- Email: [email protected]
A Discrete Domain of the Human TrkB Receptor Defines the Binding Sites for BDNF and NT-4
Biochemical and Biophysical Research Communications 291, 501–507 (2002) doi:10.1006/bbrc.2002.6468, available online at http://www.idealibrary.com on
A Discrete Domain of the Human TrkB Receptor Defines the Binding Sites for BDNF and NT-4 Ruth L. Naylor,* Alan G. S. Robertson,* Shelley J. Allen,* Richard B. Sessions,† Anthony R. Clarke,† Grant G. F. Mason,* Judy J. Burston,* Sue J. Tyler,* Gordon K. Wilcock,‡ and David Dawbarn* ,1 *University Research Centre for Neuroendocrinology (Care of the Elderly), Bristol Royal Infirmary, Bristol BS2 8HW, United Kingdom; †Department of Biochemistry, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and ‡Department of Care of the Elderly, University of Bristol, Frenchay Hospital, Frenchay BS16 1LE, United Kingdom
Received January 10, 2002
TrkB is a member of the Trk family of tyrosine kinase receptors. In vivo, the extracellular region of TrkB is known to bind, with high affinity, the neurotrophin protein brain-derived neurotrophic factor (BDNF) and neurotrophin-4 (NT-4). We describe the expression and purification of the second Ig-like domain of human TrkB (TrkBIg 2) and show, using surface plasmon resonance, that this domain is sufficient to bind BDNF and NT-4 with subnanomolar affinity. BDNF and NT-4 may have therapeutic implications for a variety of neurodegenerative diseases. The specificity of binding of the neurotrophins to their receptor TrkB is therefore of interest. We examine the specificity of TrkBIg 2 for all the neurotrophins, and use our molecular model of the BDNF-TrkBIg 2 complex to examine the residues involved in binding. It is hoped that the understanding of specific interactions will allow design of small molecule neurotrophin mimetics. © 2002 Elsevier Science (USA)
Key Words: brain-derived neurotrophic factor; molecular model; neurotrophin-4; receptor protein-tyrosine kinases; receptor, TrkB; surface plasmon resonance.
Brain-derived neurotrophic factor (BDNF) belongs to the family of neurotrophins, which are involved in the development and maintenance of the peripheral and central nervous systems. The other known members are -nerve growth factor (NGF) (1, 2), neurotrophin-3 (NT-3) (3), and neurotrophin-4 (NT-4) (4). All the neuAbbreviations used: BDNF, brain-derived neurotrophic factor; CD, circular dichroism; Ig-like, immunoglobulin-like; LRM, leucine-rich motif; NGF, -nerve growth factor; NT-3, neurotrophin-3; NT-4, neurotrophin-4; Trk, tyrosine receptor kinase. 1 To whom correspondence and reprint requests should be addressed. Fax: (⫹44)-117-9283137. E-mail: [email protected]. URL: http://www.bris.ac.uk/Depts/URCN/labs/dawbarn.html.
rotrophins bind to a common, low affinity receptor, p75 NGFR (5). Each also binds to one or more of a homologous family of tyrosine kinase receptors; NGF binds to TrkA (6, 7), BDNF/NT-4 bind to TrkB (8 –10), and NT-3 binds to TrkC (11). NT-3 can also bind TrkA and TrkB with reduced affinity (8, 12). TrkB is expressed in numerous structures of the central and peripheral nervous systems during development (13, 14, 17). Several transcripts of the TRKB gene exist (13, 15–17), encoding both catalytic and noncatalytic forms of the TrkB receptor. Catalytic or full-length forms are found in neurons within the cortex, thalamus and hippocampus. The noncatalytic forms are present throughout the brain, particularly in the choroid plexus of the lateral ventricle, and in the ependymal linings of the third ventricle (14, 17), suggesting a role in the transport and/or clearance of BDNF (17). Distinct primary structural motifs have been characterised in the sequences of the Trk receptors (18). The Trk extracellular domain comprises three tandem leucine-rich motifs (LRMs) flanked by two cysteine clusters, followed by two immunoglobulin-like (Ig-like) domains, Ig 1 and Ig 2. These are of the I-set of Ig-like domains (19). There have been numerous studies to determine which part of the Trk extracellular domain is specific for neurotrophin binding. The LRMs of TrkA and TrkB have been reported as essential for ligand binding (20 – 23), in particular the second LRM (21–23). However, studies by MacDonald and Meakin (24), Pe´rez et al. (25) and ourselves (26) all demonstrate that interaction with the Ig-like domains of TrkA is crucial for NGF binding. Specifically, Urfer et al. (12,27) have reported that the second Ig-like domain, closest to the transmembrane-spanning region, provides the main contact for both NGF binding to TrkA and NT3 binding to
501
0006-291X/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
TrkC. The solution of the X-ray crystal structure of TrkAIg 2-NGF (28) showed in detail the residues of NGF that interact with TrkAIg 2. More recently our X-ray structure of TrkBIg 2-NT4 (29) demonstrates how specificity is achieved in neurotrophin-Trk receptor interactions. However, the X ray structures of the unbound Ig 2 domains of TrkA (19, 30) TrkB (19) and TrkC (19) have been solved and shown to be biologically inactive strand swapped dimers. In this study we describe the expression and purification of the active monomeric form of TrkB. We show that this recombinant domain alone is able to bind both NT4 and BDNF with sub-nanomolar affinity. Further to this, in order to compare specific residues of binding interaction between BDNF and NT4 with TrkBIg 2 we have produced a molecular model of the BDNFTrkBIg 2 complex. Comparisons are made between the binding of NT4 and BDNF to TrkBIg 2. MATERIALS AND METHODS Cloning and sequencing of human TrkBIg 2. cDNA coding for the TrkBIg 2 domain was PCR amplified from ZAP-pBluescript II SK (⫺)/ TRKB, coding for a noncatalytic form of human TrkB (previously cloned by us (17); EMBL Nucleotide Sequence Database Accession No. X75958). Nucleotides 953 to 1397 of the human TRKB gene, corresponding to amino acid residues 286 to 430 of the mature protein (17), were cloned into the vector pET15b (Novagen). These residues comprise a second Ig-like domain of TrkB which has a beta sandwich structure (19, 29). In addition there are a further 21 residues at the NH 2 terminus, which constitute the histidine tag and associated thrombin cleavage sequence. Primers (MWG Biotech) incorporated a NdeI site in the forward primer (CGCATATGGCACCAACTATCACATTTCTCGAATCTC), and a BamHI site in the reverse primer (GCGGATCCCTATTAATGTTCCCGACCGGTTTTATC). The PCR product was subcloned into pET15b to create the expression vector pET15b-TrkBIg 2. Expression of theTrkBIg 2 protein. Electrocompetent E. coli BL21 (DE3) cells were transformed with pET15b-TrkBIg 2, and expression was carried out in accordance with the pET (Novagen) manual. Protein expression was induced with addition of IPTG, in a 5 litre fermentor. Harvested cells were resuspended in 10% glycerol and frozen at ⫺80°C. Pellets were lysed by passing 3 times through an Xpress, then washed with 20 mM sodium phosphate buffers (pH 8.5) containing, in succession, 0.1 M NaCl, 1% Triton X-100, and finally 1 M NaCl. This removed all soluble matter, leaving inclusion bodies containing insoluble protein.
FIG. 1. (A) SDS gel of the purification. 1, uninduced cells, 2, induced cells, 3, urea-soluble protein, 4, His-Trap column eluate, 5, monomer collected by gel-filtration. Molecular weight markers are labeled at the side of the gel. (B) Lanes 1 and 2: Western blot using anti TrkB. Lane 1 is human brain; lane 2 is purified TrkBIg 2 monomer. Lanes 3 and 4: Western blot using anti-6-histidine. Lane 3 is induced cells; lane 4 is purified TrkBIg 2 monomer.
Yvon CD6 instrument using a cuvette of 0.5 mm path length, and a protein concentration of 0.3 mg/ml (⬃16 M). 10 scans were accumulated with a scan speed of 0.5 nm/s, spectra averaged, and the background signal subtracted. Western blot analysis. Purified TrkBIg 2 monomer was compared with TrkB receptor solubilised from a sample of normal human hippocampus, and cell lysate from induced E. coli . Analysis was by Western blotting as previously described (31). TrkB was detected by rabbit anti TrkB, 1:200 (Santa Cruz Biotechnology Inc.), and donkey anti rabbit conjugated to horseradish peroxidase (HRP), 1:1000 (Amersham, Buckinghamshire, UK). The his tag was detected by mouse anti 6 histidine, 1:200 (Clontech), and sheep anti mouse conjugated to HRP, 1:5000 (Amersham). MALDITOF mass spectrometry. The molecular mass was determined using a PE Biosystems Voyager-DE STR MALDITOF mass spectrometer, with a nitrogen laser operating at 337 nm. The matrix solution was freshly prepared sinapinic acid at a concentration of 1 mg/100 l in a 50:50 mixture of acetonitrile and 0.1% trifluoroacetic acid. 0.5 l of sample and matrix were spotted onto the sample plate. The sample was calibrated against Calmix 3 (PE Biosystems) run as a close external standard. The spectrum was acquired over the range 5000 – 80,000 Da, under linear conditions with an accelerating voltage of 25,000 V, an extraction time of 750 ns and a laser intensity of 2700.
Refolding of theTrkBIg 2 protein. Purified inclusion bodies were solubilised in 8 M urea buffer (20 mM sodium phosphate, pH 8.5, 1 mM -mercaptoethanol), with a “Complete” proteinase inhibitor cocktail tablet (Roche) and incubated at room temperature for 2 h with gentle shaking. TrkBIg 2 protein was purified on a HisTrap nickel column (Pharmacia), under reducing conditions (20 mM sodium phosphate, pH 8.5, 8 M urea, 10 mM imidazole), and eluted using 300 mM imidazole. Refolding took place under nonreducing conditions (20 mM sodium phosphate, pH 8.5, 100 mM NaCl) on a Superdex 200 gel-filtration column (Pharmacia). This allowed separation of TrkBIg 2 monomer from dimer and aggregate. Fractions from the peak corresponding to a molecular weight of approximately 18.5 kDa contained TrkBIg 2 monomer.
Surface plasmon resonance. The kinetics of neurotrophin binding to TrkBIg 2 were investigated using surface plasmon resonance, on a Biacore 3000 (Biacore). TrkBIg 2 monomer (as evidenced by gelfiltration) was immobilised on a CM5 chip by amine coupling, according to the manufacturer’s instructions, using a concentration of 0.1 M protein in 50 mM acetate pH 3.5. TrkBIg 2 monomer was added to a level of 375 response units. Regeneration was with 10 mM glycine (pH 1.5). Kinetics were performed in duplicate, in parallel with a control activated flow cell. Neurotrophin concentrations used: 0.1, 0.2, 0.5, 1, 2, 5, 10, and 25 nM rhBDNF (expressed in stably transfected insect cells); 1, 5, 25, 50, 75, and 100 nM rhNT-4; 5, 10, 25, 50, 75, 100, 250, and 500 nM rhNT-3; 100 nM rhNGF (expressed in insect cells using baculovirus system) (32). NT-3 and NT-4 were gifts from Abraham de Vos (Genentec Inc.). Neurotrophins were shown by SDS–PAGE to form one band at their predicted molecular weights. Buffer was HBS-EP (Biacore) consisting of 0.01 M Hepes, pH 7.4, 150 mM NaCl, 3 mM EDTA and 0.005% polysorbate 20. The data collected were analysed using BIAevaluation 3.0 software.
Circular dichroism (CD) spectroscopy. To determine the secondary structure of the folded protein, far-UV CD measurements were made. CD spectra were recorded at room temperature on a Jobin
Molecular modelling of the BDNF-TrkBIg 2 complex. The coordinates of the crystal structure of the NGF-TrkAIg 2 complex (PDB accession code 1www), and of the TrkBIg 2 domain, were gifts from
502
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. MALDITOF mass spectrometry showed a molecular mass of 18,451.7 Da.
Abraham de Vos (Genentec Inc.). The coordinates of the crystal structure of the NT-4-TrkBIg 2 complex were obtained by ourselves (PDB accession code 1HCF) (29). Structures of BDNF heterodimers were obtained from the RCSB Protein Databank; accession codes are BDNF/NT-3 (1BND) and BDNF/NT-4 (1B8M). Inspection and manipulation of structures was carried out using Insight II v97 (MSI, San Diego, CA) and SPDB Viewer (SwissProt (33) http://www. expasy.ch/spdbv/). Energy minimisation of the complex was performed using Discover v2.95 (MSI) according to the following protocol. Hydrogen atoms were added consistent with pH 7 and a 5 Å layer of water molecules added around the surface of the complex. The model was relaxed with 500 cycles of conjugate gradient minimisation, while tethering the backbone atoms of the proteins to their initial positions with a force constant of 500 kcal/Å. This removed any bad clashes between side chains in the model. The minimisation used the Cvff force field and a nonbonded energy distance cutoff of 15 Å.
along with the truncated (95 kDa) form of human TrkB, was detected by the anti TrkB antibody (lanes 1 and 2, Fig. 1B). The his tag incorporated into the pET15b expression vector was detected by the anti six-histidine antibody, both in the cell lysate from E. coli, and in the purified TrkBIg 2 monomer (lanes 3 and 4, Fig. 1B). MALDITOF mass spectrometry gave a molecular mass of 18,451.7 Da (Fig. 2). This corresponds, within an accepted error margin, to the predicted mass of TrkBIg 2 (18,449.1 Da, after loss of the N-terminal methionine, which is generally removed in proteins incorporating the his tag from the expression vector pET15b). Real-time kinetic data were obtained using surface plasmon resonance. Kinetics were estimated according to a 1:1 Langmuir binding model. BDNF (Fig. 3A), passed over the chip at 0.1–25 nM, gave a K D of 790 pM ( 2 ⫽ 4.39). NT-4 (Fig. 3B), passed over at 1–100 nM, gave a K D of 260pM ( 2 ⫽ 1.29). NT-3 (Fig. 3C), passed
RESULTS AND DISCUSSION Binding of BDNF and NT-4 to TrkB initiates signalling which is critical for axonal outgrowth, neuronal survival, neurotransmitter release and synaptic plasticity. Therefore the understanding of the interactions between these neurotrophin ligands and their receptor TrkB is of great interest. Our study shows the novel result that TrkBIg 2, produced as a recombinant protein, is sufficient for high affinity binding to the neurotrophins BDNF and NT-4. However, since specificity of action is of particular importance, we have assessed this specificity in two separate ways. Firstly, we have characterised the TrkBIg 2 domain by surface plasmon resonance with respect to the binding of all the neurotrophins, and secondly we have compared the crystal structure of TrkBIg 2-NT4 (29) with a molecular model, presented here, of TrkBIg 2 bound to BDNF. Our results show that TrkBIg 2 protein is expressed at high levels in the urea-soluble fraction of inclusion bodies (Fig. 1A), and that approximately 80 mg of purified monomer were obtained from a 5 litre culture. CD spectrum analysis showed a pronounced minimum at 218 nm (data not shown), consistent with a predominantly globular, -sheet-containing structure, as seen in other immunoglobulin domains. Western blot analysis showed that TrkBIg 2 monomer,
FIG. 3. (A) BDNF at 0.1, 0.2, 0.5, 1, 2, 5, 10, and 25 nM. Kinetic analysis gave a K D of 790 pM. (B) NT-4 at 1, 5, 25, 50, 75, and 100 nM. Kinetic analysis gave a K D of 260 pM. (C) NT-3 at 0.5, 10, 25, 50, 75, 100, 250, and 500 nM. Kinetic analysis gave a K D of 18 nM.
503
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. (A) Sequence alignment of TrkBIg 2 with TrkAIg 2. Identical residues are indicated by (*) and residues with similar chemical properties are indicated by (.). (B) The model BDNF-TrkBIg 2 complex (dark red– dark blue) superimposed on the crystal structure of the NT-4-TrkBIg 2 complex (light red–light blue). Protein backbones are represented as ribbons and the letters N and C indicate the chain termini. (C) A comparison of the interface region between TrkBIg 2 and the N-terminal regions of the neurotrophins. The modelled BDNF-TrkBIg 2 complex (dark red– dark blue) is shown on the left and the crystal structure of the NT-4-TrkBIg 2 complex (light red–light blue) is shown on the right of the figure. The salt bridges between D286 of TrkB and R7 (BDNF)/R11 (NT-4) are indicated by dotted lines and the N and C termini of the neurotrophins are labeled.
over at 5–500 nM, gave a K D of 18 nM ( 2 ⫽ 1.09), and 100 nM NGF did not bind to TrkBIg 2 (data not shown). These data agree with previous studies, which have shown that BDNF interacts with TrkB with a subnanomolar affinity (34 –36). In addition it has been shown
that NT-4 has a similar affinity to BDNF at the rat TrkB receptor (37). Our results thus confirm that the second Ig-like domain of TrkB is the main docking region for BDNF and NT-4. They also agree with studies reporting that NT-3 is able to bind to TrkB with
504
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
reduced affinity (8, 38). K Ds for BDNF and NT-4 appear similar, with NT-4 having a slightly higher affinity for TrkBIg 2. Examination of the crystal structures of NGFTrkAIg 2 (28) and NT-4-TrkBIg 2 (29) shows two areas of interaction. These comprise a conserved and a specificity patch. In the conserved patch, the residues of the neurotrophin and the receptor are conserved. The specificity patch involves the N-terminus of NGF or NT-4 in association with a pocket in the TrkAIg 2 or TrkBIg 2 domain. We describe here a theoretical model of the interaction of TrkBIg 2 with the neurotrophin BDNF. This has been accomplished by reference to both NGFTrkAIg 2 (28) and NT-4-TrkBIg 2 (29) X-ray coordinates. The first stage in the modelling process was to construct a homodimer of BDNF. This was achieved by superimposing a copy of BDNF on its partner in the corresponding heterodimer complex. Performing this on the BDNF/NT-3 complex gave a C␣ RMSD of 1.07 Å between structurally similar elements (88 C␣ positions) while the same process for BDNF/NT-4 gave a C␣ RMSD of 1.92 Å (85 C␣ positions). Hence the BDNF homodimer derived from the BDNF/NT-3 heterodimer was chosen for further modelling. Next, the BDNF dimer was superimposed on the NT-4 dimer of the NT-4-TrkBIg 2 complex giving a C␣ RMSD of 0.72 Å between structurally similar elements (154 C␣ positions). Those N- and C-terminal stretches of backbone which are absent in the BDNF crystal structures were modelled using the corresponding residues present in the NT-4-TrkBIg 2 complex. The residue side chains in these regions were changed according to the BDNF sequence, and the two TrkB domains included, to yield a model of the complete BDNFTrkBIg 2 complex. The model was relaxed by energy minimisation as described under Materials and Methods. Figure 4B shows a superimposition of the BDNFTrkBIg 2 complex on the NT-4-TrkBIg 2 complex; the RMSD between similar structural elements is 0.70 Å (356 pairs of C␣ atoms). Applying the same procedure to BDNF-TrkBIg 2 and NGF-TrkAIg 2 gave a RMSD of 1.15 Å (312 pairs of C␣ atoms) indicating the close similarity between all three complexes. We have shown previously that NT-4 binds to TrkBIg 2 through two contact regions; the conserved patch and the specificity patch (29). Our model of BDNFTrkBIg 2 agrees with this. The X-ray crystal structure of NT-4-TrkBIg 2 shows a conserved salt bridge in the specificity patch, between D298 of TrkBIg 2 and R11 of NT-4. A similar salt bridge is found between D298 of TrkBIg 2 and R7 of BDNF, which may explain similarities of binding affinity between TrkB and its ligands NT-4 and BDNF (Fig. 4C). It is noteworthy that there is no corresponding salt bridge present in the NGFTrkAIg 2 complex, hence this interaction may be the major determinant of the observed specificity of BDNF and NT-4 for TrkB compared with NGF. It is clear that
the binding of BDNF and NT-4 to TrkA would be impeded by the hydrophobic nature of the pocket and the disulphide bond in TrkA. In Parkinson’s disease, there is known to be profound degeneration of the dopaminergic neurons located within the substantia nigra (39). BDNF is known to support the growth of these neurons in culture (40), and has also been shown to support motor neuron survival in vitro (41, 42). In Alzheimer’s disease the level of BDNF mRNA is reduced (43), and there is selective loss of the catalytic form of TrkB (44). BDNF also increases neuronal excitability, and levels are increased in areas of the brain implicated in epileptogenesis (45). Therefore there are many possible therapeutic uses for BDNF/NT-4 agonists/antagonists. Our findings show that the second Ig domain of TrkB is the major contributor to BDNF and NT-4 binding, and that TrkBIg 2 is capable of binding these ligands with sub-nanomolar affinities. These results support the feasibility of using TrkBIg 2 to screen for small molecule mimetics of BDNF, for use in the treatment of neurodegenerative diseases. Using the model, in conjunction with mutation analysis, will reveal the identities and roles of the residues involved in ligandreceptor interaction. ACKNOWLEDGMENTS We thank the following for their support: The Wellcome Trust, Enact Pharma PLC, and BRACE (Bristol Research into Ageing and Care of the Elderly). A.G.S.R. and S.J.A. are Sigmund Gestetner Fellows.
REFERENCES
505
1. Scott, J., Selby, S. M., Urdea, M., Quiroga, M., Bell, G. I., and Rutter, W. J. (1983) Isolation and nucleotide sequence of a cDNA encoding the precursor of mouse nerve growth factor. Nature 302, 538 –540. 2. Ullrich, A., Gray, A., Berman, C., and Dull, T. J. (1983) Human -nerve growth factor gene sequence highly homologous to that of mouse. Nature 303, 821– 825. 3. Kaisho, Y., Yoshimora, K., and Nakahama, K. (1990) Cloning and expression of a cDNA encoding a novel human neurotrophin factor. FEBS Lett. 266, 187–191. 4. Ip, N. Y., Iba´ n˜ ez, C. F., Nye, S. H., McClain, J., Jones, P. F., Gies, D. R., Belluscio, L., LeBeau, M. M., Espinosa, R., III, Squinto, S. P., Persson H., and Yancopoulos, G. D. (1992) Mammalian neurotrophin-4: Structure, chromosomal localisation, tissue distribution and receptor specificity. Proc. Natl. Acad. Sci. USA 89, 3060 –3064. 5. Rodriguez-Te´ bar, A., Dechant, G., Gotz, R., and Barde, Y.-A. (1992) Binding of neurotrophin-3 to its neuronal receptors and interactions with nerve growth-factor and brain-derived neurotrophic factor. EMBO J. 11, 917–922. 6. Kaplan, D. R., Hempstead, B. L., Martin-Zanca, D., Chao, M. V., and Parada, L. F. (1991) The trk proto-oncogene product: A signal transducing receptor for nerve growth factor. Science 252, 554 –558. 7. Klein, R., Jing, S. Q., Nanduri, V., O’Rourke, E., and Barbacid,
Vol. 291, No. 3, 2002
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
M. (1991) The trk proto-oncogene encodes the receptor for nerve growth factor. Cell 65, 189 –197. Glass, D. J., Nye, S. H., Hantzopoulos, P., Macchi, M. J., Squinto, S. P., Goldfarb, M., and Yancopoulos, G. D. (1991) trkB mediates BDNF/NT-3 dependent survival and proliferation in fibroblasts lacking the low affinity NGF-receptor. Cell 66, 405– 413. Ip, N. Y., Stitt, T. N., Tapley, P., Klein, R., Glass, D. J., Fandl, J., Greene, L. A., Barbacid, M., and Yancopoulos. G. D. (1993) Similarities and differences in the way neurotrophins interact with the trk receptors in neuronal and nonneuronal cells. Neuron 10, 137–149. Klein, R., Lamballe, F., Bryant, S., and Barbacid, M. (1992) The trkB tyrosine protein-kinase is a receptor for neurotrophin-4. Neuron 8, 947–956. Lamballe, F., Klein, R., and Barbacid, M. (1991) TrkC, a new member of the trk family of tyrosine protein-kinases, is a receptor for neurotrophin-3. Cell 66, 969 –979. Urfer, R., Tsoulfas, O’Connell, L., Shelton, D. L., Parada, L. F., and Presta, L. G. (1995) An immunoglobulin-like domain determines the specificity of neurotrophin receptors. EMBO J. 14, 2795–2805. Klein, R., Parada, L. F., Coulier, F., and Barbacid, M. (1989) trkB, a novel tyrosine protein kinase receptor expressed during mouse neural development. EMBO J. 8, 3701–3709. Klein, R., Martin-Zanca, D., Barbacid, M., and Parada, L. F. (1990) Expression of the tyrosine kinase receptor gene trkB is confined to the murine embryonic and adult nervous system. Development 109, 845– 850. Klein, R., Conway, D., Parada, L. F., and Barbacid, M. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell 61, 647– 656. Middlemas, D. S., Lindberg, R. A., and Hunter, T. (1991) trk B, a neural receptor protein-tyrosine kinase: Evidence for a fulllength and two truncated receptors. Mol. Cell Biol. 11, 143–153. Allen, S. J., Dawbarn, D., Eckford, S. D., Wilcock, G. K., Ashcroft, M., Colebrook, S. M., Feeney, R., and MacGowan, S. H. (1994) Cloning of a non-catalytic form of human trkB and distribution of messenger RNA for trkB in human brain. Neuroscience 60, 825– 834. Schneider, R., and Schweiger, M. (1991) A novel modular mosaic of cell adhesion motifs in the extracellular domains of the neurogenic trk and trkB tyrosine kinase receptors. Oncogene 6, 1807–1811. Ultsch, M. H., Wiesmann, C., Simmons, L. C., Henrich, J., Yang, M., Reilly, D., Bass, S. H., and de Vos, A. M. (1999) Crystal structures of the neurotrophin-binding domain of TrkA, TrkB and TrkC. J. Mol. Biol. 290, 149 –159. Ninkina, N., Grashchuck, M., Buchman, V. L., and Davies, A. M. (1997) TrkB variants with deletions in the leucine-rich motifs of the extracellular domain. J. Biol. Chem. 272, 13019 –13025. Windisch, J. M., Marksteiner, R., Lang, M. E., Auer, B., and Schneider, R. (1995) Brain-derived neurotrophic factor, neurotrophin-3, and neurotrophin-4 bind to a single leucine-rich motif of TrkB. Biochemistry 34, 11256 –11263. Windisch, J. M., Auer, B., Marksteiner, R., Lang, M. E., and Schneider, R. (1995) Specific neurotrophin binding to leucinerich motif peptides of TrkA and TrkB. FEBS Lett. 374, 125–129. Windisch, J. M., Marksteiner, R., and Schneider, R. (1995) Nerve growth factor binding site on TrkA mapped to a single 24-amino acid leucine-rich motif. J. Biol. Chem. 270, 28133–28138. MacDonald, J. I. S., and Meakin, S. O. (1996) Deletions in the extracellular domain of rat TrkA lead to an altered differentiative phenotype in neurotrophin responsive cells. Mol. Cell. Neurosci. 7, 371–390.
25. Pe´ rez, P., Coll, P. M., Hempstead, B. L., Martin-Zanca, D., and Chao, M. V. (1995) NGF binding to the trk tyrosine kinase receptor requires the extracellular immunoglobulin-like domains. Mol. Cell. Neurosci. 6, 97–105. 26. Holden, P. H., Asopa, V., Robertson, A. G. S., Clarke, A. R., Tyler, S., Bennett, G. S., Brain, S. D., Wilcock, G. K., Allen, S. J., Smith, S. K. F., and Dawbarn, D. (1997) Immunoglobulin-like domains define the nerve growth factor binding site of the TrkA receptor. Nature Biotech. 15, 668 – 672. 27. Urfer, R., Tsoulfas, P., O’Connell, L., Hongo, J.-A., Zhao, W., and Presta, L. G. (1998) High resolution mapping of the binding site of TrkA for nerve growth factor and TrkC for neurotrophin-3 on the second immunoglobulin-like domain of the Trk receptors. J. Biol. Chem 273, 5829 –5840. 28. Wiesmann, C., Ultsch, M. H., Bass, S. H., and de Vos, A. M. (1999) Crystal structure of nerve growth factor in complex with the ligand-binding domain of the TrkA receptor. Nature 401, 184 –188. 29. Banfield, M. J., Naylor, R. L., Robertson, A. G. S., Allen, S. J., Dawbarn, D., and Brady, R. L. (2001) Specificity in Trk-receptor: neurotrophin interaction: The crystal structure of TrkB-d5 in complex with neurotrophin-4/5. Structure 9, 1191–1199 30. Robertson, A. G. S., Banfield, M. J., Allen, S. J., Dando, J. A., Mason, G. G. F., Tyler, S. J., Bennett, G. S., Brain, S. D., Clarke, A. R., Naylor, R. L., Wilcock, G. K., Brady, R. L., and Dawbarn, D. (2001) Identification and structure of the nerve growth factor binding site on TrkA. Biochem. Biophys. Res. Commun. 282, 131–141. 31. Allen, S. J., Wilcock, G. K., and Dawbarn, D. (1999) Profound and selective loss of catalytic TrkB immunoreactivity in Alzheimer’s disease. Biochem. Biophys. Res. Commun. 264, 648 – 651. 32. Allen, S. J., Robertson, A. G. S., Tyler, S., Wilcock, G. K., and Dawbarn, D. (2001) Recombinant human nerve growth factor for clinical trials: Protein expression, purification, stability and characterisation of binding to infusion pumps. J. Biochem. Biophys. Methods 47, 239 –255. 33. Guex, N., and Peitsch, M. C. (1997) SWISS-MODEL and the Swiss-Pdb Viewer: An environment for comparative protein modelling. Electrophoresis 18, 2714 –2723. 34. Rodrigeuz-Te´ bar, A., and Barde, Y.-A. (1988) Binding characteristics of brain-derived neurotrophic factor to its receptors on neurons from the chick embryo. J. Neurosci. 8, 3337–3342. 35. Squinto, S. P., Stitt, T. N., Aldrich, T. H., Davis, S., Bianco, S. M., Radziejewski, C., Glass, D. J., Masiakowski, P., Furth, M. E., Valenzuela, D. M., DiStefano, P. S., and Yancopoulos, G. D. (1991) trkB encodes a functional receptor for brain-derived neurotrophic factor and neurotrophin-3 but not nerve growth factor. Cell 65, 885– 893. 36. Dechant, G., Biffo, S., Okazawa, H., Kolbeck, R., Pottgiesser, J., and Barde, Y.-A. (1993) Expression and binding characteristics of the BDNF receptor chick trkB. Development 119, 545–558. 37. Fandl, J. P., Tobkes, N. J., McDonald, N. Q., Hendrickson, W. A., Ryan, T. E., Nigam, S., Acheson, A., Cudny, H., and Panayotatos, N. (1994) Characterization and crystallization of recombinant human neurotrophin-4. J. Biol. Chem. 269 755–759. 38. Klein, R., Nanduri, V., Jing, S., Lamballe, F., Tapley, P., Bryant, S., Cordon-Cardo, C., Jones, K. R., Reichardt, L. F., and Barbacid, M. (1991) The trkB tryrosine protein kinase is a receptor for brain-derived neurotrophic factor and neurotrophin-3. Cell 66, 395– 403. 39. Kernie, S. G., and Parada, L. F. (2000) The molecular basis for understanding neurotrophins and their relevance to neurologic disease. Arch. Neurol. 57, 654 – 657. 40. Hyman, C., Hofer, M., Barde, Y.-A., Yahasz, M., Yancopoulos,
506
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
G. D., Squinto, S. P., and Lindsay, R. M. (1991) BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 350, 230 –232. 41. Sendtner, M., Holtmann, B., Kolbeck, R., Thoenen, H., and Barde, Y.-A. (1992) Brain-derived neurotrophic factor prevents the death of motor neurons in newborn rats after nerve section. Nature 360, 757–759. 42. Yan, O., Elliot, J., and Snider, W. D. (1992) Brain-derived neuro-
trophic factor rescues spinal motor neurons from axotomyinduced cell death. Nature 360, 753–755. 44. Allen, S. J., Wilcock, G. K., and Dawbarn, D. (1999) Profound and selective loss of catalytic TrkB immunoreactivity in Alzheimer’s disease. Biochem. Biophys. Res. Commun. 264, 648 – 651. 45. Binder, D. K., Croll, S. D., Gall, C. M., and Scharfman, H. E. (2001) BDNF and epilepsy: Too much of a good thing? Trends Neurosci. 24, 47–53.
507
A Discrete Domain of the Human TrkB Receptor Defines the Binding Sites for BDNF and NT-4 Ruth L. Naylor,* Alan G. S. Robertson,* Shelley J. Allen,* Richard B. Sessions,† Anthony R. Clarke,† Grant G. F. Mason,* Judy J. Burston,* Sue J. Tyler,* Gordon K. Wilcock,‡ and David Dawbarn* ,1 *University Research Centre for Neuroendocrinology (Care of the Elderly), Bristol Royal Infirmary, Bristol BS2 8HW, United Kingdom; †Department of Biochemistry, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and ‡Department of Care of the Elderly, University of Bristol, Frenchay Hospital, Frenchay BS16 1LE, United Kingdom
Received January 10, 2002
TrkB is a member of the Trk family of tyrosine kinase receptors. In vivo, the extracellular region of TrkB is known to bind, with high affinity, the neurotrophin protein brain-derived neurotrophic factor (BDNF) and neurotrophin-4 (NT-4). We describe the expression and purification of the second Ig-like domain of human TrkB (TrkBIg 2) and show, using surface plasmon resonance, that this domain is sufficient to bind BDNF and NT-4 with subnanomolar affinity. BDNF and NT-4 may have therapeutic implications for a variety of neurodegenerative diseases. The specificity of binding of the neurotrophins to their receptor TrkB is therefore of interest. We examine the specificity of TrkBIg 2 for all the neurotrophins, and use our molecular model of the BDNF-TrkBIg 2 complex to examine the residues involved in binding. It is hoped that the understanding of specific interactions will allow design of small molecule neurotrophin mimetics. © 2002 Elsevier Science (USA)
Key Words: brain-derived neurotrophic factor; molecular model; neurotrophin-4; receptor protein-tyrosine kinases; receptor, TrkB; surface plasmon resonance.
Brain-derived neurotrophic factor (BDNF) belongs to the family of neurotrophins, which are involved in the development and maintenance of the peripheral and central nervous systems. The other known members are -nerve growth factor (NGF) (1, 2), neurotrophin-3 (NT-3) (3), and neurotrophin-4 (NT-4) (4). All the neuAbbreviations used: BDNF, brain-derived neurotrophic factor; CD, circular dichroism; Ig-like, immunoglobulin-like; LRM, leucine-rich motif; NGF, -nerve growth factor; NT-3, neurotrophin-3; NT-4, neurotrophin-4; Trk, tyrosine receptor kinase. 1 To whom correspondence and reprint requests should be addressed. Fax: (⫹44)-117-9283137. E-mail: [email protected]. URL: http://www.bris.ac.uk/Depts/URCN/labs/dawbarn.html.
rotrophins bind to a common, low affinity receptor, p75 NGFR (5). Each also binds to one or more of a homologous family of tyrosine kinase receptors; NGF binds to TrkA (6, 7), BDNF/NT-4 bind to TrkB (8 –10), and NT-3 binds to TrkC (11). NT-3 can also bind TrkA and TrkB with reduced affinity (8, 12). TrkB is expressed in numerous structures of the central and peripheral nervous systems during development (13, 14, 17). Several transcripts of the TRKB gene exist (13, 15–17), encoding both catalytic and noncatalytic forms of the TrkB receptor. Catalytic or full-length forms are found in neurons within the cortex, thalamus and hippocampus. The noncatalytic forms are present throughout the brain, particularly in the choroid plexus of the lateral ventricle, and in the ependymal linings of the third ventricle (14, 17), suggesting a role in the transport and/or clearance of BDNF (17). Distinct primary structural motifs have been characterised in the sequences of the Trk receptors (18). The Trk extracellular domain comprises three tandem leucine-rich motifs (LRMs) flanked by two cysteine clusters, followed by two immunoglobulin-like (Ig-like) domains, Ig 1 and Ig 2. These are of the I-set of Ig-like domains (19). There have been numerous studies to determine which part of the Trk extracellular domain is specific for neurotrophin binding. The LRMs of TrkA and TrkB have been reported as essential for ligand binding (20 – 23), in particular the second LRM (21–23). However, studies by MacDonald and Meakin (24), Pe´rez et al. (25) and ourselves (26) all demonstrate that interaction with the Ig-like domains of TrkA is crucial for NGF binding. Specifically, Urfer et al. (12,27) have reported that the second Ig-like domain, closest to the transmembrane-spanning region, provides the main contact for both NGF binding to TrkA and NT3 binding to
501
0006-291X/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
TrkC. The solution of the X-ray crystal structure of TrkAIg 2-NGF (28) showed in detail the residues of NGF that interact with TrkAIg 2. More recently our X-ray structure of TrkBIg 2-NT4 (29) demonstrates how specificity is achieved in neurotrophin-Trk receptor interactions. However, the X ray structures of the unbound Ig 2 domains of TrkA (19, 30) TrkB (19) and TrkC (19) have been solved and shown to be biologically inactive strand swapped dimers. In this study we describe the expression and purification of the active monomeric form of TrkB. We show that this recombinant domain alone is able to bind both NT4 and BDNF with sub-nanomolar affinity. Further to this, in order to compare specific residues of binding interaction between BDNF and NT4 with TrkBIg 2 we have produced a molecular model of the BDNFTrkBIg 2 complex. Comparisons are made between the binding of NT4 and BDNF to TrkBIg 2. MATERIALS AND METHODS Cloning and sequencing of human TrkBIg 2. cDNA coding for the TrkBIg 2 domain was PCR amplified from ZAP-pBluescript II SK (⫺)/ TRKB, coding for a noncatalytic form of human TrkB (previously cloned by us (17); EMBL Nucleotide Sequence Database Accession No. X75958). Nucleotides 953 to 1397 of the human TRKB gene, corresponding to amino acid residues 286 to 430 of the mature protein (17), were cloned into the vector pET15b (Novagen). These residues comprise a second Ig-like domain of TrkB which has a beta sandwich structure (19, 29). In addition there are a further 21 residues at the NH 2 terminus, which constitute the histidine tag and associated thrombin cleavage sequence. Primers (MWG Biotech) incorporated a NdeI site in the forward primer (CGCATATGGCACCAACTATCACATTTCTCGAATCTC), and a BamHI site in the reverse primer (GCGGATCCCTATTAATGTTCCCGACCGGTTTTATC). The PCR product was subcloned into pET15b to create the expression vector pET15b-TrkBIg 2. Expression of theTrkBIg 2 protein. Electrocompetent E. coli BL21 (DE3) cells were transformed with pET15b-TrkBIg 2, and expression was carried out in accordance with the pET (Novagen) manual. Protein expression was induced with addition of IPTG, in a 5 litre fermentor. Harvested cells were resuspended in 10% glycerol and frozen at ⫺80°C. Pellets were lysed by passing 3 times through an Xpress, then washed with 20 mM sodium phosphate buffers (pH 8.5) containing, in succession, 0.1 M NaCl, 1% Triton X-100, and finally 1 M NaCl. This removed all soluble matter, leaving inclusion bodies containing insoluble protein.
FIG. 1. (A) SDS gel of the purification. 1, uninduced cells, 2, induced cells, 3, urea-soluble protein, 4, His-Trap column eluate, 5, monomer collected by gel-filtration. Molecular weight markers are labeled at the side of the gel. (B) Lanes 1 and 2: Western blot using anti TrkB. Lane 1 is human brain; lane 2 is purified TrkBIg 2 monomer. Lanes 3 and 4: Western blot using anti-6-histidine. Lane 3 is induced cells; lane 4 is purified TrkBIg 2 monomer.
Yvon CD6 instrument using a cuvette of 0.5 mm path length, and a protein concentration of 0.3 mg/ml (⬃16 M). 10 scans were accumulated with a scan speed of 0.5 nm/s, spectra averaged, and the background signal subtracted. Western blot analysis. Purified TrkBIg 2 monomer was compared with TrkB receptor solubilised from a sample of normal human hippocampus, and cell lysate from induced E. coli . Analysis was by Western blotting as previously described (31). TrkB was detected by rabbit anti TrkB, 1:200 (Santa Cruz Biotechnology Inc.), and donkey anti rabbit conjugated to horseradish peroxidase (HRP), 1:1000 (Amersham, Buckinghamshire, UK). The his tag was detected by mouse anti 6 histidine, 1:200 (Clontech), and sheep anti mouse conjugated to HRP, 1:5000 (Amersham). MALDITOF mass spectrometry. The molecular mass was determined using a PE Biosystems Voyager-DE STR MALDITOF mass spectrometer, with a nitrogen laser operating at 337 nm. The matrix solution was freshly prepared sinapinic acid at a concentration of 1 mg/100 l in a 50:50 mixture of acetonitrile and 0.1% trifluoroacetic acid. 0.5 l of sample and matrix were spotted onto the sample plate. The sample was calibrated against Calmix 3 (PE Biosystems) run as a close external standard. The spectrum was acquired over the range 5000 – 80,000 Da, under linear conditions with an accelerating voltage of 25,000 V, an extraction time of 750 ns and a laser intensity of 2700.
Refolding of theTrkBIg 2 protein. Purified inclusion bodies were solubilised in 8 M urea buffer (20 mM sodium phosphate, pH 8.5, 1 mM -mercaptoethanol), with a “Complete” proteinase inhibitor cocktail tablet (Roche) and incubated at room temperature for 2 h with gentle shaking. TrkBIg 2 protein was purified on a HisTrap nickel column (Pharmacia), under reducing conditions (20 mM sodium phosphate, pH 8.5, 8 M urea, 10 mM imidazole), and eluted using 300 mM imidazole. Refolding took place under nonreducing conditions (20 mM sodium phosphate, pH 8.5, 100 mM NaCl) on a Superdex 200 gel-filtration column (Pharmacia). This allowed separation of TrkBIg 2 monomer from dimer and aggregate. Fractions from the peak corresponding to a molecular weight of approximately 18.5 kDa contained TrkBIg 2 monomer.
Surface plasmon resonance. The kinetics of neurotrophin binding to TrkBIg 2 were investigated using surface plasmon resonance, on a Biacore 3000 (Biacore). TrkBIg 2 monomer (as evidenced by gelfiltration) was immobilised on a CM5 chip by amine coupling, according to the manufacturer’s instructions, using a concentration of 0.1 M protein in 50 mM acetate pH 3.5. TrkBIg 2 monomer was added to a level of 375 response units. Regeneration was with 10 mM glycine (pH 1.5). Kinetics were performed in duplicate, in parallel with a control activated flow cell. Neurotrophin concentrations used: 0.1, 0.2, 0.5, 1, 2, 5, 10, and 25 nM rhBDNF (expressed in stably transfected insect cells); 1, 5, 25, 50, 75, and 100 nM rhNT-4; 5, 10, 25, 50, 75, 100, 250, and 500 nM rhNT-3; 100 nM rhNGF (expressed in insect cells using baculovirus system) (32). NT-3 and NT-4 were gifts from Abraham de Vos (Genentec Inc.). Neurotrophins were shown by SDS–PAGE to form one band at their predicted molecular weights. Buffer was HBS-EP (Biacore) consisting of 0.01 M Hepes, pH 7.4, 150 mM NaCl, 3 mM EDTA and 0.005% polysorbate 20. The data collected were analysed using BIAevaluation 3.0 software.
Circular dichroism (CD) spectroscopy. To determine the secondary structure of the folded protein, far-UV CD measurements were made. CD spectra were recorded at room temperature on a Jobin
Molecular modelling of the BDNF-TrkBIg 2 complex. The coordinates of the crystal structure of the NGF-TrkAIg 2 complex (PDB accession code 1www), and of the TrkBIg 2 domain, were gifts from
502
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. MALDITOF mass spectrometry showed a molecular mass of 18,451.7 Da.
Abraham de Vos (Genentec Inc.). The coordinates of the crystal structure of the NT-4-TrkBIg 2 complex were obtained by ourselves (PDB accession code 1HCF) (29). Structures of BDNF heterodimers were obtained from the RCSB Protein Databank; accession codes are BDNF/NT-3 (1BND) and BDNF/NT-4 (1B8M). Inspection and manipulation of structures was carried out using Insight II v97 (MSI, San Diego, CA) and SPDB Viewer (SwissProt (33) http://www. expasy.ch/spdbv/). Energy minimisation of the complex was performed using Discover v2.95 (MSI) according to the following protocol. Hydrogen atoms were added consistent with pH 7 and a 5 Å layer of water molecules added around the surface of the complex. The model was relaxed with 500 cycles of conjugate gradient minimisation, while tethering the backbone atoms of the proteins to their initial positions with a force constant of 500 kcal/Å. This removed any bad clashes between side chains in the model. The minimisation used the Cvff force field and a nonbonded energy distance cutoff of 15 Å.
along with the truncated (95 kDa) form of human TrkB, was detected by the anti TrkB antibody (lanes 1 and 2, Fig. 1B). The his tag incorporated into the pET15b expression vector was detected by the anti six-histidine antibody, both in the cell lysate from E. coli, and in the purified TrkBIg 2 monomer (lanes 3 and 4, Fig. 1B). MALDITOF mass spectrometry gave a molecular mass of 18,451.7 Da (Fig. 2). This corresponds, within an accepted error margin, to the predicted mass of TrkBIg 2 (18,449.1 Da, after loss of the N-terminal methionine, which is generally removed in proteins incorporating the his tag from the expression vector pET15b). Real-time kinetic data were obtained using surface plasmon resonance. Kinetics were estimated according to a 1:1 Langmuir binding model. BDNF (Fig. 3A), passed over the chip at 0.1–25 nM, gave a K D of 790 pM ( 2 ⫽ 4.39). NT-4 (Fig. 3B), passed over at 1–100 nM, gave a K D of 260pM ( 2 ⫽ 1.29). NT-3 (Fig. 3C), passed
RESULTS AND DISCUSSION Binding of BDNF and NT-4 to TrkB initiates signalling which is critical for axonal outgrowth, neuronal survival, neurotransmitter release and synaptic plasticity. Therefore the understanding of the interactions between these neurotrophin ligands and their receptor TrkB is of great interest. Our study shows the novel result that TrkBIg 2, produced as a recombinant protein, is sufficient for high affinity binding to the neurotrophins BDNF and NT-4. However, since specificity of action is of particular importance, we have assessed this specificity in two separate ways. Firstly, we have characterised the TrkBIg 2 domain by surface plasmon resonance with respect to the binding of all the neurotrophins, and secondly we have compared the crystal structure of TrkBIg 2-NT4 (29) with a molecular model, presented here, of TrkBIg 2 bound to BDNF. Our results show that TrkBIg 2 protein is expressed at high levels in the urea-soluble fraction of inclusion bodies (Fig. 1A), and that approximately 80 mg of purified monomer were obtained from a 5 litre culture. CD spectrum analysis showed a pronounced minimum at 218 nm (data not shown), consistent with a predominantly globular, -sheet-containing structure, as seen in other immunoglobulin domains. Western blot analysis showed that TrkBIg 2 monomer,
FIG. 3. (A) BDNF at 0.1, 0.2, 0.5, 1, 2, 5, 10, and 25 nM. Kinetic analysis gave a K D of 790 pM. (B) NT-4 at 1, 5, 25, 50, 75, and 100 nM. Kinetic analysis gave a K D of 260 pM. (C) NT-3 at 0.5, 10, 25, 50, 75, 100, 250, and 500 nM. Kinetic analysis gave a K D of 18 nM.
503
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. (A) Sequence alignment of TrkBIg 2 with TrkAIg 2. Identical residues are indicated by (*) and residues with similar chemical properties are indicated by (.). (B) The model BDNF-TrkBIg 2 complex (dark red– dark blue) superimposed on the crystal structure of the NT-4-TrkBIg 2 complex (light red–light blue). Protein backbones are represented as ribbons and the letters N and C indicate the chain termini. (C) A comparison of the interface region between TrkBIg 2 and the N-terminal regions of the neurotrophins. The modelled BDNF-TrkBIg 2 complex (dark red– dark blue) is shown on the left and the crystal structure of the NT-4-TrkBIg 2 complex (light red–light blue) is shown on the right of the figure. The salt bridges between D286 of TrkB and R7 (BDNF)/R11 (NT-4) are indicated by dotted lines and the N and C termini of the neurotrophins are labeled.
over at 5–500 nM, gave a K D of 18 nM ( 2 ⫽ 1.09), and 100 nM NGF did not bind to TrkBIg 2 (data not shown). These data agree with previous studies, which have shown that BDNF interacts with TrkB with a subnanomolar affinity (34 –36). In addition it has been shown
that NT-4 has a similar affinity to BDNF at the rat TrkB receptor (37). Our results thus confirm that the second Ig-like domain of TrkB is the main docking region for BDNF and NT-4. They also agree with studies reporting that NT-3 is able to bind to TrkB with
504
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
reduced affinity (8, 38). K Ds for BDNF and NT-4 appear similar, with NT-4 having a slightly higher affinity for TrkBIg 2. Examination of the crystal structures of NGFTrkAIg 2 (28) and NT-4-TrkBIg 2 (29) shows two areas of interaction. These comprise a conserved and a specificity patch. In the conserved patch, the residues of the neurotrophin and the receptor are conserved. The specificity patch involves the N-terminus of NGF or NT-4 in association with a pocket in the TrkAIg 2 or TrkBIg 2 domain. We describe here a theoretical model of the interaction of TrkBIg 2 with the neurotrophin BDNF. This has been accomplished by reference to both NGFTrkAIg 2 (28) and NT-4-TrkBIg 2 (29) X-ray coordinates. The first stage in the modelling process was to construct a homodimer of BDNF. This was achieved by superimposing a copy of BDNF on its partner in the corresponding heterodimer complex. Performing this on the BDNF/NT-3 complex gave a C␣ RMSD of 1.07 Å between structurally similar elements (88 C␣ positions) while the same process for BDNF/NT-4 gave a C␣ RMSD of 1.92 Å (85 C␣ positions). Hence the BDNF homodimer derived from the BDNF/NT-3 heterodimer was chosen for further modelling. Next, the BDNF dimer was superimposed on the NT-4 dimer of the NT-4-TrkBIg 2 complex giving a C␣ RMSD of 0.72 Å between structurally similar elements (154 C␣ positions). Those N- and C-terminal stretches of backbone which are absent in the BDNF crystal structures were modelled using the corresponding residues present in the NT-4-TrkBIg 2 complex. The residue side chains in these regions were changed according to the BDNF sequence, and the two TrkB domains included, to yield a model of the complete BDNFTrkBIg 2 complex. The model was relaxed by energy minimisation as described under Materials and Methods. Figure 4B shows a superimposition of the BDNFTrkBIg 2 complex on the NT-4-TrkBIg 2 complex; the RMSD between similar structural elements is 0.70 Å (356 pairs of C␣ atoms). Applying the same procedure to BDNF-TrkBIg 2 and NGF-TrkAIg 2 gave a RMSD of 1.15 Å (312 pairs of C␣ atoms) indicating the close similarity between all three complexes. We have shown previously that NT-4 binds to TrkBIg 2 through two contact regions; the conserved patch and the specificity patch (29). Our model of BDNFTrkBIg 2 agrees with this. The X-ray crystal structure of NT-4-TrkBIg 2 shows a conserved salt bridge in the specificity patch, between D298 of TrkBIg 2 and R11 of NT-4. A similar salt bridge is found between D298 of TrkBIg 2 and R7 of BDNF, which may explain similarities of binding affinity between TrkB and its ligands NT-4 and BDNF (Fig. 4C). It is noteworthy that there is no corresponding salt bridge present in the NGFTrkAIg 2 complex, hence this interaction may be the major determinant of the observed specificity of BDNF and NT-4 for TrkB compared with NGF. It is clear that
the binding of BDNF and NT-4 to TrkA would be impeded by the hydrophobic nature of the pocket and the disulphide bond in TrkA. In Parkinson’s disease, there is known to be profound degeneration of the dopaminergic neurons located within the substantia nigra (39). BDNF is known to support the growth of these neurons in culture (40), and has also been shown to support motor neuron survival in vitro (41, 42). In Alzheimer’s disease the level of BDNF mRNA is reduced (43), and there is selective loss of the catalytic form of TrkB (44). BDNF also increases neuronal excitability, and levels are increased in areas of the brain implicated in epileptogenesis (45). Therefore there are many possible therapeutic uses for BDNF/NT-4 agonists/antagonists. Our findings show that the second Ig domain of TrkB is the major contributor to BDNF and NT-4 binding, and that TrkBIg 2 is capable of binding these ligands with sub-nanomolar affinities. These results support the feasibility of using TrkBIg 2 to screen for small molecule mimetics of BDNF, for use in the treatment of neurodegenerative diseases. Using the model, in conjunction with mutation analysis, will reveal the identities and roles of the residues involved in ligandreceptor interaction. ACKNOWLEDGMENTS We thank the following for their support: The Wellcome Trust, Enact Pharma PLC, and BRACE (Bristol Research into Ageing and Care of the Elderly). A.G.S.R. and S.J.A. are Sigmund Gestetner Fellows.
REFERENCES
505
1. Scott, J., Selby, S. M., Urdea, M., Quiroga, M., Bell, G. I., and Rutter, W. J. (1983) Isolation and nucleotide sequence of a cDNA encoding the precursor of mouse nerve growth factor. Nature 302, 538 –540. 2. Ullrich, A., Gray, A., Berman, C., and Dull, T. J. (1983) Human -nerve growth factor gene sequence highly homologous to that of mouse. Nature 303, 821– 825. 3. Kaisho, Y., Yoshimora, K., and Nakahama, K. (1990) Cloning and expression of a cDNA encoding a novel human neurotrophin factor. FEBS Lett. 266, 187–191. 4. Ip, N. Y., Iba´ n˜ ez, C. F., Nye, S. H., McClain, J., Jones, P. F., Gies, D. R., Belluscio, L., LeBeau, M. M., Espinosa, R., III, Squinto, S. P., Persson H., and Yancopoulos, G. D. (1992) Mammalian neurotrophin-4: Structure, chromosomal localisation, tissue distribution and receptor specificity. Proc. Natl. Acad. Sci. USA 89, 3060 –3064. 5. Rodriguez-Te´ bar, A., Dechant, G., Gotz, R., and Barde, Y.-A. (1992) Binding of neurotrophin-3 to its neuronal receptors and interactions with nerve growth-factor and brain-derived neurotrophic factor. EMBO J. 11, 917–922. 6. Kaplan, D. R., Hempstead, B. L., Martin-Zanca, D., Chao, M. V., and Parada, L. F. (1991) The trk proto-oncogene product: A signal transducing receptor for nerve growth factor. Science 252, 554 –558. 7. Klein, R., Jing, S. Q., Nanduri, V., O’Rourke, E., and Barbacid,
Vol. 291, No. 3, 2002
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
M. (1991) The trk proto-oncogene encodes the receptor for nerve growth factor. Cell 65, 189 –197. Glass, D. J., Nye, S. H., Hantzopoulos, P., Macchi, M. J., Squinto, S. P., Goldfarb, M., and Yancopoulos, G. D. (1991) trkB mediates BDNF/NT-3 dependent survival and proliferation in fibroblasts lacking the low affinity NGF-receptor. Cell 66, 405– 413. Ip, N. Y., Stitt, T. N., Tapley, P., Klein, R., Glass, D. J., Fandl, J., Greene, L. A., Barbacid, M., and Yancopoulos. G. D. (1993) Similarities and differences in the way neurotrophins interact with the trk receptors in neuronal and nonneuronal cells. Neuron 10, 137–149. Klein, R., Lamballe, F., Bryant, S., and Barbacid, M. (1992) The trkB tyrosine protein-kinase is a receptor for neurotrophin-4. Neuron 8, 947–956. Lamballe, F., Klein, R., and Barbacid, M. (1991) TrkC, a new member of the trk family of tyrosine protein-kinases, is a receptor for neurotrophin-3. Cell 66, 969 –979. Urfer, R., Tsoulfas, O’Connell, L., Shelton, D. L., Parada, L. F., and Presta, L. G. (1995) An immunoglobulin-like domain determines the specificity of neurotrophin receptors. EMBO J. 14, 2795–2805. Klein, R., Parada, L. F., Coulier, F., and Barbacid, M. (1989) trkB, a novel tyrosine protein kinase receptor expressed during mouse neural development. EMBO J. 8, 3701–3709. Klein, R., Martin-Zanca, D., Barbacid, M., and Parada, L. F. (1990) Expression of the tyrosine kinase receptor gene trkB is confined to the murine embryonic and adult nervous system. Development 109, 845– 850. Klein, R., Conway, D., Parada, L. F., and Barbacid, M. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell 61, 647– 656. Middlemas, D. S., Lindberg, R. A., and Hunter, T. (1991) trk B, a neural receptor protein-tyrosine kinase: Evidence for a fulllength and two truncated receptors. Mol. Cell Biol. 11, 143–153. Allen, S. J., Dawbarn, D., Eckford, S. D., Wilcock, G. K., Ashcroft, M., Colebrook, S. M., Feeney, R., and MacGowan, S. H. (1994) Cloning of a non-catalytic form of human trkB and distribution of messenger RNA for trkB in human brain. Neuroscience 60, 825– 834. Schneider, R., and Schweiger, M. (1991) A novel modular mosaic of cell adhesion motifs in the extracellular domains of the neurogenic trk and trkB tyrosine kinase receptors. Oncogene 6, 1807–1811. Ultsch, M. H., Wiesmann, C., Simmons, L. C., Henrich, J., Yang, M., Reilly, D., Bass, S. H., and de Vos, A. M. (1999) Crystal structures of the neurotrophin-binding domain of TrkA, TrkB and TrkC. J. Mol. Biol. 290, 149 –159. Ninkina, N., Grashchuck, M., Buchman, V. L., and Davies, A. M. (1997) TrkB variants with deletions in the leucine-rich motifs of the extracellular domain. J. Biol. Chem. 272, 13019 –13025. Windisch, J. M., Marksteiner, R., Lang, M. E., Auer, B., and Schneider, R. (1995) Brain-derived neurotrophic factor, neurotrophin-3, and neurotrophin-4 bind to a single leucine-rich motif of TrkB. Biochemistry 34, 11256 –11263. Windisch, J. M., Auer, B., Marksteiner, R., Lang, M. E., and Schneider, R. (1995) Specific neurotrophin binding to leucinerich motif peptides of TrkA and TrkB. FEBS Lett. 374, 125–129. Windisch, J. M., Marksteiner, R., and Schneider, R. (1995) Nerve growth factor binding site on TrkA mapped to a single 24-amino acid leucine-rich motif. J. Biol. Chem. 270, 28133–28138. MacDonald, J. I. S., and Meakin, S. O. (1996) Deletions in the extracellular domain of rat TrkA lead to an altered differentiative phenotype in neurotrophin responsive cells. Mol. Cell. Neurosci. 7, 371–390.
25. Pe´ rez, P., Coll, P. M., Hempstead, B. L., Martin-Zanca, D., and Chao, M. V. (1995) NGF binding to the trk tyrosine kinase receptor requires the extracellular immunoglobulin-like domains. Mol. Cell. Neurosci. 6, 97–105. 26. Holden, P. H., Asopa, V., Robertson, A. G. S., Clarke, A. R., Tyler, S., Bennett, G. S., Brain, S. D., Wilcock, G. K., Allen, S. J., Smith, S. K. F., and Dawbarn, D. (1997) Immunoglobulin-like domains define the nerve growth factor binding site of the TrkA receptor. Nature Biotech. 15, 668 – 672. 27. Urfer, R., Tsoulfas, P., O’Connell, L., Hongo, J.-A., Zhao, W., and Presta, L. G. (1998) High resolution mapping of the binding site of TrkA for nerve growth factor and TrkC for neurotrophin-3 on the second immunoglobulin-like domain of the Trk receptors. J. Biol. Chem 273, 5829 –5840. 28. Wiesmann, C., Ultsch, M. H., Bass, S. H., and de Vos, A. M. (1999) Crystal structure of nerve growth factor in complex with the ligand-binding domain of the TrkA receptor. Nature 401, 184 –188. 29. Banfield, M. J., Naylor, R. L., Robertson, A. G. S., Allen, S. J., Dawbarn, D., and Brady, R. L. (2001) Specificity in Trk-receptor: neurotrophin interaction: The crystal structure of TrkB-d5 in complex with neurotrophin-4/5. Structure 9, 1191–1199 30. Robertson, A. G. S., Banfield, M. J., Allen, S. J., Dando, J. A., Mason, G. G. F., Tyler, S. J., Bennett, G. S., Brain, S. D., Clarke, A. R., Naylor, R. L., Wilcock, G. K., Brady, R. L., and Dawbarn, D. (2001) Identification and structure of the nerve growth factor binding site on TrkA. Biochem. Biophys. Res. Commun. 282, 131–141. 31. Allen, S. J., Wilcock, G. K., and Dawbarn, D. (1999) Profound and selective loss of catalytic TrkB immunoreactivity in Alzheimer’s disease. Biochem. Biophys. Res. Commun. 264, 648 – 651. 32. Allen, S. J., Robertson, A. G. S., Tyler, S., Wilcock, G. K., and Dawbarn, D. (2001) Recombinant human nerve growth factor for clinical trials: Protein expression, purification, stability and characterisation of binding to infusion pumps. J. Biochem. Biophys. Methods 47, 239 –255. 33. Guex, N., and Peitsch, M. C. (1997) SWISS-MODEL and the Swiss-Pdb Viewer: An environment for comparative protein modelling. Electrophoresis 18, 2714 –2723. 34. Rodrigeuz-Te´ bar, A., and Barde, Y.-A. (1988) Binding characteristics of brain-derived neurotrophic factor to its receptors on neurons from the chick embryo. J. Neurosci. 8, 3337–3342. 35. Squinto, S. P., Stitt, T. N., Aldrich, T. H., Davis, S., Bianco, S. M., Radziejewski, C., Glass, D. J., Masiakowski, P., Furth, M. E., Valenzuela, D. M., DiStefano, P. S., and Yancopoulos, G. D. (1991) trkB encodes a functional receptor for brain-derived neurotrophic factor and neurotrophin-3 but not nerve growth factor. Cell 65, 885– 893. 36. Dechant, G., Biffo, S., Okazawa, H., Kolbeck, R., Pottgiesser, J., and Barde, Y.-A. (1993) Expression and binding characteristics of the BDNF receptor chick trkB. Development 119, 545–558. 37. Fandl, J. P., Tobkes, N. J., McDonald, N. Q., Hendrickson, W. A., Ryan, T. E., Nigam, S., Acheson, A., Cudny, H., and Panayotatos, N. (1994) Characterization and crystallization of recombinant human neurotrophin-4. J. Biol. Chem. 269 755–759. 38. Klein, R., Nanduri, V., Jing, S., Lamballe, F., Tapley, P., Bryant, S., Cordon-Cardo, C., Jones, K. R., Reichardt, L. F., and Barbacid, M. (1991) The trkB tryrosine protein kinase is a receptor for brain-derived neurotrophic factor and neurotrophin-3. Cell 66, 395– 403. 39. Kernie, S. G., and Parada, L. F. (2000) The molecular basis for understanding neurotrophins and their relevance to neurologic disease. Arch. Neurol. 57, 654 – 657. 40. Hyman, C., Hofer, M., Barde, Y.-A., Yahasz, M., Yancopoulos,
506
Vol. 291, No. 3, 2002
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
G. D., Squinto, S. P., and Lindsay, R. M. (1991) BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 350, 230 –232. 41. Sendtner, M., Holtmann, B., Kolbeck, R., Thoenen, H., and Barde, Y.-A. (1992) Brain-derived neurotrophic factor prevents the death of motor neurons in newborn rats after nerve section. Nature 360, 757–759. 42. Yan, O., Elliot, J., and Snider, W. D. (1992) Brain-derived neuro-
trophic factor rescues spinal motor neurons from axotomyinduced cell death. Nature 360, 753–755. 44. Allen, S. J., Wilcock, G. K., and Dawbarn, D. (1999) Profound and selective loss of catalytic TrkB immunoreactivity in Alzheimer’s disease. Biochem. Biophys. Res. Commun. 264, 648 – 651. 45. Binder, D. K., Croll, S. D., Gall, C. M., and Scharfman, H. E. (2001) BDNF and epilepsy: Too much of a good thing? Trends Neurosci. 24, 47–53.
507