A multilocus sequence analysis of the genus Xanthomonas

ARTICLE IN PRESS

Systematic and Applied Microbiology 31 (2008) 366–377 www.elsevier.de/syapm

A multilocus sequence analysis of the genus Xanthomonas$ J.M. Younga,, D.-C. Parka, H.M. Shearmanb, E. Fargierc,1 a

Landcare Research, Private Bag 92170, Auckland, New Zealand Allan Wilson Centre for Molecular Ecology and Evolution, Massey University, Private Bag 11222, Palmerston North, New Zealand c UMR Pathologie Ve´ge´tale, INRA, F-49071 Beaucouze´, France b

Received 12 March 2008

Abstract A multilocus sequence analysis (MLSA) of strains representing all validly published Xanthomonas spp. (119 strains) was conducted using four genes; dnaK, fyuA, gyrB and rpoD, a total of 440 sequences. Xanthomonas spp. were divided into two groups similar to those indicated in earlier 16S rDNA comparative analyses, and they possibly represent distinct genera. The analysis clearly differentiated most species that have been established by DNA–DNA reassociation. A similarity matrix of the data indicated clear numerical differences that could form the basis for species differentiation in the future, as an alternative to DNA–DNA reassociation. Some species, X. cynarae, X. gardneri and X. hortorum, formed a single heterogeneous group that is in need of further investigation. X. gardneri appeared to be a synonym of X. cynarae. Recently proposed new species, X. alfalfae, X. citri, X. euvesicatoria, X. fuscans and X. perforans, were not clearly differentiated as species from X. axonopodis, and X. euvesicatoria and X. perforans are very probably synonyms. MLSA offers a powerful tool for further investigation of the classification of Xanthomonas. Based on the dataset produced, the method also offers a relatively simple way of identifying strains as members of known species, or of indicating their status as members of new species. r 2008 Elsevier GmbH. All rights reserved. Keywords: DNA–DNA reassociation; MLSA; Plant pathogen; Taxonomy

Introduction The nomenclature of the genus Xanthomonas based on the studies of Dye [5] resulted in the publication of five species in the Approved Lists [29], with more than $ Nucleotide sequence data reported are available in the DDBJ/EMBL/GenBank databases under the accession numbers: dnaK, EU498747–EU498848; fyuA, EU498849–EU498947; gyrB, EU498948–EU499066; rpoD, EU499067––EU499186. Corresponding author. Tel.: +64 9 574 4124; fax: +64 9 574 4101. E-mail address: [email protected] (J.M. Young). 1 Present address: Microbiology Department, Biomerit Research Centre, National University of Ireland, Cork, Ireland.

0723-2020/$ - see front matter r 2008 Elsevier GmbH. All rights reserved. doi:10.1016/j.syapm.2008.06.004

110 pathogens identified at the infrasubspecific level as pathovars. Following the recommendation of Wayne et al. [36], differentiation of species has depended, by convention, on DNA–DNA hybridization studies and the application of arbitrary calibration values for DNA–DNA reassociation (70%) and DTm (o5 1C). The requirement that species proposals include this standard method reduced the likelihood of proposals based on different incongruent methods and the creation of many synonyms. Although DNA–DNA reassociation offered a simple criterion for species circumscriptions, wider application in different taxonomic groups of organisms has shown

ARTICLE IN PRESS J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

that it fails to differentiate some taxa and indicates amalgamation of others that have distinct phenotypic differences that may merit species recognition [3,10]. Furthermore, DNA–DNA reassociation studies are intensive and expensive; there is a difficulty of standardization between laboratories, and with increasing numbers of species requiring comparison, it is impractical for all but a few specialist laboratories [19,34]. Based on DNA–DNA reassociation data, Vauterin et al. [35] proposed a revision of Xanthomonas that resulted in the recognition of 20 species, to which they reallocated 62 pathovars of the 150 then reported. The species of Vauterin et al. [35] were supported by polyacrylamide gel electrophoresis of proteins and fatty acid profiles, but there were no portable methods of identification for the routine allocation of strains to many of these species [37]. This approach to the classification and nomenclature of Xanthomonas has made the allocation of unidentified strains to taxa practically impossible. Since this work was conducted, only three additional reports of new species and new species combinations in Xanthomonas have been made [15,27,33]. Most of the species of Vauterin et al. [35] circumscribed distinct pathogenic populations, indicating that DNA–DNA reassociation characterized these pathogens as natural ecological groups. However, many pathogens included in a few species, namely X. arboricola, X. axonopodis, X. campestris, X. oryzae and X. translucens, differed from other members of their species by only a few phenotypic differences and required classification at subspecific or infrasubspecific levels, as subspecies or pathovars. Rademaker et al. [22] showed that the classification of Vauterin et al. [35] was supported by a combined rep-PCR analysis [17], as well as by AFLP, and Rademaker et al. [23] showed that a more refined discrimination was possible within the heterogeneous species X. axonopodis. Maiden et al. [18] proposed that classification could be refined by generating a representation of the chromosome using multilocus sequence typing (MLST) – concatenation of a selection of suitable protein-coding genes and identification of allelic mismatches at the loci of closely related organisms. The concept has been extended to a consideration of more diverse taxa to include whole genera using sequences of protein-coding genes, called multilocus sequence analysis (MLSA) [10]. MLSA is increasingly seen as offering an alternative, more flexible way of comparing bacteria, towards the development of a species concept. Gevers et al. [10] provide a critical and comprehensive review of this approach to taxonomic differentiation. Some pathogenic species, Pseudomonas syringae [14,25] and Xylella fastidiosa [26], have been studied without drawing taxonomic conclusions, but the method is

367

increasingly being considered in the inference of species relationships [2,4,10,12,19,24]. In a recent MLSA of Xanthomonas, Fargier and Manceau [7] investigated six house-keeping genes (atpD, dnaK, glnA, gyrB, rpoD and tpiA) and the structural gene, fyuA, as the basis for differentiation within Xanthomonas. Of these, four gene sequences, the chaperone protein dnaK (dnaK), tonB-dependent receptor (fyuA), DNA gyrase subunit B (gyrB) and RNA polymerase sigma factor (rpoD) were congruent in their representation of Xanthomonas spp. Partial sequences of these genes were used in the present study to consider the extent to which these genes in an MLSA might reflect the species relationships indicated by DNA–DNA reassociation and, therefore, the likelihood that this method offers an alternative to support species characterization. The classifications of Vauterin et al. [35] and Rademaker et al. [22,23] are used as the points of departure in this study for a reconsideration of Xanthomonas species using MLSA.

Materials and methods Strains Strains were obtained from the International Collection of Micro-organisms from Plants (ICMP), Landcare Research, Auckland. Information on these strains is given at the ICMP website (http://www.landcarere search.co.nz/research/biodiversity/fungiprog/icmp.asp), and is listed in Table 1. All numbers in this text refer to ICMP depositions and the nomenclature of Vauterin et al. [35] is used.

DNA extraction Strains were cultured on nutrient agar (Difco, USA) and incubated at 27 1C for 2–4 days. Genomic DNA was directly extracted from colonies grown on nutrient agar using a REDExtract-N-Amp Plant PCR kit (Sigma, USA).

Amplification and sequencing Degenerate primers for partial sequences of dnaK, fyuA, gyrB and rpoD (Table 2) were developed from genomic Xanthomonas sequences in GenBank; X. campestris pv. vesicatoria AM039952, X. oryzae pv. oryzae AE013598, X. axonopodis pv. citri AE008923 and X. campestris pv. campestris AE008922. PCR amplifications were performed with initial denaturation at 94 1C for 3 min, 30 cycles of denaturation at 94 1C for 30 s, annealing at 54 1C for 30 s,

ARTICLE IN PRESS 368

Table 1.

J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

Names of Xanthomonas strains referred to in this study, with ICMP numbers

Code

Species name

Xal Xarar Xarce Xarco Xarpo Xarpr Xaxal Xaxau Xaxax Xaxbe Xaxca Xaxgl Xaxci Xaxct Xaxma Xaxml Xaxph Xaxpf Xaxri Xaxva Xaxve Xaxvi Xbr Xcac Xcai Xcar Xca Xco Xcu Xcy Xdy Xfr Xga Xhoh Xhoh Xhop Xhot Xhy Xme Xoro Xorz Xpe Xpi Xpo Xsa Xth Xtrc Xtrg Xtrs Xtrt Xtru Xva Xve Sma

albilineans arboricola pv. arboricola arboricola pv. celebensis arboricola pv. corylina arboricola pv. populi arboricola pv. pruni axonopodis pv. alfalfae axonopodis pv. ‘aurantifolii’ axonopodis pv. axonopodis axonopodis pv. begoniae axonopodis pv. cajani axonopodis pv. glycines axonopodis pv. citri axonopodis pv. ‘citrumelo’ axonopodis pv. manihotis axonopodis pv. malvacearum axonopodis pv. phaseoli axonopodis pv. phaseoli (biovar. fuscans) axonopodis pv. ricini axonopodis pv. vasculorum axonopodis pv. vesicatoria axonopodis pv. vignicola bromi campestris pv. campestris campestris pv. incanae campestris pv. raphani cassavae codiaei cucurbitae cynarae strains from Dysoxylum sp. fragariae gardneri hortorum pv. hederae hortorum pv. hederae hortorum pv. pelargonii hortorum pv. taraxaci hyacinthi melonis oryzae pv. oryzae oryzae pv. oryzicola perforans pisi populi sacchari theicola translucens pv. cerealis translucens pv. graminis translucens pv. secalis translucens pv. translucens translucens pv. undulosa vasicola vesicatoria S. maltophilia

Also called

X. alfalfae subsp. alfalfae X. fuscans subsp. aurantifolii

X. citri subsp. citri X. alfalfae subsp. citrumelonis X. citri subsp. malvacearum X. fuscans subsp. fuscans

X. euvesicatoria

ICMP # 196a, 1590, 8679, 10041b 35a 1488c 5726c 8923c 51c 4765, 5718c 8432, 10027, 10030 50a, 698b 8681 194c 444c 5732c, 244 21, 24c, 7493, 10022 10009, 10010, 10014 5741c 217, 5739, 9280 5834c 239a (X. fuscans), 5807, 12325 3031, 7462 304, 356, 5757c 109a (X. euvesicatoria), 172, 4779 333c 12545a 13a, 6541 574c 1404c 204a, 8666, 8667 9512, 9513a 203b 2179, 2299a, 4767 16774, 16775a, 16776 2415a, 6465, 16370, 16372, 16466, 16468, 16473 659, 5715a, 5797, 6646 16689a 453a 1661 4319, 4321c 579c 187, 188, 189a, 190 8682a, 8683, 8686, 8689 440, 3125a 5743, 12013 16690a 570a 5816a, 5836, 7728, 9893b 9984b 16916a, 16917, 16918 6774a, 7291, 7294 1409c 5733c 5749c 5752a 5755c 451, 3103a, 3490, 12004 115, 63a, 696, 1643b 8037b 9593b 17033a

The nomenclature of Vauterin et al. [35] is used. Codes refer to use in the figures. All species epithets with citations are recorded at the website of J. Euze´by (/http://www.bacterio.netS). a Type strain of species. b Data from the study indicate that the strain is misplaced. c Pathotype strain.

ARTICLE IN PRESS J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

Table 2.

369

Primers used in this study

Sequence

Forward

Reverse

dnaK

XdnaK1F GGTGGAAGACCTGGTCAAGA XfyuA1F AGCTACGAYGTGCGYTACGA XgyrB1F ACGAGTACAACCCGGACAA XrpoD1F TGGAACAGGGCTATCTGACC

XdnaK1R TCCTTGACYTCGGTGAACTC XfyuA1R GTTCACGCCRAACTGGTAG XgyrB1R CCCATCARGGTGCTGAAGAT XrpoD1R CATTCYAGGTTGGTCTGRTT

fyuA gyrB rpoD

extension at 72 1C for 1 min and final extension at 72 1C for 10 min. PCR products, purified with a Qiagen MinElute 96 UF PCR Purification Kit (Qiagen, USA), were cycle sequenced with the appropriate primers using BigDye Terminator Ready Reaction Mix v3.1 (ABI) and sequences were obtained in both directions with an ABI PRISM 3100 Avant Genetic Analyzer. Sequences were assembled and edited with Sequencher 4.6 (Gene Codes Corporation).

likelihood trees were built in PAUP* version 4.0b10, using the models found by ModelTest. A similarity matrix of all sequences was prepared using PAUP* and average values with standard deviations for all pair-wise relationships were obtained. A similarity matrix of sequences representing X. axonopodis (sensu Vauterin et al., [35]) was also prepared.

Results Sequence analyses Nucleotide sequences were aligned with Clustal X 1.83 using default parameters and both ends of each alignment were trimmed to the following sizes: dnaK, 940 positions; fyuA, 698 positions; gyrB, 865 positions, and rpoD, 875 positions. Sequences were concatenated to give a total length of 3378 positions. Peptide sequences for dnaK, fyuA, gyrB and rpoD were determined using GeneDoc, aligned using Clustal X and manually edited again using GeneDoc to ensure that alignment gaps in protein-coding genes did not cause errors in the amino acid sequence. Calculated peptide sequence lengths for dnaK, fyuA, gyrB and rpoD were 312, 232, 288 and 293 amino acids, respectively, resulting in a concatenated peptide length of 1125 amino acids. Concatenated sequences were compared using PAUP* version 4.0b10 with the neighbour-joining (NJ) minimum evolution, and parsimony algorithms. For the NJ analysis, an uncorrected ‘p’ distance and the Jukes–Cantor model were used. Under minimum evolution all characters were given equal weight, and support for nodes was based on 1000 bootstrap replicates. For Parsimony, the analysis was run with heuristic searches with TBR branch swapping, and random addition of taxa. An incongruence length difference (ILD) analysis, based on the parsimony algorithm implemented in PAUP* and applying 100 bootstrap replicates, tested for incongruence between gene sequences. Model selection was performed using ModelTest 3.7. Maximum

All four gene sequences were amplified for most strains of X. arboricola, X. axonopodis, X. bromi, X. campestris, X. cassavae, X. codiaei, X. cucurbitae, X. fragariae, X. hortorum, X. melonis, X. oryzae, X. pisi, X. populi, X. vasicola and X. vesicatoria. In spite of efforts to find alternative primers, attempts to amplify fyuA for X. cassavae ICMP 8666 and 8667 and Stenotrophomonas maltophilia ICMP 17033, and gyrB for X. melonis were unsuccessful. There was also a consistent failure to obtain dnaK and fyuA for X. albilineans, X. hyacinthi, X. sacchari, X. theicola and X. translucens. Success was usual for all four nucleotide sequences for species in group 2 (Fig. 1). The outgroup was the appropriate nucleotide sequence from the type strain of S. maltophilia ICMP 17033. Because amplification of the fyuA sequence of S. maltophilia was not successful, a synthetic outgroup, derived by introducing random changes to a sequence of X. campestris, was used for this gene. NJ trees, whether based on concatenation of all four genes (Fig. 1) or single genes (Supplementary Figs. 4–7), produced practically identical structures. A tree of the concatenated peptide sequences based on the NJ algorithm (Supplementary Fig. 1) was not structurally different from those based on gene sequences. A tree based on the parsimony algorithm of concatenated gene sequences (Supplementary Fig. 2) produced essentially the same tree structure as the NJ algorithm. A tree of the concatenated peptide sequences based on the parsimony algorithm (Supplementary Fig. 3) was not structurally different from those based on gene sequences. Of the

ARTICLE IN PRESS 370

J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

trees for individual nucleotide sequences, only gyrB, in which sequences of X. melonis interacted with X. axonopodis (Supplementary Fig. 5), and rpoD, in which sequences of X. codiaei also interacted with X. axonopodis (Supplementary Fig. 7), deviated from the consensus. The ILD analysis showed that all four individual gene sequences were congruent (P ¼ 0.0100) with the concatenated sequence (Table 3). A consideration of the similarity matrix data (Table 4) showed that most species sensu Vauterin et al. [35] had internal similarity values greater than 99%, except X. albilineans, X. arboricola, X. axonopodis, X. campestris and X. hortorum-cynarae. All interspecies values for the remainder were less than 96%. A detailed study of the similarity for sequences within X. axonopodis showed that these were not less than 97.5%. The internal structure of X. axonopodis corresponded to the groups of Rademaker et al. [23], hereafter referred to as ‘RG’. Similarity values within RG 9.2, which includes the recently described species X. alfalfae, X. euvesicatoria, X. perforans and X. axonopodis pv. ricini, and a strain of X. axonopodis pv. axonopodis (ICMP 698) collectively shared a similarity value greater than 99% (Table 5). The similarity value of strains in RG 9.5 and 9.6 (elsewhere called X. citri and X. fuscans, respectively) was 98.34%. Strains isolated from diseased Dysoxylum sp. formed a separate group from all other Xanthomonas spp.

Discussion In this study, relationships indicated by comparative analysis of 16S rDNA [13] were mimicked by the analyses of single and concatenated nucleotides and concatenated peptides. The MLSA was based on the four house-keeping genes, and did not include 16S rDNA sequences because degeneracy in codons means that house-keeping genes are subject to a lower level of selection constraint at the second and third codons compared with 16S rDNA, in which all bases are equally conserved and which directly encodes its rRNA product. These different sequence forms may make unbalanced contributions when they are concatenated and may explain the lack of congruence reported in other studies [19,39]. Stackebrandt et al. [32] recommended the investigation of five or more sequences towards the establishment of reliable MLSA. However, they do not give criteria for deciding what level of congruence forms a basis for acceptance. This study is based on the preliminary report of Fargier and Manceau [7] who showed that

the four genes, the chaperone protein dnaK (dnaK), tonB-dependent receptor (fyuA), DNA gyrase subunit B (gyrB) and RNA polymerase sigma factor (rpoD), gave highly congruent representations of Xanthomonas. A more recent study [6], using a variation of the four house-keeping genes reported here, confirmed the overall relationships of Xanthomonas spp. The ILD analysis conducted in this study also showed that all four individual gene sequences were highly congruent (P ¼ 0.0100) with the concatenated sequence (Table 3) and, with few exceptions, analyses of single gene and concatenated nucleotide and peptide sequences produced congruent trees with well-defined end branches corresponding to the species sensu Vauterin et al. [35]. The level of congruence of these sequences is high compared, for instance, with those used by Martens et al. [19] and can be considered to provide equally, or more, reliable relationships than larger numbers of less congruent sequences. Comparison of individual nucleotide trees shows greater variation, for example, the placement of X. melonis within X. axonopodis by gyrB, than the differences between the analyses using NJ (Fig. 1) or parsimony (Supplementary Fig. 2). Choice of genes, therefore, is more likely to influence tree structure than choice of algorithm.

A second genus? The MLSA reported here indicated two groups (Fig. 1) corresponding closely to those based on 16S rDNA reported by Hauben et al. [13]: (1) X. albilineans, X. hyacinthi, X. theicola, X. sacchari and X. translucens, and (2) X. arboricola, X. axonopodis, X. bromi, X. campestris, X. cassavae, X. codiaei, X. cucurbitae, X. fragariae, X. hortorum, X. melonis, X. oryzae, X. pisi, X. populi, X. vasicola and X. vesicatoria. Differentiation into two groups is further supported by systematic failure to obtain dnaK and fyuA primers for the species in group 1, which indicates a lack of homology of the genes between the groups. Xanthomonas as presently defined may be more accurately represented by two genera. A comprehensive polyphasic study would be necessary to test this indicative result.

Delineation of species The diversity of sequences representing X. albilineans in group 1 is notable and indicates the need for a specific investigation of this taxon. However, because there may be doubts as to the reliability of MLSA based on two

Fig. 1. NJ tree of concatenated nucleotide sequences for partial dnaK, fyuA, gyrB and rpoD genes, based on 119 strains of Xanthomonas. The genus is described in terms of two 16S rDNA groups representing the divisions indicated by Hauben et al. [13]. X. axonopodis is represented by the groups of Rademaker et al. [23] as 9.1–9.6. New species recently proposed from X. axonopodis [14,26,29] are shown. Bar indicates number of substitutions per site.

ARTICLE IN PRESS J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

371

ARTICLE IN PRESS 372

Table 3.

J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

Sequence information

Locus

# nt

IS

VS

PI

PI (%)

ML Model

I

g parameter

Base frequencies A/C/G/T

-ln L ML tree

P

dnaK fyuA gyrB rpoD 4 Loci

940 698 865 875 3378

716 466 544 633 2045

29 19 38 22 230

195 213 283 220 1103

20.75 30.52 32.72 25.14 32.66

GTR+I+G GTR+I+G GTR+I+G GTR+I+G –

0.5904 0.5027 0.5195 0.4971 –

0.6751 0.7442 1.3095 0.5473 –

0.215/0.311/0.343/0.131 0.189/0.364/0.304/0.143 0.189/0.363/0.317/0.131 0.216/0.344/0.308/0.132 –

4260.90 4310.15 6025.69 4547.96 –

1(99/100) ¼ 0.010 1(99/100) ¼ 0.010 1(99/100) ¼ 0.010 1(99/100) ¼ 0.010 –

ML Models (selected using the AIC results in ModelTest). # nt ¼ number of nucleotides; IS ¼ invariable sites; VS ¼ variable but parsimony uninformative sites; PI ¼ parsimony informative sites; I ¼ proportion of invariable sites (ML); P ¼ P value for each gene partitioned against the other three genes.

genes, the discussion that follows is largely confined to considerations of species in group 2. The MLSA reported here indicated the same species structure as that proposed by Vauterin et al. [35], based on DNA–DNA reassociation. With the exception of X. axonopodis and X. hortorum (and X. translucens in group 1), the species reported were all delineated in homogeneous groups. Most nodes of species branches were well-supported by high bootstrap values. These indicate the reliability of nodes but do not validate branch lengths, which are the measure of the similarity or dissimilarity between taxa. These are indicated quantitatively by values in similarity matrices. Species with greater internal diversity, X. arboricola, X. axonopodis, X. campestris and X. hortorum–cynarae– gardneri, are all represented by pathovars of different hosts, suggesting heterogeneity in the house-keeping genes associated with these phenotypic differences. Further differentiation by the systematic creation of subspecies for some pathovars and groups of pathovars seems likely.

Calibration of MLSA The difficulty in providing dependable criteria for species differentiation based on sequence analyses has been due to the absence of satisfactory methods of calibration [10,31,39]. That is to say, differentiation of taxa cannot be determined satisfactorily by inspection of branch lengths [38]. Similarity matrix data, which does give a quantitative measure of diversity, indicated that all intra-species values were less that 96% using these genes. Species unequivocally differentiated by DNA– DNA reassociation were represented by sequences with similarities greater than 99%. If a value of less than 96% was considered to support species differentiation and a value of greater than 99% to confirm species identity, then groups with intermediate values need to be considered more carefully to determine their status, perhaps as subspecies. Gevers et al. [10] correctly warn against the use of arbitrary approaches to species delineation yet, flexibly used, these criteria seem to offer

a useful guide, though not a rule, for differentiating Xanthomonas species by a method other than DNA– DNA reassociation, which is also based on arbitrary values. Other gene selections could provide support if they were calibrated in a similar way. Future studies that appear to justify further revisions should not divide natural ecological groups, such as the present Xanthomonas spp. that are pathogenic to particular hosts. Strains isolated from diseased Dysoxylum sp. formed a separate group from all other Xanthomonas spp. and, if supported by data from polyphasic studies, could represent a new species.

Species considerations A closer consideration of the groups identified by Rademaker et al. [23] in the similarity matrix of X. axonopodis showed that they were supported with internal similarity values greater than 99%. Inter-group values were always greater than 96%. If the species criterion above was adopted then further investigation would be needed to justify these groups as separate species. The homogeneity of groups within X. axonopodis, indicated by nucleotide sequences, is confirmed by the analysis of the peptide sequences. Notably, nucleotide sequences representing RG 9.2 shared similarities greater than 99% and the concatenated peptide sequences for the group were practically identical. The greater heterogeneity expressed by the nucleotide sequences is probably explained by redundancy in the second and third bases of their codons compared with the respective peptide sequences [39,40].

Misplaced strains Anomalous sequence results are indicated for various taxa and individual sequences. X. arboricola The presence of ICMP 9593 (X. vesicatoria) from Capsicum in X. arboricola suggests that this strain represents an additional host, possibly a novel pathovar,

Table 4.

3

4

5

6

7

8

9

10

11

12

97.6171.21 94.5870.26 94.4970.26 93.9570.35 94.0470.19 93.0770.15 92.4470.24 93.0970.28 90.9870.18 93.3470.26 90.9070.21 92.6070.34 91.4570.23 92.8170.19 92.9370.17 93.4770.22 81.3070.23 84.1270.29 84.7270.19 85.6570.21 85.4870.32 81.5170.75

99.4570.60 95.8270.13 93.0270.14 94.0070.09 92.3370.07 92.3870.06 93.1370.22 91.1370.09 93.2570.14 91.1870.08 92.8270.34 91.5170.16 92.5770.05 92.2170.04 93.0870.12 80.9570.10 83.5070.08 84.1370.10 84.6970.08 84.8270.15 81.6870.03

99.9570.05 92.9870.08 94.4970.01 92.6170.06 92.4270.05 93.4570.26 91.5270.05 93.5470.28 91.6870.03 92.8970.32 91.6370.24 92.9170.03 92.9370.03 93.6070.06 80.4370.10 83.6770.09 84.1670.04 84.9070.09 84.9470.19 81.3170.08

99.8870.22 93.3170.11 92.9870.66 92.1570.62 92.4170.71 90.3370.36 92.9170.40 90.7870.41 91.9770.43 91.4570.58 92.5370.44 92.7070.57 93.0970.23 80.6070.15 83.5370.33 83.8470.75 84.8570.48 84.9070.56 82.4772.07

100.00 93.1570.04 93.1670.06 94.0570.32 91.2170.05 93.5370.20 91.7170.02 93.0670.31 92.3770.25 93.8370.00 94.5870.00 94.25 81.0170.10 84.5870.08 85.5170.03 85.7670.06 85.5370.13 81.94

99.9570.09 94.1370.09 94.9970.28 90.1470.03 93.2570.15 90.7470.02 92.3870.22 92.4770.16 92.8570.01 93.1170.02 93.12 81.5370.18 84.2270.08 84.4070.03 84.8970.08 85.4870.31 81.25

99.8670.20 94.7270.26 90.2970.06 93.0470.19 90.8770.02 92.1370.20 91.8470.20 93.2670.03 93.0670.06 93.2570.06 81.0370.25 84.0570.06 84.5370.15 84.8070.05 84.9970.25 81.4670.06

99.9470.08 91.0270.07 94.4670.20 91.4770.08 93.2570.37 92.8970.68 93.8070.24 94.0670.20 94.1670.26 81.6970.22 84.4170.08 84.9370.04 85.2270.09 85.4270.14 81.4970.02

99.9570.06 92.3570.14 90.6270.05 91.9070.22 90.5170.17 91.2270.06 91.3070.05 91.6870.05 79.4870.15 81.8170.08 81.9970.04 83.2470.04 83.6470.21 79.9770.06

98.6970.98 92.7770.12 94.2070.36 93.1870.30 93.7070.24 93.6970.22 94.9570.31 81.3670.29 84.0870.14 84.1170.10 84.9970.11 85.3070.23 82.0070.14

99.9670.05 94.2270.19 91.6070.18 91.5370.02 91.2470.01 92.1670.02 80.7070.18 82.8970.03 83.4070.06 84.2970.05 84.1570.13 80.0270.03

98.4371.27 92.9670.32 92.8670.24 92.7770.22 93.7170.29 81.1170.31 84.0870.30 84.3970.25 85.2670.26 85.1670.22 81.3270.25

13

14

15

16

17

18

19

20

21

22

98.9670.88 92.3970.25 92.3970.20 92.3670.30 80.7970.13 82.8670.12 83.4470.09 84.5470.07 84.1270.26 81.0970.17

99.9970.01 95.2170.02 94.9670.01 80.2970.06 83.4170.07 84.3470.03 84.5770.07 84.9970.17 81.4070.00

99.9970.02 95.0670.02 80.8970.18 83.4670.07 83.8370.04 84.7770.04 85.1070.09 81.0170.02

100.00 81.0570.07 84.4170.07 84.5270.03 85.2770.05 85.6170.30 82.02

97.7273.23 87.2070.39 86.4670.40 86.7470.41 86.4170.48 76.1270.67

99.9870.03 91.0870.03 91.8370.08 91.0870.23 79.1270.07

99.9870.03 93.4670.08 93.0870.21 78.2170.03

99.9470.07 96.1370.34 98.7071.32 78.7770.06 78.1070.16 100.00

373

X. axonopodis X. oryzae X. vasicola X. melonis X. bromi X. codiaei X. cucurbitae X. cassavae X. fragariae X. arboricola X. populi X. hortorum-cynarae X. campestris X. sp. (Dysoxylum) X. vesicatoria X. pisi X. albilineans X. sacchari X. theicola X. hyacinthi X. translucens S. maltophilia

2

ARTICLE IN PRESS

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

X. axonopodis X. oryzae X. vasicola X. melonis X. bromi X. codiaei X. cucurbitae X. cassavae X. fragariae X. arboricola X. populi X. hortorum-cynarae X. campestris X. sp. (Dysoxylum) X. vesicatoria X. pisi X. albilineans X. sacchari X. theicola X. hyacinthi X. translucens S. maltophilia

1

J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Similarity matrix of all data from concatenated nucleotides representing all named Xanthomonas spp.

ARTICLE IN PRESS

9.?

100.00 99.7270.20 96.8970.05

X. axonopodis RG 9.1. A strain identified as X. cucurbitae ICMP 203 from Cucumis is grouped with X. axonpodis pv. begoniae.

99.6070.33 98.3470.07 96.9370.08

RG 9.2. X. axonopodis pv. axonopodis ICMP 698 from Axonopus was included with X. axonopodis pv. vesicatoria. Two strains, ICMP1643 and 8037, identified as X. vesicatoria based on amylolytic and pectolytic reactions [15], are allocated to X. axonopodis pv. vesicatoria. A larger number of strains from these two taxa needs to be compared to prove the reliability of the correlation between the determinative tests and the results from MLSA.

RG 9.4. X. populi ICMP 9893 from Populus is included with X. axonopodis pv. manihotis ICMP 5741 and X. axonopodis pv. phaseoli ICMP 5834.

The strain, ICMP 10041, indicates a possible additional RG group (see Discussion).

X.citri X. fuscans ICMP 10041a

X. axonopodis

RG 9.3. The close association of strains of X. axonopodis pv. vasculorum, ICMP 304, 356 and 5757 (the pathotype strain) with authentic X. axonopodis pv. axonopodis is evidence that pv. vasculorum is a synonym of pv. axonopodis, with Thysanolaena maxima (tigergrass) identified as a new host for the pathovar.

a

99.8570.20 96.1570.10 95.9570.06 97.5670.09 99.5170.50 96.4570.12 96.8270.06 96.6670.08 96.4870.02 100.00 96.8170.01 96.5270.10 96.9670.06 96.6370.07 96.95 99.9270.13 99.1870.06 96.8470.08 96.6170.13 97.1570.12 96.6970.11 97.1870.28 100.00 99.4170.26 99.17 96.9370.04 96.6170.09 97.1470.06 96.7970.06 96.98 99.9870.02 99.2670.08 99.3470.02 99.4670.13 99.1070.02 96.9270.04 96.6670.08 97.2270.06 96.8670.06 97.0570.02 9.1 9.2.1 9.2.2 9.2.3 9.2.4 9.2.5 9.3 9.4 9.5 9.6 9.?

RG

X. euvesicatoria X. alfalfae X. perforans

99.9870.03 97.2370.04 97.2270.05 97.2570.04 97.2770.24 96.9870.04 97.1170.03 98.0570.12 96.7570.07 96.4570.04 97.9670.04

99.8270.17 99.5970.08 99.4070.18 99.0770.03 96.9770.05 96.6470.10 97.1570.08 96.7970.08 97.0170.04

9.4 9.3 9.2.5 9.2.3 9.2.1 9.1

9.2.2

9.2.4

9.5

for the species. Strain ICMP 9984, received as X. populi, is presumably a member of X. arboricola pv. populi.

9.6

J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

Table 5. Similarity matrix of all data from concatenated nucleotides of X. axonopodis showing the internal structure with reference to the groups (RG) proposed by Rademaker et al. [23] proposed species X. alfalfae, X. citri, X. euvesicatoria, X. fuscans and X. perforans. Values in bold refer to the discussion of RG 9.2, 9.5 and 9.6.

374

RG 9.6. X. axonopodis pv. vignicola ICMP 333 from Vigna is a member of RG 9.6 with X. fuscans, indicating possible synonymy of these pathogens and a need to reexamine the relationships of pathogenic populations from these and related legumes. RG 9.?. ICMP 10041 from Saccharum, received as X. albilineans, indicates a possible novel group. This strain, together with RG 9.1 and RG 9.4, form a heterogeneous population and need more detailed investigation. The reallocation of strains pathogenic to a range of host plants into various Xanthomonas spp. suggests that genes for pathogenicity are independently segregated among taxa more commonly than has been recognized in the past. For instance, pathogenicity to tomato, previously identified in X. vesicatoria and X. axonopodis pv. vesicatoria is also indicated here in X. arboricola, and pathogenicity to cucurbits, previously identified only in X. cucurbitae, is also indicated in X. axonopodis.

Recently proposed species X. X. X. X.

Since 1995, X. cynarae [33], X. euvesicatoria, gardneri and X. perforans [16], and X. alfalfae, fuscans and X. smithii (subsequently validated as citri) [28] have been validly published. In this study, cynarae is not discriminated from X. hortorum

ARTICLE IN PRESS J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

because the latter species is represented by heterogeneous sequences, as was also indicated by Rademaker et al. [23]. Although Tre´baol et al. [33] appear mistakenly to have used the pathotype strain of X. hortorum pv. pelargonii (ICMP 4321) instead of the type strain of the species (X. hortorum pv. hederae ICMP 453), both these strains are independently welldifferentiated from X. cynarae here and the published data therefore supports discrimination of X. cynarae and X. hortorum as distinct species [33]. The heterogeneity of sequences representing X. hortorum indicates the need for further investigation of these two species and more detailed investigations of strains representing X. hortorum will probably see a revision into two or more species delineated separately from X. cynarae. The high level of sequence similarity suggests that X. gardneri is a heterotypic (subjective) synonym of X. cynarae. X. euvesicatoria and X. perforans in RG 9.2 form a single group with similarity values greater than 99% and are probably better represented in a single subspecies of X. axonopodis. X. citri and X. fuscans are included in RG5 and RG6, respectively, and share 98.34% similarity. A polyphasic study indicates that these two species appear to be heterotypic synonyms to be reclassified as a single authentic species [1], or proposed as a sub-species of X. axonopodis. The AFLP method of Mougel et al. [20] was applied in the study [1] and appears to give a slightly different resolution of taxa compared with the MLSA reported here and the DNA–DNA reassociation method of Vauterin et al. [35]. Possible reasons for the lack of quantitative agreement between MLSA and the DNA–DNA reassociation studies of Jones et al. [15] and Schaad et al. [27] for X. citri and X. fuscans and X. alfalfae, X. euvesicatoria and X. perforans could be due to the stringency of their method, which uses S1 endonuclease and a high reassociation temperature, and perhaps experimental error connected with the method in general [30]. The other possibility is that MLSA and the DNA–DNA reassociation methods do not give equivalent results using some strain combinations, in which case a choice may need to be made as to which should be considered the more reliable and useful method for future studies.

Assessment of MLSA Various methods, DNA–DNA reassociation, AFLP, rep-PCR and MLSA, point to a congruent classification of Xanthomonas, generally confirming the conclusion of Vauterin et al. [35] that there are a number of species comprising strains with limited host ranges, and a heterogeneous genetic group (X. axonopodis) comprising strains affecting many different hosts. The groups of Rademaker et al. [23] appear to be well-supported but it is not clear at this stage whether they should be

375

recognized as separate subspecies or species. The differentiation of species from very similar strain populations is likely to result in descriptions that are not robust. A preferable approach may be to recognize these groups as subspecies until the X. axonopodis complex has been evaluated in its entirety. The ad hoc creation of species from sub-populations of heterogeneous groups is likely to require further revision and cause confusion in nomenclature. Recent publications [10] have suggested the need for a more flexible approach to species discrimination than is offered by the arbitrary calibration entailed in DNA– DNA reassociation. Nevertheless, classification revisions should not be arbitrarily based on the interpretation of novel methods without careful interpretation of past determinations. Wayne et al. [36] proposed that, in establishing relationships based on percentage DNA– DNA reassociation, classification could be considered to reflect phylogeny. Whether or not one accepts this principle, coherence of classification, rather than competing classification based on different methods, is obviously highly desirable. An alternative view of DNA–DNA reassociation is that results are interpreted as part of phenetic classification [30], in which taxa are considered in terms of their overall similarities and differences [38,41]. Data presented here suggest that MLSA provides a robust method for the differentiation of most Xanthomonas spp. These show that MLSA generally mimics groupings generated by DNA–DNA reassociation within Xanthomonas [35], AFLP [22] and rep-PCR [23] and may therefore offer a refined method for differentiation of species. These results complement recent studies of plant pathogenic Pseudomonas species [14,25] whose preliminary data showed that MLSA produced groups corresponding in general to the genomospecies indicated by Gardan et al. [8,9]. Sequence data, even individual sequences, appear to offer indicative methods for the placement of individual strains [21]. It is not unexpected that correspondence between DNA–DNA reassociation and MLSA is not perfect because the methods rely on only loosely connected characteristics of bacteria; either comparison of haphazard hybridization of components of the genome or comparison of specific house-keeping genes chosen to reflect genome structure and hence the bacterial phenotype. Both methods have the same result, of reflecting the overall relationships of populations represented by differences in genomic data [41]. The results here show that MLSA gives a close correspondence with DNA–DNA reassociation methods and its application should permit a comprehensive, coherent revision of the classification of Xanthomonas. It has been proposed that the comparison of whole genome sequences would be the most informative technique for determining overall taxonomic relatedness

ARTICLE IN PRESS 376

J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

[13]. However, this is not yet routinely practical and therefore reliance must be on sub-sets of genes. Zeigler [42] identified individual house-keeping genes that could predict overall genome relatedness with some precision. Zeigler [42] also anticipated that analyses could be refined by MLSA of such genes, and this conclusion is borne out here. It is unlikely that one set will discriminate all known bacterial taxa and it follows that, as studies are expanded, it will be necessary to discover additional sequences for differentiation of further taxa. As more complete chromosomal sequences of taxa are sequenced, the choice of house-keeping genes may be refined further. Acceptance of DNA–DNA reassociation as the basis for classification and nomenclature of Xanthomonas [35] without providing easy means of identification of strains made the allocation of strains to species practically impossible. One of the most important contributions of MLSA, applied to Xanthomonas, is that it will allow strains to be allocated to known species or be indicated as members of new species more easily.

Acknowledgements The New Zealand Foundation for Research, Science and Technology provided financial support. Robyn L. Howitt and Helen M. Harman, Landcare Research, are thanked for critically reading the manuscript.

Appendix A. Supplementary Data Supplementary data associated with this article can be found in the online version at doi:10.1016/j.syapm. 2008.06.004.

References [1] N. Ah-You, L. Gagnevin, P.A.D. Grimont, S. Brisse, X. Nesme, F. Chiroleu, L. Bui Thi Ngoc, E. Jouen, P. Lefeuvre, C. Vernie`re, O. Pruvost, Polyphasic characterization of xanthomonads pathogenic to Anacardiaceae and their relatedness to different Xanthomonas species, Int. J. Syst. Evol. Microbiol. 58 (2008), in press. [2] I.M. Chelo, L. Ze-Ze, R. Tenreiro, Congruence of evolutionary relationships inside the Leuconostoc– Oenococcus–Weissella clade assessed by phylogenetic analysis of the 16S rRNA gene, dnaA, gyrB, rpoC and dnaK, Int. J. Syst. Evol. Microbiol. 57 (2007) 276–286. [3] F.M. Cohan, What are bacterial species?, Annu. Rev. Microbiol. 56 (2002) 457–487. [4] G. Devulder, M. Perouse de Montclos, J.P. Flandrois, A multigene approach to phylogenetic analysis using the genus Mycobacterium as a model, Int. J. Syst. Evol. Microbiol. 55 (2005) 293–302.

[5] D.W. Dye, The inadequacy of the usual determinative tests for the identification of Xanthomonas spp., N.Z. J. Sci. 5 (1962) 393–416. [6] E. Fargier, L’e´tude de la pathologie de Xanthomonas campestris et de la structure ge´ne´tique de ses pathovars a permis l’ame´lioration de la de´tection du pathoge`ne dans les semences de Brassicace´es, Doctoral Thesis, E´cole Doctorale d’Angers, Universite´ d’Angers, Angers, France, 2007. [7] E. Fargier, C. Manceau, Pathogenic and genetic characterization of Xanthomonas campestris by plant inoculation and multilocus site analysis, In: J. Elphinstone, S. Weller, R. Thwaites, N. Parkinson, D. Stead, G. Saddler, in: Proceedings of the 11th International Conference on Plant Path. Bact., Edinburgh, Edinburgh, Scottish Agricultural Science Agency, 10–14 July 2006, p. 35. [8] L. Gardan, C. Bollet, M. Abu Gorah, F. Grimont, P.A.D. Grimont, DNA relatedness among the pathovar strains of Pseudomonas syringae subsp. savastanoi Janse (1982) and proposal of Pseudomonas savastanoi sp. nov., Int. J. Syst. Bact. 42 (1992) 606–612. [9] L. Gardan, H. Shafik, S. Belouin, R. Brosch, F. Grimont, P.A.D. Grimont, DNA relatedness among the pathovars of Pseudomonas syringae and descriptions of Pseudomonas tremae sp. nov. and Pseudomonas cannabina sp. nov. (ex Sˇutic´ and Dowson 1959), Int. J. Syst. Bact. 99 (1999) 469–478. [10] D. Gevers, F.M. Cohan, J.G. Lawrence, B.G. Spratt, T. Coenye, E.J. Feil, E. Stackebrandt, Y. Van de Peer, P. Vandamme, F.L. Thompson, J. Swings, Re-evaluating prokaryotic species, Nat. Rev. Microbiol. 3 (2005) 733–739. [12] W.P. Hanage, C. Fraser, B.G. Spratt, Fuzzy species among recombinogenic bacteria, BMC Biol. 3 (2005) 6. [13] H. Hauben, L. Vauterin, J. Swings, E.R. Moore, Comparison of 16S ribosomal DNA sequences of all Xanthomonas species, Int. J. Syst. Bacteriol. 47 (1997) 328–335. [14] M.S.H. Hwang, R.L. Morgan, S.F. Sarkar, P.W. Wang, D.S. Guttman, Phylogenetic characterization of virulence and resistance phenotypes of Pseudomonas syringae, Appl. Environ. Microbiol. 71 (2005) 5182–5191. [15] J.B. Jones, G.H. Lacy, H. Bouzar, R.E. Stall, N.W. Schaad, Reclassification of the xanthomonads associated with bacterial spot disease of tomato and pepper, Syst. Appl. Microbiol. 27 (2004) 755–762. [16] J.B. Jones, G.H. Lacy, H. Bouzar, R.E. Stall, N.W. Schaad, Validation list no. 109. List of new names and new combinations previously effectively, but not validly, published, Int. J. Syst. Evol. Microbiol. 56 (2006) 925–927 effective publication; J.B. Jones, G.H. Lacy, H. Bouzar, R.E. Stall, N.W. Schaad, Reclassification of the xanthomonads associated with bacterial spot disease of tomato and pepper, Syst. Appl. Microbiol. 27 (2004) 755–762. [17] F.J. Louws, D.W. Fulbright, C. Taylor Stephens, F.J. De Bruijn, Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR, Appl. Environ. Microbiol. 60 (1994) 2286–2295.

ARTICLE IN PRESS J.M. Young et al. / Systematic and Applied Microbiology 31 (2008) 366–377

[18] M.J.C. Maiden, J.A. Bygraves, E. Feil, G. Morelli, J.E. Russell, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D.A. Caugant, I.M. Feavers, M. Achtam, B.G. Spratt, Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms, Proc. Natl. Acad. Sci. USA 95 (1998) 3140–3145. [19] M. Martens, M. Delaere, R. Coopman, P. De Vos, M. Gillis, A. Willems, Multilocus sequence analysis of Ensifer and related taxa, Int. J. Syst. Evol. Microbiol. 57 (2007) 489–503. [20] C. Mougel, J. Thioulouse, G. Perrie`re, X. Nesme, A mathematical method for determining genome divergence and species delineation using AFLP, Int. J. Syst. Evol. Microbiol. 52 (2002) 573–586. [21] N. Parkinson, C. Cowie, J. Heeney, D. Stead, Phylogenetic structure of Xanthomonas determined by comparison of gyrB sequences, Int. J. Syst. Evol. Microbiol. 58 (2008) in press. [22] J.L.W. Rademaker, B. Hoste, F.J. Louws, K. Kersters, J. Swings, L. Vauterin, P. Vauterin, F.J. De Bruijn, Comparison of AFLP and rep-PCR genomic fingerprinting with DNA–DNA homology studies: Xanthomonas as a model system, Int. J. Syst. Evol. Microbiol. 50 (2000) 665–677. [23] J.L.W. Rademaker, F.J. Louws, M.H. Schultz, U. Rossbach, L. Vauterin, J. Swings, F.J. de Bruijn, A comprehensive species to strain taxonomic framework for Xanthomonas, Phytopathology 95 (2005) 1098–1111. [24] D. Richter, D. Postic, N. Sertour, I. Livey, F.-R. Matuschka, G. Baranton, Delineation of Borrelia burgdorferi sensu lato species by multilocus sequence analysis and confirmation of the delineation of Borrelia spielmanii sp. nov., Int. J. Syst. Evol. Microbiol. 56 (2006) 873–881. [25] S.F. Sarkar, D.S. Guttman, Evolution of the core genome of Pseudomonas syringae, a highly clonal, endemic plant pathogen, Appl. Environ. Microbiol. 70 (2004) 1999–2012. [26] M. Scally, E.L. Schuenzel, R. Stouthamer, L. Nunney, Multilocus sequence type system for the plant pathogen Xylella fastidiosa and relative contributions of recombination and point mutation to clonal diversity, Appl. Environ. Microbiol. 71 (2005) 8491–8499. [27] N.W. Schaad, E. Postnikova, G.L. Lacey, A. Sechler, I. Agarkova, P.E. Stromberg, V.K. Stromberg, A.K. Vidaver, Reclassification of Xanthomonas campestris pv. citri (ex Hasse1915) Dye 1978 forms A, B/C/D, and E as X. smithii subsp. citri (ex Hasse) sp. nov. nom. rev. comb. nov., X. fuscans subsp. aurantifolii (ex Gabriel [sic] 1989) sp. nov. nom. rev. comb. nov., and X. alfalfae subsp. citrumelo (ex Riker and Jones [sic]) Gabriel et al., 1989 sp. nov. nom. rev.; X. campestris pv. malvacearum (ex Smith 1901) Dye 1978 as X. smithii subsp. smithii nov. comb. nom. nov.; X. campestris pv. alfalfae (ex Riker and Jones [sic] 1935) Dye 1978 as X. alfalfae subsp. alfalfae (ex Riker et al., 1935) sp. nov. nom. rev.; and ‘‘var. fuscans’’ of X. campestris pv. phaseoli (ex Smith, 1897) Dye 1978 as X. fuscans subsp. fuscans sp. nov., Syst. Appl. Microbiol. 28 (2005) 494–518. [28] N.W. Schaad, E. Postnikova, G.L. Lacey, A. Sechler, I. Agarkova, P.E. Stromberg, V.K. Stromberg, A.K. Vidaver, Validation of publication of new names and new combinations previously effectively published outside

[29]

[30]

[31]

[32]

[33]

[34]

[35] [36]

[37]

[38]

[39]

[40]

[41]

[42]

377

the IJSEM, Int. J. Syst. Evol. Microbiol. 54 (2007) 893–897 Effective publication; N.W. Schaad, E. Postnikova, G.L. Lacey, A. Sechler, I. Agarkova, P.E. Stromberg, V.K. Stromberg, A.K. Vidaver, Emended classification of xanthomonad pathogens on citrus – erratum, Syst. Appl. Microbiol. 29 (2006) 690–695. V.B.D. Skerman, V. McGowan, P.H.A. Sneath (Eds.), Approved lists of bacterial names, Int. J. Syst. Bacteriol. 30 (1980) 225–420. P.H.A. Sneath, Analysis and interpretation of sequence data for bacterial systematics: the view of a numerical taxonomist, Syst. Appl. Microbiol. 12 (1989) 15–31. E. Stackebrandt, B.M. Goebel, Taxonomic note: a place for DNA–DNA-reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology, Int. J. Syst. Bacteriol. 44 (1994) 846–849. E. Stackebrandt, W. Frederiksen, G.M. Garrity, P.A.D. Grimont, P. Ka¨mpfer, M.J.C. Maiden, X. Nesme, R. Rossello´-Mora, J. Swings, H.-G. Tru¨per, L. Vauterin, A.C. Ward, W.B. Whitman, Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology, Int. J. Syst. Evol. Microbiol. 52 (2002) 1043–1047. G. Tre´baol, L. Gardan, C. Manceau, J.L. Tanguy, Y. Tirilly, S. Boury, Genomic and phenotypic characterization of Xanthomonas cynarae sp. nov., a new species that causes bacterial bract spot of artichoke (Cynara scolymus L.), Int. J. Syst. Evol. Microbiol. 50 (2000) 1471–1478. L. Vauterin, J. Swings, Are classification and phytopathological diversity compatible in Xanthomonas?, J. Ind. Microbiol. Biotechnol. 19 (1997) 77–82. L. Vauterin, B. Hoste, K. Kersters, J. Swings, Reclassification of Xanthomonas, Int. J. Syst. Bact. 45 (1995) 472–489. L.G. Wayne, D.J. Brenner, R.R. Colwell, P.A.D. Grimont, O. Kandler, M.I. Krichevsky, L.H. Moore, W.E.C. Moore, R.G.E. Murray, E. Stackebrandt, M.P. Starr, H.G. Tru¨per, Report of the ad hoc committee on the reconciliation of approaches to bacterial systematics, Int. J. Syst. Bact. 37 (1987) 463–464. J.M. Young, Recent systematics developments and implications for plant pathogenic bacteria, in: F.G. Priest, M. Goodfellow (Eds.), Applied Microbial Systematics, Chapman Hall, 2000, pp. 133–160. J.M. Young, Implications of alternative classifications and horizontal gene transfer for bacterial taxonomy, Int. J. Syst. Evol. Microbiol. 51 (2001) 945–953. J.M. Young, D.-C. Park, Relationships of plant pathogenic Enterobacteria based on partial atpD, carA, recA, as concatenated gene and peptide sequences, Syst. Appl. Microbiol. 30 (2007) 343–354. J.M. Young, D.-C. Park, Probable synonymy of the nitrogen-fixing genus Azotobacter and the genus Pseudomonas, Int. J. Syst. Evol. Microbiol. 57 (2007) 2894–2901. J.M. Young, Y. Takikawa, L. Gardan, D.E. Stead, Changing concepts in the taxonomy of plant pathogenic bacteria, Annu. Rev. Phytopathol. 30 (1992) 67–105. D.R. Zeigler, Gene sequences useful for predicting relatedness of whole genomes in bacteria, Int. J. Syst. Evol. Microbiol. 53 (2003) 1893–1900.