- Email: [email protected]
A Japanese case of Creutzfeldt-Jakob disease with a point mutation in the prion protein gene at codon 210
JOURNAL
OF THE
NEUROLOGICAL SCIENCES
ELSEVIER
Journal of the Neurological Sciences141 ( 1996) 120- 122
Short report
A Japanese case of Creutzfeldt-Jakob disease with a point mutation in the prion protein gene at codon 210 Hisako Furukawa a3b3 * , Tetsuyuki Kitamoto ‘, Hideyuki Hashiguchi d, Jun Tateishi b a Department of Neurology, Neurological Institute, Faculty of Medicine, Kyushu University, Maidashi, Fukuoka 812-82 Japan b Neuropathology, Neurological Institute, Faculty of Medicine, Kyushu l&tier&y, Fukuoka Japan ’ Department of Neurological Sciences, Tohoku University School of Medicine, Sendai Japan ’ Department of Neurology, Shimonoseki Welfare Hospital, Shimonoseki Japan
Received 26 March 1996;accepted 17 April 1996
Abstract We screened 111 cases of sporadic Creutzfeldt-Jakob disease (CJD) and 75 healthy control subjects in Japan to detect possible polymorphisms in their prion protein gene (PRNP). We identified a G-to-A point substitution at codon 210, leading a valine-to-isoleucine change, in a 69-year-old CJD patient. This substitution was not seen in 75 healthy control subjects. Keywords: Creutzfeldt-Jakobdisease;Prion protein; Dementia
1. Introduction
2.
Creutzfeldt-Jakob disease (CJD), kuru, and GerstmannStrgussler syndrome are transmissible neurodegenerative diseases. These diseases are caused by unusual infectious agents called prions, the major component of which is the proteinase-resistant prion protein (PrP”“). PrP is encoded in normal human genome (chromosome 20), but in normal individuals, prion protein is proteinase-sensitive (PI-P”) (Prusiner, 1982). Since Hsiao et al. reported a proline-toleucine substitution at codon 102, many mutations and polymorphisms in the prion protein gene (PRNP) have been reported (Hsiao et al., 1989). Recently, Rip011 et al. and Pocchiari et al. reported some cases of CJD with a codon 210 mutations (Maurizio et al., 1993; Rip011 et al., 1993). We screened 111 cases of sporadic CJD and 75 healthy control subjects in Japan to detect possible polymorphisms and mutations, including those in codon 2 10, in their PRNP. Here, we report the first Japanese case of CJD with codon 210 mutation.
The patient was a 69-year-old man. At the ages of 58 and 67, he suffered from cerebral infarction of the territories of right middle cerebral artery and left posterior inferior cerebellar artery. At the age of 69, he developed sub acutely progressive memory and gait disturbance and abnormal behavior. Brain magnetic resonance imaging (MRI) and brain computed tomography (CT) revealed moderate brain atrophy without fresh hemorrhage or infarction. Cerebrospinal fluid examination was negative. Two months later, he presented akinetic mutism with massive myoclonus in all limbs and periodic synchronous discharge was observed on electroencephalography (EEG). He developed repeated aspiration pneumonia and died of respiratory failure five months after onset. No autopsy examination was performed. His father died at young age and his mother had died of renal disease. His younger sister died of bad nutrition just after World War II. He did not have any children and there was no information available about other relatives.
Case report
2.1. Subjects
* Corresponding author. Tel: + 81 (92) 641-l 151. Fax: + 81 (92) 632-3343.
We analyzed DNA from 111 unrelated CJD patients and 75 healthy control subjects. Seventeen patients were
0022-510X/96/$15.00 Copyright 0 1996 Elsevier Science B.V. All rights reserved. PII SOO22-510X(96)00157-8
H. Furukawa et al./ Journal of the Neurological
codon 210 G to A GTGkTTGAGCAGATG mismatched primer
GTGATTCAGCAGATG
Mutant
Hinf I
GTGGTTCAGCAGATG
wild
uncut Fig. 1. Strategy for the detection of codon 210 mutation (Val to ne). We prepared a mismatched antisense primer (CH-12) to introduce an Hid site in the Ile210 allele, but not in the Va1210 allele.
neuropathologically confirmed as having CJD. Other patients showed sub acutely progressive dementia and myoclonus with periodic synchronous discharge on EEG and they were clinically diagnosed as CJD. 2.2. Polymerase chain reaction and restriction fragment length polymorphism (RFLP)
Sciences 141 (1996) 120-122
121
was performed as described with CH-1 (ACTCTGACATTCTCCTCTTCA) sense primer and CH-2 (AAGCTGGAAAAAGAITAGAAAG) antisense primer. The 847-bp PCR product was digested with DdeI, AU, PuuII, NspI, MaeI, TthIII-1, and BsmA-I to check for codon 102, 105, 117, 129, 145, 178, 180, and 200. To detect codon 219 polymorphism, we prepared a mismatched sense primer SC-~ and matched antisense primer SC-~, and the nested PCR product was then digested with SplI (Kitamoto and Tateishi, 1994). 2.3. PCR using a mismatched primer To detect the codon 210 mutation, we prepared a matched sense primer CH- 11 (ACAGCAACCAGAACAA CTTTG), and new mismatched antisense primer CH-12 (TACTGGGTGATACACATC TGcTGAA). The nested PCR products (148 bp) with CH-11 and CH-12 primers had no HinfI restriction site (GANTC) in the VaZ allele at codon 210, but did show this site in the Zle allele. Hinff cut the ZZe allele PCR products into 122 and 26 bp fragments (Figs. 1 and 2).
High molecular weight DNA was extracted from peripheral lymphocytes. Polymerase chain reaction (PCR)
MU1
2
3. Results We identified one case of CJD with codon 210 mutation. This patient was a 69-year-old man. He developed sub acutely progressive memory disturbance, gait disturbance and abnormal behavior followed by myoclonus of all limbs. RFLP of the PRNP of the patient revealed a G-to-A substitution in one allele at the first portion of codon 210, which resulted in the substitution of valine by isoleucine (Fig. 2). The patient had Met/Met alleles at codon 129. We also performed direct sequencing of the total open reading frame of the PrP gene using DyeDeoxy terminators (Applied Biosystems). This analysis confirmed a G-toA substitution at codon 210 and there were no other mutations or polymorphisms in the ORF of PRNP. We screened 110 other sporadic CJD patients and 75 healthy control subjects for codon 2 10 mutation using CH-11 and CH-12 primers. None of these subjects had this mutation in their ORF of the PrP gene.
4. Discussion
Fig. 2. Restriction analysis of PCR products generated with CH-11 and CH-12 primers with Hinf I digestion. Lanes 1 and 2, the Hi&I-digested PCR product from the patient (Lane 1) and control subject (Lane 2). Lane U, undigested PCR product with CH-1 and CH-2 primers. In Lane 1, a digested 122 bp fragment was detected in addition to the undigested 148 bp PCR product on 3% MetaPhor agarose gel.
Rip011 et al. reported a case of sporadic CJD with codon 210 mutation in 1993 (Rip011 et al., 1993). Their patient showed typical clinical and pathological features of CJD. On the other hand, Pocchiari et al. reported an Italian family with CJD showing codon 210 mutation. This Italian case had a new 24-bp deletion in the other allele.
122
H. Furukawa et al./Joumal
of the Neurological Sciences 141 (1996) 120-122
We recently prepared a mismatched primer (CH-12) to detect codon 210 mutation and found a patient with clinically diagnosed CJD with this mutation. In our case, family members died due to other causes while still young, so we could not determine whether this case represented sporadic or familial CJD. However, his clinical features were similar to those of sporadic CJD with wild-type PRNP. In addition to sporadic CJD, we screened 6 cases of familial CJD and one case of fatal familial insomnia. Four cases had Glu/Lys alleles at codon 200 and two cases had Ile/Val at codon 180. All of them had Vul/Val alleles at codon 210.
Acknowledgements We thank Dr. Shin-ichi Hosokawa and many other neurologists for providing the cases on which our study was based. This study was supported by a Grant-in-Aid for Scientific Research (T.K., J.T.) and a Grant-in-Aid Scien-
tific Research on priority Area (J.T.) from the Ministry of Education Science and Culture, and a grant (J.T.) from the Ministry of Health and Welfare, Japan.
References Hsiao K., Baker HF., Crow TJ., Poulter M., Owen F., Terwilliger JD., Westaway D., Ott J. and Prusiner SB. (1989) Linkage of a prion protein missense variant to Gerstmann-Straussler syndrome. Nature; 338: 342-345. Kitamoto T. and Tateishi J. (1994) Human prion diseases with variant prion protein. Phil. Trans. R. Sot. Lond. B; 343: 391-398. Maurizio P., Mirella S., Francesca C., Maurizio G., Carlo T.A., Carlo M., Giorgio M., Giovanni A., Simona G., You G.X., Rosella P., Maria C.S. and Maurizio B. (1993) A new point mutation of the prion protein gene in Creutzfeldt-Jakob disease. Ann Neurol; 34: 802-807. Prusiner SB. (1982) Novel proteinaceous infectious particles cause scrapie. Science; 216: 136-144. Rip011 L., Laplanche J-L., Salzmann M., Jouvet A., Plaques B., Dussaucy M., Chatelain J., Beaudry P. and Launay J-M. (1993) A new point mutation in tne prion protein gene at codon 210 in CreutzfeldtJakob disease. Neurology; 43: 1934-1938.
OF THE
NEUROLOGICAL SCIENCES
ELSEVIER
Journal of the Neurological Sciences141 ( 1996) 120- 122
Short report
A Japanese case of Creutzfeldt-Jakob disease with a point mutation in the prion protein gene at codon 210 Hisako Furukawa a3b3 * , Tetsuyuki Kitamoto ‘, Hideyuki Hashiguchi d, Jun Tateishi b a Department of Neurology, Neurological Institute, Faculty of Medicine, Kyushu University, Maidashi, Fukuoka 812-82 Japan b Neuropathology, Neurological Institute, Faculty of Medicine, Kyushu l&tier&y, Fukuoka Japan ’ Department of Neurological Sciences, Tohoku University School of Medicine, Sendai Japan ’ Department of Neurology, Shimonoseki Welfare Hospital, Shimonoseki Japan
Received 26 March 1996;accepted 17 April 1996
Abstract We screened 111 cases of sporadic Creutzfeldt-Jakob disease (CJD) and 75 healthy control subjects in Japan to detect possible polymorphisms in their prion protein gene (PRNP). We identified a G-to-A point substitution at codon 210, leading a valine-to-isoleucine change, in a 69-year-old CJD patient. This substitution was not seen in 75 healthy control subjects. Keywords: Creutzfeldt-Jakobdisease;Prion protein; Dementia
1. Introduction
2.
Creutzfeldt-Jakob disease (CJD), kuru, and GerstmannStrgussler syndrome are transmissible neurodegenerative diseases. These diseases are caused by unusual infectious agents called prions, the major component of which is the proteinase-resistant prion protein (PrP”“). PrP is encoded in normal human genome (chromosome 20), but in normal individuals, prion protein is proteinase-sensitive (PI-P”) (Prusiner, 1982). Since Hsiao et al. reported a proline-toleucine substitution at codon 102, many mutations and polymorphisms in the prion protein gene (PRNP) have been reported (Hsiao et al., 1989). Recently, Rip011 et al. and Pocchiari et al. reported some cases of CJD with a codon 210 mutations (Maurizio et al., 1993; Rip011 et al., 1993). We screened 111 cases of sporadic CJD and 75 healthy control subjects in Japan to detect possible polymorphisms and mutations, including those in codon 2 10, in their PRNP. Here, we report the first Japanese case of CJD with codon 210 mutation.
The patient was a 69-year-old man. At the ages of 58 and 67, he suffered from cerebral infarction of the territories of right middle cerebral artery and left posterior inferior cerebellar artery. At the age of 69, he developed sub acutely progressive memory and gait disturbance and abnormal behavior. Brain magnetic resonance imaging (MRI) and brain computed tomography (CT) revealed moderate brain atrophy without fresh hemorrhage or infarction. Cerebrospinal fluid examination was negative. Two months later, he presented akinetic mutism with massive myoclonus in all limbs and periodic synchronous discharge was observed on electroencephalography (EEG). He developed repeated aspiration pneumonia and died of respiratory failure five months after onset. No autopsy examination was performed. His father died at young age and his mother had died of renal disease. His younger sister died of bad nutrition just after World War II. He did not have any children and there was no information available about other relatives.
Case report
2.1. Subjects
* Corresponding author. Tel: + 81 (92) 641-l 151. Fax: + 81 (92) 632-3343.
We analyzed DNA from 111 unrelated CJD patients and 75 healthy control subjects. Seventeen patients were
0022-510X/96/$15.00 Copyright 0 1996 Elsevier Science B.V. All rights reserved. PII SOO22-510X(96)00157-8
H. Furukawa et al./ Journal of the Neurological
codon 210 G to A GTGkTTGAGCAGATG mismatched primer
GTGATTCAGCAGATG
Mutant
Hinf I
GTGGTTCAGCAGATG
wild
uncut Fig. 1. Strategy for the detection of codon 210 mutation (Val to ne). We prepared a mismatched antisense primer (CH-12) to introduce an Hid site in the Ile210 allele, but not in the Va1210 allele.
neuropathologically confirmed as having CJD. Other patients showed sub acutely progressive dementia and myoclonus with periodic synchronous discharge on EEG and they were clinically diagnosed as CJD. 2.2. Polymerase chain reaction and restriction fragment length polymorphism (RFLP)
Sciences 141 (1996) 120-122
121
was performed as described with CH-1 (ACTCTGACATTCTCCTCTTCA) sense primer and CH-2 (AAGCTGGAAAAAGAITAGAAAG) antisense primer. The 847-bp PCR product was digested with DdeI, AU, PuuII, NspI, MaeI, TthIII-1, and BsmA-I to check for codon 102, 105, 117, 129, 145, 178, 180, and 200. To detect codon 219 polymorphism, we prepared a mismatched sense primer SC-~ and matched antisense primer SC-~, and the nested PCR product was then digested with SplI (Kitamoto and Tateishi, 1994). 2.3. PCR using a mismatched primer To detect the codon 210 mutation, we prepared a matched sense primer CH- 11 (ACAGCAACCAGAACAA CTTTG), and new mismatched antisense primer CH-12 (TACTGGGTGATACACATC TGcTGAA). The nested PCR products (148 bp) with CH-11 and CH-12 primers had no HinfI restriction site (GANTC) in the VaZ allele at codon 210, but did show this site in the Zle allele. Hinff cut the ZZe allele PCR products into 122 and 26 bp fragments (Figs. 1 and 2).
High molecular weight DNA was extracted from peripheral lymphocytes. Polymerase chain reaction (PCR)
MU1
2
3. Results We identified one case of CJD with codon 210 mutation. This patient was a 69-year-old man. He developed sub acutely progressive memory disturbance, gait disturbance and abnormal behavior followed by myoclonus of all limbs. RFLP of the PRNP of the patient revealed a G-to-A substitution in one allele at the first portion of codon 210, which resulted in the substitution of valine by isoleucine (Fig. 2). The patient had Met/Met alleles at codon 129. We also performed direct sequencing of the total open reading frame of the PrP gene using DyeDeoxy terminators (Applied Biosystems). This analysis confirmed a G-toA substitution at codon 210 and there were no other mutations or polymorphisms in the ORF of PRNP. We screened 110 other sporadic CJD patients and 75 healthy control subjects for codon 2 10 mutation using CH-11 and CH-12 primers. None of these subjects had this mutation in their ORF of the PrP gene.
4. Discussion
Fig. 2. Restriction analysis of PCR products generated with CH-11 and CH-12 primers with Hinf I digestion. Lanes 1 and 2, the Hi&I-digested PCR product from the patient (Lane 1) and control subject (Lane 2). Lane U, undigested PCR product with CH-1 and CH-2 primers. In Lane 1, a digested 122 bp fragment was detected in addition to the undigested 148 bp PCR product on 3% MetaPhor agarose gel.
Rip011 et al. reported a case of sporadic CJD with codon 210 mutation in 1993 (Rip011 et al., 1993). Their patient showed typical clinical and pathological features of CJD. On the other hand, Pocchiari et al. reported an Italian family with CJD showing codon 210 mutation. This Italian case had a new 24-bp deletion in the other allele.
122
H. Furukawa et al./Joumal
of the Neurological Sciences 141 (1996) 120-122
We recently prepared a mismatched primer (CH-12) to detect codon 210 mutation and found a patient with clinically diagnosed CJD with this mutation. In our case, family members died due to other causes while still young, so we could not determine whether this case represented sporadic or familial CJD. However, his clinical features were similar to those of sporadic CJD with wild-type PRNP. In addition to sporadic CJD, we screened 6 cases of familial CJD and one case of fatal familial insomnia. Four cases had Glu/Lys alleles at codon 200 and two cases had Ile/Val at codon 180. All of them had Vul/Val alleles at codon 210.
Acknowledgements We thank Dr. Shin-ichi Hosokawa and many other neurologists for providing the cases on which our study was based. This study was supported by a Grant-in-Aid for Scientific Research (T.K., J.T.) and a Grant-in-Aid Scien-
tific Research on priority Area (J.T.) from the Ministry of Education Science and Culture, and a grant (J.T.) from the Ministry of Health and Welfare, Japan.
References Hsiao K., Baker HF., Crow TJ., Poulter M., Owen F., Terwilliger JD., Westaway D., Ott J. and Prusiner SB. (1989) Linkage of a prion protein missense variant to Gerstmann-Straussler syndrome. Nature; 338: 342-345. Kitamoto T. and Tateishi J. (1994) Human prion diseases with variant prion protein. Phil. Trans. R. Sot. Lond. B; 343: 391-398. Maurizio P., Mirella S., Francesca C., Maurizio G., Carlo T.A., Carlo M., Giorgio M., Giovanni A., Simona G., You G.X., Rosella P., Maria C.S. and Maurizio B. (1993) A new point mutation of the prion protein gene in Creutzfeldt-Jakob disease. Ann Neurol; 34: 802-807. Prusiner SB. (1982) Novel proteinaceous infectious particles cause scrapie. Science; 216: 136-144. Rip011 L., Laplanche J-L., Salzmann M., Jouvet A., Plaques B., Dussaucy M., Chatelain J., Beaudry P. and Launay J-M. (1993) A new point mutation in tne prion protein gene at codon 210 in CreutzfeldtJakob disease. Neurology; 43: 1934-1938.