BTP complexed with 4nmol BACE1 siRNA (5:1 mole ratio) and compared with mice injected with complex containing 4nmol siSTABLE non-targeting control siRNA #1 or 4nmol naked BACE1 siRNA. b) BACE1 mRNA levels in organs of 8-10 week old wild type C57BL/6 mice injected with TARBP-BTP: BACE1 siRNA. c) BACE1 mRNA levels in 10-12 month APP-PS1 mice 48 h after i.v. injection with 20 nmol TARBP-BTP complexed with 4nmol BACE1 siRNA (5:1 mole ratio). The values were normalized to respective PBS control (100%). -Actin served as an internal control for all qRT-PCR experiments. d) Western blots of representative lysates from tissues obtained in (a and c) depict protein levels of the corresponding tissues. n=3 for each group. C=Control mice, T=Mice treated with TARBP-BTP: BACE1 siRNA complex. (* p<0.05 were considered statistically significant when compared to PBS control group. NS=not significant).

4. Discussion With a growing complexity of wide-ranging therapies that can effectively modulate gene expression, it is now conceivable to deliver siRNA [44] practically to any tissue. Limitations of delivery systems comprising cationic lipids, peptides or dendrimers discovered in the early stages of non-viral vector development [17] have culminated in combinatorial approaches with design concepts tailored to generate colloidal macromolecules [45-47] for efficient drug and nucleic acid delivery. Rationally designed peptide-based delivery systems [48-51] being simplistic in design with 21

ACCEPTED MANUSCRIPT minimal essential elements, such as the one described in this study, is a relatively straightforward approach. Collectively, these carriers comprise features that are physiologically vital to outweigh the negative effects experienced during noninvasive

IP

T

delivery upon in vivo delivery.

Transvascular delivery of biological drugs encompassing nucleic acid therapeutics is

SC R

challenged by the complexities of blood brain barrier, which is essentially a polarized layer of endothelial cells bridged by tight junctions and astrocytes, restricting access of large molecules [50]. The development of multi-functional delivery systems to

NU

overcome these barriers and target neurological disorders by RNAi across the BBB is moreover linked to a) design, b) in vivo stability and their c) in vivo transcytotic

MA

potential. In contrast to small molecule drugs where physicochemical factors such as lipophilicity and size play a major role [10], the utility of multi-functional platforms enable the delivery of diverse and larger biomolecules to neuronal receptors [22, 30]

D

differentially enriched in the nervous system [14, 28, 52]. With these essential

TE

requirements, in a simplistic approach, we sought to generate the chimeric fusion protein namely TARBP-BTP to enhance the aforesaid properties. Besides having high

CE P

affinity to siRNA, the ability to elicit RNAi in the mouse brain suggests possible transcytotic potential of TARBP-BTP, similar to the earlier study[14]. The RNA-binding scaffold, with  fold is common to all the double-

AC

stranded RNA binding proteins, binding preferentially to A-form dsRNA than the B form with a reported binding constant of 113nM [26]. In a recent study, fusion protein TRAF demonstrated excellent structural stability and similar affinity to siRNA[25]. Based on the aforementioned studies, we envisage the TARBP-BTP, with a structurally related fold to exhibit similar domain function, stability and release properties [25]. Besides the binding of TARBP-BTP to dsRNA (22-23mer siRNAs) and not to DNA duplex of similar length, indicates conformation-specific binding to siRNA and complete protection of siRNA at 5:1 mole ratio. Although a fraction of the free protein is likely to remain at this ratio upon systemic administration, dilution due to mixing of the complex in blood may not affect the successful encounter of the complex with the target as observed in the functional in vivo experiments. Importantly, we have demonstrated GM1 selectivity of TARBP-BTP. In contrast to

22

ACCEPTED MANUSCRIPT the observations in neuronal cells, the association of the complex to GM1-treated HepG2 cells suggests that insertion of the exogenous glycolipid into the membrane may have facilitated the interaction with the cells reiterating the role of GM1.

T

Although TARBP binds siRNA, the lack of the targeting peptide limits cell entry and

IP

thereby the gene silencing potential.

SC R

Glycolipids are unusually enriched in caveolae and abundantly present in the nervous system [28] [53, 54] in all vertebrates. GM1 is also considered a marker of lipid rafts due to its enrichment in lipid microdomains and as the cell-surface receptor for CTB

NU

[55-57] and anti-GM1 antibodies [58]. Several bacterial toxins such as cholera toxin (CTB) bind to GM1 with high affinity. Three other major gangliosides GD1, GD1b

MA

and GT1b together with GM1 [58] encompass the major species of gangliosides in the brain. The ability of TARBP-BTP to bind gangliosides other than GM1 has not been explored. It is plausible that the brain targeting peptide (BTP) would potentially

D

display GT1b binding characteristics, which along with GM1 binding may explain the

TE

region-specific localization and concomitant gene silencing under the conditions examined, and which is being further investigated. Using monoclonal antibodies,

CE P

Kotani et al. [52] have demonstrated the enrichment of GT1b in the molecular and granular layer besides dense staining of GM1 in the cerebral cortex. In a previous study, GM1was demonstrated to function as the transcytotic receptor. Moreover, the peptide also demonstrated GT1b receptor binding and brain targeting when

AC

administered via the intracarotid artery [14]. In an ensuing study using a different route of administration (the intravenous route) localization was additionally observed in the lungs [15]. Furthermore, accumulation of PEG derived G23-polymerosomes observed in the spleen and liver is challenged by observations made with PEG derivatives [59] that are known to reduce uptake by these organs. This decreased selectivity of the polymerosomes is however not clear. Receptor-binding competition assays clearly demonstrate that TARBP-BTP and CTB compete for binding GM1 in vitro. Moreover, systemic in vivo delivery of BACE1 siRNA targeting a valid therapeutic gene resulted in target specific gene silencing in various regions of the brain. The absence of knockdown in the lung, liver and spleen clearly indicated the specificity of TARBP-BTP to GM1. We believe that GM1 present on the luminal surface of brain endothelial cells [14] may function as cellular entry portals for internalization of serum-stable peptide-bound cargo possibly by receptor-mediated 23

ACCEPTED MANUSCRIPT transcytosis. In a subsequent event, distribution of complex in GM1-enriched cells in the brain regions may have led to the release of siRNA in the cytoplasm elicited as by BACE1 knockdown. TARBP-BTP-mediated knockdown of BACE1 substantiates the

T

functional efficacy of the released siRNA leading to therapeutic gene silencing in the

IP

specified brain regions. This is a clear reflection of the in vivo stability and functional efficacy of TARBP-BTP as an excellent carrier. Although the observed reductions are

SC R

modest 30-50% for BACE1 and we believe that repeated administration, a precondition for treatment of AD may be necessary to elicit the desired pharmacological effect and which remains to be tested. Towards understanding BBB,

NU

a previous report indicated no extensive BBB damage or permeability in 6-13 month APP-PS1 [60], which suggest that these aspects need to be further explored while

MA

developing carriers as brain therapeutics. Nevertheless, APP-PS1 mice being one of the most suitable model to study AD pathology and prognosis, establishes here the noteworthy potential of the chimeric protein as a robust single-component mediator of

TE

D

RNAi that is a promising approach towards anti-amyloid therapy.

Therapeutic Implications: Modulating protease targets by RNAi

CE P

Extracellular accumulation of neurotoxic Aβ peptide, manifested by loss of memory and cognitive decline, is the hallmark of Alzheimer’s disease (AD) where degeneration of the cerebral cortex and hippocampus leads to loss of cognitive function, learning and memory. Based on a multi-state probabilistic model for the

AC

occurrence and disease progression, Alzheimer’s disease is predicted to affect 1 in 85 people globally by 2050 [61] which is a major challenge. Although RNAi is recognized as a potential treatment strategy [62], the absence of suitable delivery systems is the current blockage for achieving sustained and effective targeting of brain tissues. Besides the polarized layer of endothelial cells that separates blood from the brain tissue limits access of anionic molecules to the brain. Approaches to reduce the buildup of Amyloid-beta (A), explored by several groups [63, 64], appear promising. Additionally, inhibiting genes implicated in increasing the levels of Aβ peptides, without affecting other key cellular functions, by targeted RNAi may be a prospective alternative strategy [65] that is testable.

24

ACCEPTED MANUSCRIPT When considering the translational value, the system presented here could have an advantage over the other delivery systems because of its design simplicity, retention of the functional attributes upon convenient production from bacterial systems. We

T

surmise that efficient transport of siRNA against amyloid--lowering protease targets

IP

may lead to a promising outcome, which mandates further exploration of the delivery system by analyzing the memory and brain energy metabolism ensuing successful

SC R

RNAi. It is envisaged that the strategy in principle, can work across similar neurological conditions of the brain, which remains to be explored.

NU

5. Conclusions

The data presented here suggest the potential application of recombinant TARBP-

MA

BTP fusion protein as a carrier designed for the therapeutic delivery of siRNA into the mouse brain. We surmise that as a preventive strategy, the choice of suitable siRNAs to amyloid--lowering protease targets, using this carrier would lead to a promising

Acknowledgements

TE

D

outcome, which mandates further exploration in this direction.

CE P

Financial support from the Board of Research in Nuclear Sciences (DAE) Mumbai, India (Grant # 37(1)/14/51/2014-BRNS/1555) and support in part from the Council of Scientific and Industrial Research (CSIR, India) Network project BioAGE (BSC0208)

AC

is gratefully acknowledged. Technical assistance from S. Venugopal is highly appreciated. The authors thank Shruti Sriramkumar, Pooja Yadav, and Aabid Shah for preparing the constructs and initial characterization. We also thank Saad Mohammad Ahsan and Y Thasneem for help with CD measurements, G. Srinivas for help with flow cytometry, T. Avinash Raj for cryosectioning the tissues, Jedy Jose for the animal dissections and Y. Kameshwari for determining the molecular mass.

References [1] Gregory J. Hannon JJR. Unlocking the potential of the human genome with RNA interference. Nature. 2004;431:371-8. [2] Daniel H. Kim JJR. RNAi mechanisms and applications. BioTechniques. 2008;44:613-6. [3] Antonin de Fougerolles H-PV, John Maraganore & Judy Lieberman. Interfering with disease: a progress report on siRNA-based therapeutics. Nature Reviews Drug Discovery. 2007;6:443-53.

25

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

[4] Kathryn A. Whitehead RLDGA. Knocking down barriers: advances in siRNA delivery. Nature Reviews Drug Discovery. 2009;8:129-38. [5] MA B. Chemical modification of siRNAs for in vivo use. Oligonucleotides. 2008;18:305-19. [6] Joao T Marques BRGW. Activation of the mammalian immune system by siRNAs. Nature biotechnology. 2005;23:1399-404. [7] Sioud M SD. Cationic liposome-mediated delivery of siRNAs in adult mice. Biochem Biophys Res Commun. 2003;312:1220-5. [8] Katalin Karikó PB, John Capodici, Drew Weissman. Small Interfering RNAs Mediate Sequence-Independent Gene Suppression and Induce Immune Activation by Signaling through Toll-Like Receptor 3. The Journal of Immunology. 2004;172:65459. [9] Shi N, Pardridge WM. Noninvasive gene targeting to the brain. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:7567-72. [10] Pardridge WM. Drug and gene targeting to the brain with molecular Trojan horses. Nature reviews Drug discovery. 2002;1:131-9. [11] Boado RJ, Zhang Y, Wang Y, Pardridge WM. Engineering and expression of a chimeric transferrin receptor monoclonal antibody for blood-brain barrier delivery in the mouse. Biotechnology and bioengineering. 2009;102:1251-8. [12] Larocca D BM, Jensen-Pergakes K, Ravey EP, Gonzalez AM, Baird A. Evolving phage vectors for cell targeted gene delivery. Curr Pharm Biotechnol. 2002;3:45-57. [13] Liu JK TQ, Garrity-Moses M, Federici T, Tanase D, Imperiale MJ, Boulis NM. A novel peptide defined through phage display for therapeutic protein and vector neuronal targeting. Neurobiology of disease. 2005;19:407-18. [14] Georgieva JV, Brinkhuis RP, Stojanov K, Weijers CA, Zuilhof H, Rutjes FP, et al. Peptide-mediated blood-brain barrier transport of polymersomes. Angewandte Chemie. 2012;51:8339-42. [15] Stojanov K, Georgieva JV, Brinkhuis RP, van Hest JC, Rutjes FP, Dierckx RA, et al. In vivo biodistribution of prion- and GM1-targeted polymersomes following intravenous administration in mice. Molecular pharmaceutics. 2012;9:1620-7. [16] Shubiao Zhang BZ, Huiming Jiang, Bing Wang, Baichao Ma. Cationic lipids and polymers mediated vectors for delivery of siRNA. Journal of Controlled Release. 2007;123. [17] Gopal V. Bioinspired peptides as versatile nucleic acid delivery platforms. Journal of controlled release : official journal of the Controlled Release Society. 2013;167:323-32. [18] Lönn P DS. Cationic PTD/CPP-mediated macromolecular delivery: charging into the cell. Expert Opin Drug Deliv 2015. [19] Serramia MJA, S. Fuentes-Paniagua, E. Clemente, M. I. Sanchez-Nieves, J. Gomez, R. de la Mata, J., Munoz-Fernandez MA. In vivo delivery of siRNA to the brain by carbosilane dendrimer. Journal of controlled release : official journal of the Controlled Release Society. 2015;200:60-70. [20] Gooding M, Browne LP, Quinteiro FM, Selwood DL. siRNA delivery: from lipids to cell-penetrating peptides and their mimics. Chemical biology & drug design. 2012;80:787-809. [21] Andaloussi SE, Lehto T, Mager I, Rosenthal-Aizman K, Oprea, II, Simonson OE, et al. Design of a peptide-based vector, PepFect6, for efficient delivery of siRNA in cell culture and systemically in vivo. Nucleic acids research. 2011;39:3972-87.

26

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

[22] Kumar P, Wu H, McBride JL, Jung KE, Kim MH, Davidson BL, et al. Transvascular delivery of small interfering RNA to the central nervous system. Nature. 2007;448:39-43. [23] Schneider B GM, John M, Haas A, Bramlage B, Ickenstein LM, Jahn-Hofmann K, Bauss F, et al. Targeted siRNA Delivery and mRNA Knockdown Mediated by Bispecific Digoxigenin-binding Antibodies. Mol Ther Nucleic Acids. 2012;1. [24] Fiedel BA RR, Myhrman R, Gewurz H. Complement activation by interaction of polyanions and polycations. Immunology. 1976;30:161-9. [25] Dar GH, Gopal V, Rao M. Conformation-dependent binding and tumor-targeted delivery of siRNA by a designed TRBP2: Affibody fusion protein. Nanomedicine : nanotechnology, biology, and medicine. 2015;11:1455-66. [26] Yamashita S, Nagata T, Kawazoe M, Takemoto C, Kigawa T, Guntert P, et al. Structures of the first and second double-stranded RNA-binding domains of human TAR RNA-binding protein. Protein science : a publication of the Protein Society. 2011;20:118-30. [27] Eguchi A, Meade BR, Chang YC, Fredrickson CT, Willert K, Puri N, et al. Efficient siRNA delivery into primary cells by a peptide transduction domain-dsRNA binding domain fusion protein. Nature biotechnology. 2009;27:567-71. [28] Hansson H.A. HJ, Svennerholm L. . Ultrastructural localization of cell membrane GM1 ganglioside by cholera toxin. . Proc Natl Acad Sci USA 74 1977;74:3782–6. [29] Marconi S DTL, Lovato L, Tedeschi E, Gaetti L, Acler M, Bonetti B. Expression of gangliosides on glial and neuronal cells in normal and pathological adult human brain. J Neuroimmunol. 2005 170:115-21. . [30] Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ. Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nature biotechnology. 2011;29:341-5. [31] Lauer SA NJ. Development and characterization of Ni-NTA-bearing microspheres. Cytometry. 2002;48:136-45. [32] Rajagopalan R, Xavier J, Rangaraj N, Rao NM, Gopal V. Recombinant fusion proteins TAT-Mu, Mu and Mu-Mu mediate efficient non-viral gene delivery. The journal of gene medicine. 2007;9:275-86. [33] Reichelt P SC, Donzeau M. Single step protocol to purify recombinant proteins with low endotoxin contents. Protein Expr Purif 2006 Apr;46(2):483-8 2006;46:4838. [34] Harris AGaDA. Glycolipid-anchored Proteins in Neuroblastoma Cells Form Detergent-resistant Complexes without Caveolin. The Journal of cell biology. 1995;129: 619-27. [35] Rong Qi. Douglas G Mullen JRBJ, Mark M. Banaszak Holl. The mechanism of polyplexes internalization into cells: Testing the GM1/Caveolin-1-mediated lipid raft mediated endocytosis pathway. Mol Pharm. 2010;7:267-79. [36] Hansen MB NS, Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J Immunol Methods. 1989;119:203-10. [37] Jankowsky JL FD, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland NG, Lee MK, Younkin LH, Wagner SL, Younkin SG, Borchelt DR. Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet 2004;13:159-70. [38] Tiwari VP, Anant B. Pyruvate Carboxylase and Pentose Phosphate Fluxes are Reduced in AβPP-PS1 Mouse Model of Alzheimer's Disease: A 13C NMR Study. Journal of Alzheimer's Disease, vol 41, no 2, pp 387-399, 2014. 2014;41:387-99. 27

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

[39] Spitzer N, Sammons GS, Price EM. Autofluorescent cells in rat brain can be convincing impostors in green fluorescent reporter studies. Journal of neuroscience methods. 2011;197:48-55. [40] Markwell MA HS, Bieber LL, Tolbert NE. A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples. Anal Biochem. 1978;87:206-10. [41] Geoffrey M. Kuziemko MS, and Raymond C. Stevens. Cholera Toxin Binding Affinity and Specificity for Gangliosides Determined by Surface Plasmon Resonance. Biochemistry 1996;35:6375-84. [42] Merritt EA SS, van den Akker F, L'Hoir C, Martial JA, Hol WG. Crystal structure of cholera toxin B-pentamer bound to receptor GM1 pentasaccharide. Protein Sci 1994;3:166-75. [43] Singer O MR, Rockenstein E, Crews L, Coufal NG, Gage FH, Verma IM, Masliah E. Targeting BACE1 with siRNAs ameliorates Alzheimer disease neuropathology in a transgenic model. Nat Neurosci. 2005;10:1343-9. [44] Castanotto D, Rossi JJ. The promises and pitfalls of RNA-interference-based therapeutics. Nature. 2009;457:426-33. [45] Medina SH, El-Sayed, Mohamed E. H. Dendrimers as carriers for delivery of chemotherapeutic agents. Chem Rev. 2009;109:3141-57. [46] Alyautdin R, Khalin I, Nafeeza MI, Haron MH, Kuznetsov D. Nanoscale drug delivery systems and the blood-brain barrier. International journal of nanomedicine. 2014;9:795-811. [47] Jain K KP, Gupta U, Jain NK. Dendrimer toxicity: Let's meet the challenge. Int J Pharm 2010;394:122-42. [48] Gabathuler R. Approaches to transport therapeutic drugs across the blood-brain barrier to treat brain diseases. Neurobiology of disease. 2010;37:48-57. [49] Julia V. Georgieva Dick Hoekstra, Inge S Zuhorn. Smuggling drugs into the brain: An overview of ligands targeting transcytosis for drug delivery across the blood-brain barrier. Pharmaceutics. 2014;6:557-83. [50] Pardridge W. Targeted delivery of protein and gene medicines through the blood–brain barrier. Clinical Pharmacology & Therapeutics. 2014;97:347-61. [51] Peluffo H, Unzueta U, Negro-Demontel ML, Xu Z, Vaquez E, Ferrer-Miralles N, et al. BBB-targeting, protein-based nanomedicines for drug and nucleic acid delivery to the CNS. Biotechnology advances. 2015;33:277-87. [52] Kotani M KI, Ozawa H, Terashima T, Tai T. Differential distribution of major gangliosides in rat central nervous system detected by specific monoclonal antibodies. Glycobiology 1993;3:137-46. [53] Hakomori S HK, Iwabuchi K, Yamamura S, Prinetti A. New insights in glycosphingolipid function: "glycosignaling domain," a cell surface assembly of glycosphingolipids with signal transducer molecules,involved in cell adhesion coupled with signaling. Glycobiology. 1998;8:xi-xix. [54] Schengrund CL. Gangliosides: glycosphingolipids essential for normal neural development and function. Trends in biochemical sciences. 2015;40:397-406. [55] Fishman P. Role of membrane gangliosides in the binding and action of bacterial toxins. J Membr Biol 1982;69:85-97. [56] Critchley DR SC, Kellie S, Ansell S, Patel B. Characterization of the cholera toxin receptor on Balb/c 3T3 cells as a ganglioside similar to, or identical with, ganglioside GM1. No evidence for galactoproteins with receptor activity. Biochem J 1982;204:209-19.

28

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

SC R

IP

T

[57] Parton RG. Ultrastructural localization of gangliosides; GM1 is concentrated in caveolae. Journal of Histochemistry & Cytochemistry. 1994;42:155-66. [58] Ledeen RW, Wu G. The multi-tasked life of GM1 ganglioside, a true factotum of nature. Trends in biochemical sciences. 2015;40:407-18. [59] Woodle MC. Controlling liposome blood clearance by surface-grafted polymers. Advanced drug delivery reviews. 1998;32:139-52. [60] Poduslo JF CG, Wengenack TM, Malester B, Duff K. Permeability of proteins at the blood-brain barrier in the normal adult mouse and double transgenic mouse model of Alzheimer's disease. Neurobiol Dis 2001;8:555-67. [61] Ron Brookmeyer EJ, Kathryn Ziegler-Graham, and H. Michael Arrighi. Forecasting the global burden of Alzheimer's Disease. Johns Hopkins University, Dept of Biostatistics Working Papers. 2007;UCLA:Paper 130. [62] Davidson BL, McCray PB, Jr. Current prospects for RNA interference-based therapies. Nature reviews Genetics. 2011;12:329-40. [63] Wang A, Das P, Switzer RC, 3rd, Golde TE, Jankowsky JL. Robust amyloid clearance in a mouse model of Alzheimer's disease provides novel insights into the mechanism of amyloid-beta immunotherapy. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2011;31:4124-36. [64] Demattos RB, Lu J, Tang Y, Racke MM, Delong CA, Tzaferis JA, et al. A plaque-specific antibody clears existing beta-amyloid plaques in Alzheimer's disease mice. Neuron. 2012;76:908-20. [65] He G, Luo W, Li P, Remmers C, Netzer WJ, Hendrick J, et al. Gamma-secretase activating protein is a therapeutic target for Alzheimer's disease. Nature. 2010;467:958.

29

SC R

IP

T

ACCEPTED MANUSCRIPT

AC

CE P

TE

D

MA

NU

Graphical abstract

30