A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution

G Model JCZ-25269; No. of Pages 11

ARTICLE IN PRESS Zoologischer Anzeiger xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Zoologischer Anzeiger journal homepage: www.elsevier.de/jcz

A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution Azad Teimori a,b,∗ , Hamid Reza Esmaeili c , Dirk Erpenbeck a , Bettina Reichenbacher a a Department of Earth and Environmental Sciences, Palaeontology & Geobiology and GeoBio-Center LMU, Ludwig-Maximilians-University, Munich, Germany b Department of Biology, Faculty of Sciences, Shahid-Bahonar University of Kerman (SBUK), Kerman, Iran c Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran

a r t i c l e

i n f o

Article history: Received 30 April 2013 Received in revised form 29 November 2013 Accepted 2 December 2013 Available online xxx Keywords: Aphanius Mitochondrial DNA Evolutionary history Extreme habitat conditions Hormuzgan

a b s t r a c t A primarily vicariance-based speciation has been suggested for the killifish genus Aphanius Nardo, 1827, but ecological factors are likely to have promoted the speciation processes in addition. Here, we report on the discovery of a unique Aphanius species from Southern Iran and show that also regressive evolution has shaped the present-day diversity of Aphanius. The species is characterized by complete absence of scales and reduction in the biomineralization of hard structures, particularly of the caudal skeleton and jaw teeth. Based on mt-DNA sequences, morphometric and meristic data, osteology, jaw teeth and otoliths, it is described as Aphanius furcatus sp. n. The new species is sympatric with A. dispar (Rüppell, 1829) in salty rivers and hot sulphuric springs in the Hormuzgan Basin (Southern Iran), and is sister taxon to this species plus A. ginaonis Holly, 1929. Based on geological data we estimate that the divergence between the lineages of A. furcatus and A. dispar is about 12–14 million years old. We conclude that the reductive phenomena observed in A. furcatus have evolved as an evolutionary response to the extreme habitat conditions in order to save energy (because storage of Ca2+ is not necessary), and to transport oxygen efficiently. The results confirm that regressive evolution is an important factor in speciation and occurs independently in separate lineages. © 2013 Elsevier GmbH. All rights reserved.

1. Introduction Killifishes (Cyprinodontiformes) are a large group of secondary freshwater fishes and have been found particularly interesting for evolutionary studies for a long time (see review in Parker and Kornfield, 1995). The cyprinodontid Aphanius Nardo, 1827 is the only representative of this group in the Old World (e.g., Kosswig, 1967; Villwock, 1999). Similar to most cyprinodontiforms, species of Aphanius tolerate a wide range of temperatures and salinities. This ecological tolerance, together with their small size, permits Aphanius populations to persist in restricted and also extreme habitats (e.g., Echelle and Dowling, 1992; Wildekamp, 1993). Moreover,

∗ Corresponding author at: Department of Biology, Faculty of Sciences, ShahidBahonar University of Kerman (SBUK), Kerman, 8 Iran. Tel.: +49 08937943861. E-mail address: [email protected] (A. Teimori).

these abilities promote exploration of new environments and processes of speciation (Villwock, 1964). The phenomenon of regressive evolution is known for cyprinodontids since Gervais (1853), who discovered “Tellia apoda Gervais, 1853” [now Aphanius apodus (Gervais, 1853)], a species without pelvic fins. Regression in scalation and cusps of jaw teeth have been described for several subspecies of A. anatoliae (Leidenfrost, 1912) in SW-Anatolia, while A. asquamatus (Sözer, 1942) is an example for the final stage of these processes, i.e., complete absence of scales and presence of unicuspid jaw teeth (see reviews in Villwock, 1984; Wildekamp et al., 1999). During our recent fieldwork in Hormuzgan, Southern Iran (see Fig. 1), we collected new specimens of Aphanius from hot sulphuric springs and salty rivers, where they occur sympatrically with A. dispar. The new specimens clearly differed from A. dispar due to a complete absence of scales, less colourful pigmentation of both males and females, and a slightly forked caudal fin. The present paper describes this population as a new species of the genus Aphanius and highlights the possible role of regressive evolution in its evolutionary success.

0044-5231/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.jcz.2013.12.001

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

2

Fig. 1. (A) General geographic overview of the study area in Southern Iran. (B) Details of study area and sampling sites of A. furcatus. () Shur River (type locality); () collection sites of paratypes; (•) Genow hot spring, habitat of A. ginaonis. Sources of maps: Wildekamp, 1993 (for A), Google Earth (for B).

2. Materials and methods 2.1. Materials Type specimens and comparative specimens were collected by hand-net from springs and rivers in Southern Iran (Fig. 1). All specimens are deposited in the Zoological Museum of Shiraz University, Collection of Biology Department (ZM-CBSU). Comparative specimens include: A. dispar: 15 males (19.0–28.8 mm SL) and 15 females (18.3–38.0 mm SL) from the Khurgu hot sulphuric spring (27◦ 31 34.1 N, 56◦ 28 08.2 E; altitude 170 m) and the Shur River (N 27◦ 19 37.6 N, 56◦ 28 10.2 E altitude 2 m) in Southern Iran (same specimens as used in Teimori et al., 2012a). A. ginaonis: 15 males (22.2–24.7 mm SL) and 15 females (23.3–25.2 mm SL) from the Genow hot sulphuric spring (27◦ 26 77 N, 56◦ 17 97 E; altitude 200 m) in Southern Iran. For the molecular analyses, we used eight individuals from the type specimens, six individuals of A. dispar (three from Khurgu, three from Shur River), and two specimens of A. ginaonis from the Genow hot spring. Additional molecular data of in- and out-group taxa were derived from NCBI Genbank (www.ncbi.nlm.nih.gov) and include sequences of two A. mento (Heckel in Russegger, 1843) (AF449388, AF449389), one A. asquamatus (AF449368), two A. anatoliae transgrediens (AF451663, AF449352), two A. fasciatus (Valenciennes, in Humboldt and Valenciennes, 1821) (AF449371, AF449375), two A. iberus (Valenciennes, in Cuvier and Valenciennes, 1846) (AF449381, AF449379), one A. apodus (AF449385), and two Valencia hispanica (Valenciennes, in Cuvier and Valenciennes, 1846) (AF449400, AF449401). 2.2. Methods 2.2.1. Methods used for morphological analyses Because of the sex dimorphism that occurs in Aphanius, the analysis of morphometric and meristic characters was conducted for males and females, separately. All measurements and counts were made according to Holcik (1989) and Doadrio et al. (2002). Measurements for fish body morphometry were taken with digital callipers to a precision of 0.5 mm. Standard length (SL) was measured from the tip of the snout to the base of the caudal fin rays.

Meristic characters include numbers of dorsal, pectoral, pelvic and anal fin rays, as well as numbers of gill rakers, and were counted under a stereomicroscope. Two posteriormost rays of the dorsal and anal fins were counted as one ray. Standardized measurements and counts served as input for the descriptive analysis and calculations of mean values and ranges using PASW 20.00 (SPSS Inc., 2012). Six to eight jaw teeth were carefully removed from the upper and lower jaws of one specimen per species. Otoliths were dissected from ten specimens with SL >20 mm per species, according to the protocol in Reichenbacher et al. (2007). Jaw teeth and otoliths were examined by a digital stereomicroscope and a scanning electron microscope (SEM) of the type LEO 1430 VP. Two specimens per species were cleared and stained based on the protocol of Potthoff (1984). Terminology of osteological characters followed Arratia and Schultze (1992). 2.2.2. Methods used for molecular analyses Total DNA was extracted from few mm3 muscle tissue of the right caudal peduncle of specimens using a commercial DNA extraction kit (DNeasy Tissue Kit, Qiagen) followed the manufacturer’s protocol. The partial mitochondrial 12S rDNA and the complete tRNA-Val genes were amplified by polymerase chain reaction (PCR) using the primers L1090 (5 AAACTGGGATTAGATACCCCACTA 3 ) and H1782 (5 TTACATCTTTCCCTTGCGGTAC 3 ; Hrbek and Larson, 1999). The amplification processes was performed as following: initial denaturation 94 ◦ C (2 min), 35 cycles with denaturation at 94 ◦ C for 45 s, annealing at 58 ◦ C for 1 min, extension at 72 ◦ C for 1:30 min per cycle and a final extension phase at 72 ◦ C for 10 min. The PCR mixtures were prepared in a final volume of 25 ␮l containing 10.8 ␮l ddH2 O, corresponding 5 mM buffer, 3 mM MgCl2 , 2 mM BSA, dNTPs, 1 ␮l primer, 0.2 mM Taq DNA polymerase and 1–2 mM DNA. The resulting products were visualized on a 1% agarose gel, and then purified with PEG solution (PolyEthylene Glycol, modified from Rosenthal et al., 1993), which contains 10.0 g PEG, 7.3 g NaCl and 45 ml ddH2 O. Forward and reverse strand were sequenced with the PCR primers and BigDye 3.1 chemistry (Applied Biosystems) following the manufacturers protocol on an ABI3730 automated sequencer of the Genomic Sequencing Unit LMU Munich.

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

3

Fig. 3. Paratypes collected from type locality (photos refer to specimens in aquarium). (A) Male and (B) female of Aphanius furcatus sp. n.

Fig. 2. (A) Aphanius furcatus, holotype, male, 21.05 mm SL (ZM-CBSU225), (B) paratype, female, 30.24 mm SL (ZM-CBSU226). Photos refer to fresh specimens after catching (now fixed in 70% alcohol), (C) Shur River (type locality) in the Hormuzgan drainage, Southern Iran.

Sequences were trimmed and assembled in Geneious R6 (Biomatters) (Geneious, 2013). New sequences are deposited in NCBI Genbank (www.ncbi.nlm.nih.gov) under accession numbers KF983842–KF983856. Sequences were subsequently aligned using Muscle 3.6 (Edgar, 2004), as incorporated in Geneious, under default settings with the additional Aphanius sequences published in Genbank in order to gain a representative data set for the assessment of the phylogenetic position of the new taxa. Bayesian analyses of nucleotide sequences were run with the parallel version of MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003) on a Linux cluster with one processor assigned to each Markov chain under the most generalizing model (GTR + G + I) because overparametrization apparently does not negatively affect Bayesian analyses (Huelsenbeck and Ranala, 2004). Each Bayesian analysis comprised two simultaneous runs of four Metropolis-coupled Markov-chains at the default temperature (0.2). Analyses were terminated after the chains converged significantly, as indicated by the average standard deviation of split frequencies <0.01. Maximum likelihood reconstructions were performed using RAxML 7.2.5 (Stamatakis, 2006) under the GTR model of nucleotide substitution, with CAT approximation of rate heterogeneity and fast bootstrap (2000 bootstrap replicates).

Subdivision Teleostei sensu Arratia, 1999 Order Cyprinodontiformes Berg, 1940 Suborder Cyprinodontoidei Parenti, 1981 Family Cyprinodontidae Gill, 1865 Genus Aphanius Nardo, 1827 (type species A. fasciatus Valenciennes, in Humboldt and Valenciennes, 1821)

3.1.1. Aphanius furcatus sp. n. (Figs. 2, 3, 4a–d, 5a–e, 6a) 3.1.1.1. Diagnosis. A. furcatus is distinguished from all congeners by the following combination of characters: Complete absence of scales; slightly forked caudal fin; males with dark pigmentation at the base of the four anterior dorsal rays (Figs. 2a and 3a); single row of tricuspid teeth with the two lateral cusps shorter than the middle one (Fig. 4a–d); rounded otolith with short rostrum and antirostrum of almost equal length (Fig. 5a–e); reduction in biomineralization of caudal skeleton such as thin epural bone (Fig. 6a); 157 (vs. A. dispar) and 170 (vs. A. ginaonis ) molecular characters in the 12S mt-DNA and tRNA-Val. The identification key for the three closely related species in Southern Iran is as follows: 1a. Absence of scales and slightly forked caudal fin.. . .. . .. . .. . .. . .. . . A. furcatus 1b. Presence of scales and rounded caudal fin . . .. . .. . .. . .. . .. . .. . .. . .. . ..2 2a. 8–11 dorsal fin rays . . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . . . . .. . .. . .. . ... . .. . .. A. dispar 2b. 5–7 dorsal fin rays. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . . . . .. . ... . .. . .. . .. . .. A. ginaonis

3. Results 3.1.1.2. Holotype. Male, ZM-CBSU 225 (Fig. 2a), 21.05 mm SL. 3.1. Systematic ichthyology We follow the classification of the Teleostei in Arratia (1999), which has been confirmed by recent molecular analyses (e.g., Near et al., 2012; Broughton et al., 2013; Betancur et al., 2013).

3.1.1.3. Paratypes. Three males (18.5–23.50 mm SL) and 11 females (21.75–25.50 mm SL) from the type locality (Figs. 2b and 3, ZMCBSU 211–224, 226); 6 females (20.9–30.4 mm SL) from the Khurgu hot sulphuric spring (ZM-CBSU 45, 411–415); 2 males

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11 4

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

Fig. 4. Jaw teeth of Aphanius furcatus (a–d) (ZM-CBSU213), A. dispar (e–h) (ZM-CBSU229), A. ginaonis (i–l) (ZM-CBSU35), and A. mento (m–p) (BSPG2013 III 1). Scale bar = 200 ␮m.

(22.6–32.7 mm SL) and 7 females (21.70–23.35 mm SL) from the Kol River (ZM-CBSU 51, 511, 513–519); 3 males (18.1–20.0 mm SL) from the Mehran River (ZM-CBSU 72, 78, 713); 2 males (23.6–31.0 mm SL) and 2 females (19.6–26.5 mm SL) from the Faryab hot sulphuric spring (ZM-CBSU 93, 912, 914, 915). All sites are located in the Hormuzgan Basin (Fig. 1).

3.1.1.4. Type locality. Shur River (Fig. 2c), along the Bandar Abbas–Minab road, 20 km East of Bandar Abbas (27◦ 19 37.6 N, 56◦ 28 10.2 E, altitude 2 m), Iran, Hormuzgan province, collected on 26th September 2010 by A. Teimori, H.R. Esmaeili, A. Gholamifard and R. Khaefi.

3.1.1.5. Habitat. Ecological parameters were collected from three sites in the Shur River (October 2010): Water temperature 36.7–38.8 ◦ C; water depth 8.15–35.0 cm; water speed 1 m/s; nitrate (NO3 − ) 1.7–2.1 mg/l; nitrite (NO2 − ) 0.014–0.015 mg/l; phosphate (PO4 3− ) 0.21–0.36 mg/l; ammonia (NH3 ) 2.55–2.66 mg/l; pH 7.87–8.04; conductivity 3180–3240 ␮S/cm; salinity 18.6–25.0 ppt, dissolved oxygen 7.32–7.40 mg/l. During the sampling, the cichlid Iranocichla hormuzensis Coad, 1982 was the only other fish species. Tamarix and Phragmitis were the dominant flora.

3.1.1.6. Description. The examined males reached approximately 23.4 mm SL, the examined females had about 24.2 mm SL.

Fig. 5. Otoliths (inner face) of Aphanius furcatus (a–e) (ZM-CBSU211, 214, 215, 217, 218), A. dispar (f–k) (ZM-CBSU72, 78, 51, 511, 513), A. ginaonis (l–n) (ZM-CBSU31–35), and A. mento (q–w) (BSPG2013 III 2–6). Scale bar = 200 ␮m.

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

5

Fig. 6. Left lateral view of a stained specimen of Aphanius furcatus (a1, arrow indicates thick neural arch) and detail of its caudal skeleton (a2) (ZM-CBSU227); left lateral view of a stained specimen of A. dispar (b1, arrow indicates thin neural arch) and detail of its caudal skeleton (b2) (ZM-CBSU79); left lateral view of the caudal skeletons of a stained specimen of A. ginaonis (c, ZM-CBSU35) and A. mento (d, BSPG2013 III 7). Abbreviations: c.pl., cartilaginous plate; E, epural; H, hypural plate; HS2, haemal spine of PU2; H, hypural plate; NS2, neural spine of PU2; PH, parhypural; PU, preural centrum.

The morphometric and meristic characters are summarized in Tables 1 and 2. In addition to the diagnostic characters the specimens can be characterized as follows: Caudal fin with the upper (dorsal) lobe slightly longer than the lower lobe (Figs. 2 and 3); 26–27 vertebrae of which the neural arches are rather thick (Fig. 6a1); three preural vertebrae (PU1–PU3); parhypural with anterior arches that articulate with the lateroventral region of the centrum (Fig. 6a2, this means that caudal blood vessels were completely enclosed); space between neural and haemal spines of PU2 and PU3 wide; neural and haemal spine of PU2 widened; and distinctive cartilaginous plates in front of the neural and haemal spines of PU 3 (Fig. 6a2).

drainage, Southern Iran (Figs. 1 and 2c). The rivers and spring streams in Southern Iran are often seasonal and characterized by shallow water and white layers of salt around and within the river. A. furcatus individuals are often dominant on the riversides, where the water is shallow, warm and water flow is slow.

3.1.1.7. Colour. A. furcatus shows external sexual dimorphism. Males (Figs. 2a and 3a) usually have 7–11 vertical flank-bars, their dorsal, anal, caudal, pelvic and pectoral fins are white but with a dark pigmentation on the base of the 1st–4th dorsal rays. Females (Figs. 2b and 3b) display 7–9 dark circular blotches on their flanks, starting behind the operculum and extending until the base of the caudal fin. Similar to the males, their dorsal, anal, caudal, pelvic and pectoral fins are white. Both males and females display a yellowish dorso-posterior part of the eyes.

3.1.1.10. Etymology. The name of the new species, furcatus, is derived from its slightly forked caudal fin that is unique in Aphanius species.

3.1.1.8. Distribution. The new species has been observed to be sympatric with A. dispar from the Shur River, Kol River, Mehran River, Khurgu and Faryab hot sulphuric springs in the Hormuzgan

3.1.1.9. Conservation. The abundances of individuals of the new species are less in comparison to the sympatric A. dispar. The major threat that can seriously affect the survival of the new species is drought. Moreover, local people use water from the hot sulphuric springs for medical purpose (e.g., Khurgu hot sulphuric spring) and contaminate it using chemical materials.

3.1.1.11. Common names. Kapour-e-dandandar-e-bedun-e-fals-eIrani (Farsi); Iranian scaleless tooth-carp (English); Schuppenloser Persischer Zahnkarpfen (German). 3.2. Phylogenetic analyses The resulting trees from Maximum Likelihood and Bayesian Inference methods are largely congruent. A. furcatus forms a wellsupported clade and is phylogenetically distinct to all other species

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

A. furcatus n = 10, F

A. dispar n = 15, M

A. dispar n = 15, F

A. ginaonis n = 15, M

A. ginaonis n = 15, F

22.25 18.13 55.40 19.40 6.65 9.3 10.2 35.62 22.73 13.86 27.62 21.50 64.20

24.4 ± 0.95 (23.4–26.0) 18.1 ± 0.81 (16.9–19.5) 56.8 ± 1.84 (54.6–61.6) 19.1 ± 1.40 (16.6–20.9) 6.1 ± 0.84 (5.1–7.4) 9.7 ± 0.65 (8.9–10.8) 10.5 ± 0.37 (10.0–11.1) 35.5 ± 0.97 (34.2–37.0) 22.1 ± 1.20 (19.4–23.6) 13.3 ± 0.96 (11.3–14.4) 27.7 ± 1.95 (25.4–32.3) 21.6 ± 0.96 (20.0–23.4) 65.8 ± 1.75 (63.5–68.4)

24.4 ± 1.10 (21.9–25.3) 18.0 ± 0.57 (16.9–18.7) 58.1 ± 1.70 (55.1–60.3) 17.5 ± 0.92 (16.3–18.7) 5.8 ± 0.88 (5.1–6.8) 8.7 ± 0.94 (7.2–10.6) 9.6 ± 0.76 (8.6–10.8) 36.6 ± 1.64 (35.3–39.6) 23.6 ± 1.16 (22.0–26.1) 14.3 ± 0.93 (13.2–15.9) 26.9 ± 1.40 (24.4–28.8) 20.3 ± 1.24 (19.1–22.5) 67.1 ± 1.60 (65.1–70.4)

30.1 ± 1.92 (26.4–33.2) 20.9 ± 1.35 (19.4–23.7) 64.3 ± 1.74 (61.4–67.8) 19.8 ± 1.13 (17.6–21.3) 9.9 ± 1.10 (7.6–11.5) 10.7 ± 1.34 (8.9–12.9) 12.9 ± 0.69 (11.4–13.9) 35.1 ± 1.97 (31.6–38.3) 18.8 ± 1.94 (14.7–20.9) 15.9 ± 1.33 (13.8–18.1) 22.1 ± 1.70 (19.2–23.4) 22.1 ± 2.10 (18.9–25.2) 69.2 ± 1.12 (66.8–71.1)

30.2 ± 1.40 (27.4–32.8) 20.6 ± 1.45 (19.3–22.7) 64.7 ± 1.63 (61.4–67.1) 18.5 ± 1.15 (16.6–20.9) 8.6 ± 1.10 (7.1–10.4) 10.2 ± 0.59 (9.1–11.1) 12.1 ± 1.10 (10.4–13.8) 35.2 ± 2.78 (28.9–38.1) 19.1 ± 2.73 (12.6–21.3) 15.4 ± 1.26 (13.2–16.1) 21.1 ± 2.17 (15.7–23.4) 22.1 ± 2.85 (18.5–27.2) 70.3 ± 1.95 (66.5–73.1)

31.9 ± 1.24 (29.2–34.6) 21.4 ± 1.04 (19.7–23.6) 67.6 ± 2.10 (64.3–71.6) 18.7 ± 1.24 (16.2–20.2) 10.4 ± 0.83 (9.33–11.7) 10.2 ± 1.20 (8.0–11.7) 14.5 ± 0.76 (13.5–15.3) 36.1 ± 2.35 (32.8–42.0) 19.1 ± 1.85 (16.8–24.6) 16.1 ± 1.65 (13.2–19.7) 24.1 ± 2.14 (19.3–28.7) 23.5 ± 2.15 (19.4–27.7) 70.2 ± 2.20 (66.4–74.7)

32.4 ± 1.94 (29.5–35.4) 20.7 ± 1.40 (18.9–23.1) 68.6 ± 1.95 (65.2–73.4) 18.5 ± 1.64 (15.9–22.6) 10.3 ± 1.20 (7.7–12.5) 10.4 ± 0.90 (9.1–12.0) 13.8 ± 0.86 (12.9–15.8) 35.1 ± 2.20 (32.1–41.1) 18.5 ± 1.80 (15.9–21.6) 16.1 ± 1.40 (13.9–18.9) 25.6 ± 1.56 (22.8–28.1) 23.6 ± 1.40 (19.3–26.1) 71.2 ± 2.25 (66.9–75.1)

15.60 42.35 32.86

15.9 ± 0.53 (15.0–16.9) 42.1 ± 3.00 (39.2–49.3) 32.8 ± 2.80 (30.1–36.9)

14.4 ± 1.10 (13.1–16.3) 40.2 ± 2.46 (36.2–43.9) 30.4 ± 1.80 (28.5–33.8)

18.7 ± 1.10 (16.3–20.7) 32.0 ± 2.40 (27.2–36.5) 31.8 ± 2.82 (27.3–36.3)

17.2 ± 1.40 (14.1–19.2) 30.0 ± 3.15 (21.4–34.6) 30.1 ± 4.50 (25.7–40.8)

20.7 ± 1.10 (19.0–22.4) 34.3 ± 3.42 (25.8–41.2) 33.8 ± 2.85 (29.2–38.7)

19.3 ± 1.20 (17.5–22.1) 35.9 ± 2.33 (31.4–39.1) 33.2 ± 3.40 (26.6–37.6)

0.79

0.78 ± 0.46 (0.72–0.87)

0.77 ± 0.07 (0.69–0.90)

0.78 ± 0.72 (0.67–0.91)

0.80 ± 0.52 (0.71–0.89)

0.91 ± 0.05 (0.83–1.2)

0.85 ± 0.01 (0.65–1.1)

0.30

0.30 ± 0.02 (0.26–0.33)

0.30 ± 0.02 (0.27–0.33)

0.29 ± 0.03 (0.21–0.33)

0.29 ± 0.01 (0.26–0.33)

0.25 ± 0.01 (0.21–0.27)

0.23 ± 0.02 (0.20–0.26)

1.15

1.10 ± 0.10 (0.89–1.2)

1.10 ± 0.08 (1.0–1.3)

1.10 ± 0.12 (0.86–1.4)

0.97 ± 0.10 (0.78–1.2)

1.30 ± 0.15 (0.94–1.5)

1.30 ± 0.14 (1.1–1.5)

2.56

2.65 ± 0.18 (2.5–3.1)

2.80 ± 0.24 (2.4–3.2)

1.71 ± 0.16 (1.4–2.0)

1.70 ± 0.27 (1.1–2.2)

1.65 ± 0.16 (1.3–1.9)

1.86 ± 0.18 (1.4–2.1)

G Model

A. furcatus n = 10, M

A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

% Standard length Head length Head depth Predorsal length Length of pectoral fin Length of pelvic fin Length of anal fin Minimum body depth Pectoral–anal fins distance Pectoral–pelvic fins distance Pelvic–anal fins distance Length of caudal peduncle Length of caudal fin Preanal distance % Preanal distance Minimum body depth Length of caudal peduncle Length of caudal fin % Head width Interorbital distance % Head length Eye diameter % Eye diameter Preorbital distance % Minimum body depth Length of caudal peduncle

Holotype Male

ARTICLE IN PRESS

Character

JCZ-25269; No. of Pages 11

6

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

Table 1 Morphometric characters of Aphanius furcatus sp. n., in comparison to A. dispar and A. ginaonis. Each cell contains mean ± standard deviation and range (minimum–maximum). M = male and F = female.

ARTICLE IN PRESS

G Model JCZ-25269; No. of Pages 11

5.7 ± 0.79 (4–7) 16.3 ± 0.70 (15–17) 7.4 ± 0.50 (7–8) 8.3 ± 0.72 (7–9) 14.5 ± 0.83 (13–16)

A. ginaonis n = 15, F

A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

7

investigated in this study. There is a phylogenetic signal for a sister group relationship of A. furcatus to A. dispar plus A. ginaonis, who in turn cannot be distinguished with bootstrap or posterior probabilities with this marker. These three species are sister to A. mento (Fig. 7). The phylogenetic analyses also clearly support the monophyly of all other species in the data set.

A. dispar n = 15, F

6.1 ± 0.51 (5–7) 16.3 ± 1.1 (15–18) 7.6 ± 0.50 (7–8) 8.1 ± 0.60 (7–9) 14.8 ± 0.94 (13–17) 9.64 ± 0.63 (9–11) 15.7 ± 1.10 (14–17) 7.3 ± 0.74 (6–8) 10.3 ± 0.61 (9–11) 15.0 ± 0.55 (14–16) 9.33 ± 0.67 (8–11) 15.7 ± 0.97 (14–17) 7.6 ± 0.63 (6–8) 10.0 ± 0.84 (9–11) 15.1 ± 0.45 (14–16) 10.1 ± 0.56 (9–11) 14.0 ± 0.66 (13–15) 5.3 ± 0.42 (5–6) 10.1 ± 0.66 (9–11) 14.9 ± 0.56 (14–16)

A. dispar n = 15, M A. furcatus n = 10, F

10.3 ± 1.10 (9–12) 13.8 ± 0.78 (12–15) 5.0 ± 0.47 (5–6) 9.7 ± 0.67 (9–11) 14.3 ± 1.33 (12–16) 10 14 5 9 14 Dorsal fin rays Pectoral fin rays Pelvic fin rays Anal fin rays Gill raker

A. furcatus n = 10, M Holotype Male Character

Table 2 Meristic characters (mean ± standard deviation and range) of Aphanius furcatus sp. n., in comparison to A. dispar and A. ginaonis. M = male and F = female.

A. ginaonis n = 15, M

3.3. Comparative morphology The results of the comparative morphometric and meristic analyses are summarized in Tables 1 and 2. Accordingly, A. furcatus differs from its relatives in Southern Iran by the combination of the following characters: Long caudal peduncle (24.4–32.3% of SL vs. 15.7–23.4% in A. dispar and 19.3–28.7% in A. ginaonis); long pectoral–pelvic fins distance (19.4–26.1% of SL vs. 12.6–21.3% in A. dispar and 15.9–24.6% in A. ginaonis); significantly short predorsal distance (55.1–60.3% of SL vs. 61.4–67.8% in A. dispar and 64.3–73.4% in A. ginaonis); small minimum body depth (8.6–11.1% of SL vs. 11.4–13.9% in A. dispar and 12.9–15.8% in A. ginaonis); small pelvic fin length (5.1–7.4% of SL vs. 4.1–11.5% in A. dispar and 19.3–12.5% in A. ginaonis); 12–15 pectoral fin rays (vs. 14–17 in A. dispar and 15–18 in A. ginaonis); 5–6 pelvic fin rays (vs. 6–8 in A. dispar and 7–8 in A. ginaonis). In addition, A. furcatus differs from A. ginaonis by a higher number of rays in the anal fin (9–11 vs. 7–9) and dorsal fin (9–12 vs. 4–7). The jaw teeth of A. furcatus display a long middle cusp and short lateral cusps (Fig. 4a–d). They are similar to the jaw teeth of A. mento (Fig. 4m–p), but clearly different with regard to the jaw teeth of A. dispar (Fig. 4e–h) and A. ginaonis (Fig. 4i–l), which display three cusps that are relatively equal in length. The otoliths of A. furcatus are generally oval or rounded in shape; the sulcus is S-shaped, the ostium deepened, and the long cauda distinctly bent towards its posterior end (Fig. 5a–e). They largely resemble the otoliths of A. dispar (Fig. 5f–k), and mainly differ from this species by the short size and equal size relations of the rostrum and antirostrum, and also by the clearly curved ventral rim. They are clearly different from the otoliths of A. ginaonis (Fig. 5l–p) that possess a long and usually pointed rostrum. They are also clearly different from A. mento because otoliths of A. mento are triangular in shape, have a prominent rostrum, and a straight sulcus (Fig. 5q–w). Thus, the otoliths additionally confirm the distinctiveness of A. furcatus and its close relation to A. dispar. The caudal skeleton in A. dispar, A. ginaonis, A. mento and A. furcatus displays a single hypural plate (Fig. 6). Four preural vertebrae (PU1–4) with long haemal and neural spines participate in the caudal skeleton of A. dispar and A. ginaonis (Fig. 6b–c), whereas five preural vertebrae (PU1–5) with long haemal and neural spines are present in A. mento (Fig. 6d). In contrast, only three preural vertebrae (PU1–3) contribute to the caudal skeleton in A. furcatus (Fig. 6a). In addition, the parhypural in A. furcatus displays elongate anterior arches that articulate with the lateroventral region of the centrum (Fig. 6a), whereas the parhypural is clearly distant from the terminal centrum in A. dispar (Fig. 6b), A. ginaonis (Fig. 6c) and A. mento (Fig. 6d). Distinctive cartilaginous plates are present in the caudal skeleton of A. furcatus, A. dispar and A. mento (Fig. 6a–b, d), whereas such structures are not visible in the caudal skeleton of A. ginaonis (Fig. 6c). In A. furcatus, the cartilaginous plates are located in front of the distal tips of the neural and haemal spines of PU3 (Fig. 6a), whereas the plates are placed in front of the distal tips of the neural and haemal spines of PU4 in A. dispar and A. mento (Fig. 6b and d). Additionally, A. mento seems to have a small plate in front of the spines of PU5 (Fig. 6d). Generally, the degree of ossification appears lower in A. furcatus than in A. dispar, A. ginaonis and A. mento. The epural is a thick and slightly sinuous bone in A. dispar and A. ginaonis (Fig. 6b–c), and thick but straight in A. mento (Fig. 6d). In contrast, the epural is

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

8

Fig. 7. Phylogenetic relationships of Aphanius furcatus sp. n. to other Aphanius species. Numbers at the branches are (from left to right): Maximum Likelihood bootstrap support values on 2000 replicates/Bayesian Posterior Probabilities. The numbers after taxa refer to accession numbers in GenBank.

a thin slender bone in A. furcatus (Fig. 6a). In addition, less welldeveloped ossification in A. furcatus is also visible in the reduced thickness of the neural and haemal spines of PU3, in the short length of the spines of the preceding caudal vertebrae and in the presence of thin and short ribs (Fig. 6a vs. b).

4. Discussion 4.1. The eloquence of the morphological data The comparative morphological analyses of the otoliths and the caudal skeleton osteology clearly support the relationships between the studied species as suggested by the molecular analysis. The otoliths of Aphanius species are usually rounded to triangular. Otoliths of the Mediterranean species such as A. mento display a straight sulcus (Fig. 5q–w), while the sulcus of the Aphanius species in the Persian Gulf area, such as A. dispar (Fig. 5f–k), A. ginaonis (Fig. 5l–p) and also A. sirhani Villwock et al., 1983 is distinctly bent towards its posterior end (Reichenbacher et al., 2007, 2009a, 2009b; Teimori et al., 2012a, 2012b). The otoliths of A. furcatus (Fig. 5a–e) clearly belong to the “Persian-Gulf-type” of otoliths because their sulcus is bent posteriorly. In addition to the sulcus similarities, the otoliths of A. furcatus and A. dispar share a similar shape. Thus, the otoliths fully confirm the close relationships between A. furcatus and A. dispar plus A. ginaonis and the distinctiveness of this group from A. mento. These phylogenetic relationships are additionally

indicated in the caudal skeleton because a sinuous haemal spine of PU2 is developed in A. furcatus, A. dispar and A. ginaonis, but not in A. mento. In contrast to the otoliths and the caudal skeleton, the tricuspid jaw teeth of A. furcatus are more similar to A. mento than to A. dispar and A. ginaonis. However, it is clear from our molecular data that this cannot represent a phylogenetic signal. Previous studies on tricuspid jaw teeth of Aphanius have revealed that the relative sizes of the lateral and central cusps are different between the species (Vasilyan et al., 2009; Teimori et al., 2011). Such a taxonomic value of jaw teeth morphology on the species level is clearly supported by the here achieved data because the central cusps of the jaw teeth in A. furcatus are less pointed and slightly wider than seen in A. mento (see Fig. 5a–d vs. m–p).

4.2. Phylogenetic relationships and evolutionary history A primarily vicariance-based speciation has been suggested for the genus Aphanius, but ecological factors are likely to have promoted the speciation processes in addition (Hrbek and Meyer, 2003). Based on maximum-likelihood results and calibrations both with geological and fossil data it was suggested that the lineage of A. mento has diverged from A. dispar about 20–28 million years ago (Hrbek and Meyer, 2003: Table 3). This calculation was based on the estimated age of 12–20 million years for the cut-off of the Iranian plate from the Tethys Sea according to Dercourt et al. (1986), and

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

on the assumption that this geological event most likely has triggered the separation of the E-Mediterranean (Tethyan) A. mento from the Persian (Iranian) A. dispar clade. In addition, Hrbek and Meyer (2003) estimated that the divergence of the landlocked A. dispar populations in Egypt, Djibouti, Saudi-Arabia and Iraq started about 6–8 million years ago, and probably was related to the ongoing collision between the African/Arabian and Eurasian plates. It should be noted that coastal populations of A. dispar such as those from Southern Iran and the Persian Gulf coast have diverged much more recently due to vicariance events in the course of the last glacial maximum in the Late Pleistocene (21,000–18,000 years ago) (Teimori et al., 2012b). As suggested from our phylogenetic analysis, A. furcatus is sister to A. dispar plus A. ginaonis, and these all are sister to A. mento (Fig. 7). As suggested by Hrbek and Meyer (2003), we assume that the split between A. mento and A. dispar is linked to the isolation of Iran from the Tethyan seaway. However, according to new geological data, this event can now be dated more precisely and happened about 16 million years ago (Reuter et al., 2009). As a result, we assume here an age of about 16 million years for the divergence between A. mento and A. dispar/A. ginaonis. In addition, we tentatively compared the branch lengths in the maximum-likelihood tree of Hrbek and Meyer (2003: Fig. 5) with those in our tree (Fig. 7), in order to estimate the age of the split between A. furcatus and A. dispar/A. ginaonis. Based on the short branch length that appears between the divergence of A. mento and that of A. furcatus, we suggest that the divergence of A. furcatus happened in a comparatively short time after the split of A. mento. Consequently, taking into account the newly estimated age of 16 million years for the A. mento split, we estimate that the A. furcatus lineage diverged about 12–14 million years ago. 4.3. Regressive evolution in Aphanius In the new species A. furcatus, several phenotypic characters show reductions; most remarkable is the complete absence of scales. Generally, variations in the shape of dermal skeletal elements of the fins, scales, cranium, and teeth play a significant role in adaptations of fish to new environments (Bell and Foster, 1994). Regressive characters such as scale reduction and reductions of pelvic (ventral) fins have been described for several teleost taxa and have been linked to adaptations and speciation processes (e.g., Villwock, 1982; Harris, 2012). Notably, these phenomena appear in different lineages of teleosts (Bell et al., 1993; Nelson, 1971; Harris, 2012). Also within the genus Aphanius, regressive evolution has been reported for several species (see below) that clearly belong to separate lineages (Villwock, 1984; Hrbek and Meyer, 2003; Hrbek et al., 2002; this study). Examples for species with reduced or lacking scalation are A. anatoliae (Leidenfrost, 1912) and A. asquamatus from springs and streams around saline lakes in Southwestern and Eastern Anatolia; their habitats are characterized by a high concentration of soda (Na2 CO3 ), sulphate (SO4 2− ) or magnesium chloride (MgCl2 ) in the water (Aksiray and Villwock, 1962; Grimm, 1980; Villwock, 1982, 1984; Wildekamp et al., 1999). Aksiray and Villwock (1962) assumed that the phenomena of reduced scalation in these species are a result of adaptation to the extreme habitat conditions. In contrast, Grimm (1979, 1980) favoured the idea that the regressive phenomena are due to the lack of stabilizing selection (so that mutants with all variations in scalation may survive), rather than to environmental adaptation. Further examples of Aphanius species that experienced regressive evolution are the extant A. apodus and the fossil (Upper Miocene) A. illunensis Gaudant, 1993 that are both characterized by absence of pelvic fins; A. illunensis shows also reduction in jaw teeth cusps (see Gervais, 1853; Parenti, 1981; Gaudant, 1993; Sienknecht, 1999). Sienknecht (1999) followed the

9

assumptions of Grimm (1979, 1980) in suggesting that lack of stabilizing factors led to an increasing number of specimens with mutations in A. apodus, which resulted in the regressive evolution and eventually in the absence of pelvic fins. However, Aksiray and Villwock (1962) and Villwock (1984) have pointed out that Aphanius species with a fully scaled body are present in freshwater habitats, while those with scale reductions appear in warm and hypersaline or sulphate (SO4 2− ) containing waters. They suggested that scale reduction processes are linked to physiological adaptations to the specific hydrochemical conditions in these extreme habitats, but did not specify what type of adaptations might have triggered the loss of scales. In the study of Harris et al. (2008), the loss of dermal skeleton structures such as fin rays, scales, and pharyngeal teeth was analyzed based on experiments with zebrafish. The authors demonstrated that the ectodysplasin (Eda) and ectodysplasin receptor (Edar) genes are specific for the development of adult skeletal and dental structures, and suggested that mutation in the Eda gene “could be a common mechanism that permits viable and diverse phenotypes”, which then can serve as a basis for selection (Harris et al., 2008: 12). The role of the Eda gene for scale development has also been shown for the Japanese ricefish or medaka Oryzias latipes (Kondo et al., 2001). Harris (2012) suggested that scale reductions or loss could be linked to oxygen poor environments that additionally lack predators, because the loss of scales enables the fish to transport additional oxygen via the skin. In such environments, phenotypes with reduced scalation or absence of scales would have a higher chance of survival. Another possible trigger for scale loss can be a high content of CaCO3 in water, because this minimizes the selective pressure for maintenance of calcium stores (Harris, 2012). The new species A. furcatus is thriving in extreme habitats characterized by low oxygen, high water temperatures, and high salt concentration (see type locality description above). It appears sympatrically with A. dispar, but the two species have different ecological preferences. Within the same river, A. furcatus is found along the riversides, where water temperature is high and oxygen concentration low. In contrast, A. dispar inhabits the middle of a river, where the water is deeper, water temperature lower, and oxygen concentration higher than along the sides. The ability of A. furcatus to survive under adverse conditions and in extreme habitats may be responsible for its competitiveness with regard to the very successful A. dispar (considering the wide distribution of A. dispar in Iran and the Persian Gulf area). In the habitats of A. furcatus, reduction of scales (and bones) saves energy and facilitates respiration, and is not disadvantageous because storage of Ca2+ is not necessary. We therefore conclude that the reductive phenomena observed in A. furcatus have evolved as an evolutionary response to the adaptation to adverse conditions and extreme habitats in order to compete with A. dispar.

Acknowledgments The Iranian Ministry of Sciences, Research and Technology and the LMU Graduate Centre are acknowledged for financial support to the first author. We thank S.H. Hashemi from the Environment Department of Hormuzgan for providing the facilities for fish collection. R. Khaefi, A. Gholamifard, G. Sayyadzadeh and S. Mirghiasi assisted in the collection of fish specimens, and M. Kamran and M. Dehdar helped with the logistic support in the field (all Shiraz University). J. Freyhof (Berlin) provided the A. mento specimens. G. Wörheide (LMU Munich) provided access to the Molecular Geoand Palaeobiology Lab at LMU Munich and G. Büttner and S. Schätzle assisted in the molecular work. M. Starck, J. Faltermeier and M. Altner (all LMU Munich) assisted in the staining procedures, and R. Melzer (ZSM, Munich) provided access to the SEM at the

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11 10

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

Bavarian State Collection of Zoology. To all, we express our sincere thanks.

References Bell, M.A., Orti, G., Walker, J.A., Koenings, J.P., 1993. Evolution of pelvic reduction in threespine stickleback fish: a test of competing hypotheses. Evolution 47, 906–914. Aksiray, F., Villwock, W., 1962. Populationsdynamische Betrachtungen an Zahnkarpfen des südwestanatolischen Aci (Tuz-) Golii. Zoologischer Anzeiger 168, 87–101. Arratia, G., Schultze, H.P., 1992. Re-evaluation of the caudal skeleton of certain actinopterygian fishes: III Salmonidae, homologization of caudal skeletal structures. Journal of Morphology 214, 187–249. Arratia, G., 1999. The monophyly of Teleostei and stem-group teleosts. Consensus and disagreements. In: Arratia, G., Schultze, H.-P. (Eds.), Mesozoic Fishes 2 – Systematics and Fossil Record. Verlag Dr. F. Pfeil, München, pp. 265–334. Bell, M.A., Foster, S.A., 1994. The Evolutionary Biology of the Threespine Stickleback. Oxford University Press, Oxford. Betancur, R.R., Broughton, R.E., Wiley, E.O., Carpenter, K., López, J.A., Li, C., Holcroft, N.I., Arcila, D., Sanciangco, M., Cureton, J., Zhang, F., Buser, T., Campbell, M., Rowley, T., Ballesteros, J.A., Lu, G., Grande, T., Arratia, G., Ortí, G., 2013. The tree of life and a new classification of bony fishes. PLoS Currents Tree of Life, http://dx.doi.org/10.1371/currents.tol.53ba26640df0ccaee75bb165c8c26288. Broughton, R.E., Betancur, R.R., Li, C., Arratia, G., Orti, G., 2013. Multi-locus phylogenetic analysis reveals the pattern and tempo of bony fish evolution. PLoS Currents Tree of Life, http://dx.doi.org/10.1371/currents.tol. 2ca8041495ffafd0c92756e75247483e. Coad, B.W., 1982. A new genus and species of cichlid endemic to southern Iran. Copeia, 28–37. Cuvier, G., Valenciennes, A., 1846. Histoire naturelle des poissons. Tome dixhuitième. Suite du livre dix-huitième. Cyprinoïdes. Livre dix-neuvième. Des Ésoces ou Lucioïdes 18, 1–505. Dercourt, J., Zonenshain, L.P., Ricou, L.E., Kazmin, V.G., Pichon, L.X., Knipper, A.L., Grandjacquet, C., Sbortshikov, I.M., Geyssant, J., Lepvrier, C., Pechersky, D.H., Boulin, J., Sibuet, J.C., Savostin, L.A., Sorokhtin, O., Westphal, M., Bazhenov, M.L., Lauer, J.P., Biju-Duval, B., 1986. Geological evolution of the Tethys belt from the Atlantic to the Pamirs since the Lias. Tectonophysics 123, 241–315. Doadrio, I., Carmona, J.A., Fernandez-Delgado, C., 2002. Morphometric study of the Iberian Aphanius (Actinopterygii: Cyprinodontiformes), with description of a new species. Folia Zoologica 51, 67–79. Echelle, A.A., Dowling, T.E., 1992. Mitochondrial DNA variation and evolution of the Death Valley pupfishes (Cyprinodon, Cyprinodontidae). Evolution 46, 193–206. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792–1797. Gaudant, J., 1993. Un example de régression évolutive chez des poissons Cyprinodontidae du Miocène supérieur d’Espagne: Aphanius illunensis nov. sp. Géobios 26, 449–454. Gervais, F.L.P., 1853. Remarques sur les poissons fluviatiles de l’Algérie, et description de deux genres nouveaux sous les noms de Coptodon et Tellia. Annales des Sciences Naturelles, Paris (Zoologie) 19, 5–17. Grimm, H., 1979. Eigröße und Eizahl in der Zahnkarpfengattung Aphanius (Pisces, Cyprinodontidae). Meeresforschung 27, 186–197. Grimm, H., 1980. Investigations on the problem of scale reduction and sulphate tolerance of west Anatolian cyprinodonts (Pisces). Internationale Revue der gesamten Hydrobiologie 4, 517–533. Geneious, 2013. Version R6 created by Biomatters. Geneious http://www. geneious.com Harris, M.P., Rohner, N., Schwarz, H., Perathoner, S., Konstantinidis, P., NüssleinVolhard, C., 2008. Zebrafish eda and edar mutants reveal conserved and ancestral roles of ectodysplasin signaling in vertebrates. PLoS Genetics 4, e1000206, http://dx.doi.org/10.1371/journal.pgen.1000206. Harris, M.P., 2012. Comparative genetics of postembryonic development as a means to understand evolutionary change. Journal of Applied Ichthyology 28, 306–315. Heckel, J.J., 1843. Ichthyologie [von Syrien]. In: von Russegger, J. (Ed.), Reisen in Europa, Asien und Africa, mit besonderer Rücksicht auf die naturwissenschaftlichen Verhältnisse der betreffenden Länder unternommen in den Jahren 1835 bis 1841, etc. E. Schweizerbart’sche Verlagshandlung, Stuttgart, pp. 990–1099. Holcik, J., 1989. The Freshwater Fishes of Europe. General Introduction to Fishes: Acipenseriformes. AULA-Verlag, Wiesbaden. Holly, M., 1929. Drei neue Fischformen aus Persien. Anzeiger der Akademy der Wissenschaften in Wien. Mathematisch-Naturwissenschaftliche Klasse 66, 62–64. Hrbek, T., Larson, A., 1999. The evolution of diapause in the killifish family Rivulidae (Atherinomorpha, Cyprinodontiformes): a molecular phylogenetic and biogeographic perspective. Evolution 53, 1200–1216. Hrbek, T., Kücük, F., Frickey, T., Stölting, N.K., Wildekamp, R.H., Meyer, A., 2002. Molecular phylogeny and historical biogeography of the Aphanius (Pisces, Cyprinodontiformes) species complex of central Anatolia, Turkey. Molecular Phylogenetics and Evolution 25, 125–137. Hrbek, T., Meyer, A., 2003. Closing of the Tethys Sea and the phylogeny of Eurasian killifishes (Cyprinodontiformes: Cyprinodontidae). Journal of Evolutionary Biology 16, 17–36.

Huelsenbeck, J.P., Ranala, B., 2004. Frequentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Systematic Biology 53, 904–913. Kondo, S., Kuwahara, Y., Kondo, M., Naruse, K., Mitani, H., Wakamatsu, Y., Ozato, K., Asakawa, S., Shimizu, N., Shima, A., 2001. The medaka rs-3 locus required for scale development encodes ectodysplasin – a receptor. Current Biology 11, 1202–1206. Kosswig, C., 1967. Tethys and its relation to the peri-mediterranean faunas of freshwater fishes. In: Adams, C.G., Ager, D.V. (Eds.), Aspects of Tethyan Biogeography. Systematics Association Publication, pp. 313–324. Leidenfrost, G., 1912. Kis-ázsiai halak (Fishes from Asia Minor). Allatani Közlemények 11, 125–132. Nardo, G.D., 1827. Prodromus observationum et disquisitionum Adriaticae ichthyologiae. Giornale di fisica, chimica e storia naturale, medicina, ed arti 10, 22–40. Near, T.J., Eytan, R.I., Dornburg, A., Kuhn, K.L., Moore, J.A., Davis, M.P., Wainwright, P.C., Friedman, M., Smith, W.L., 2012. Resolution of ray-finned fish phylogeny and timing of diversification. Proceedings of the National Academy of Sciences of the United States of America 109, 13698–13703. Nelson, J.S., 1971. Absence of the pelvic complex in ninespine sticklebacks, Pungitius pungitius, collected in Ireland and Wood Buffalo National Park region, Canada, with notes on meristic variation. Copeia 1971, 707–717. Parenti, L.R., 1981. A phylogenetic and biogeographic analysis of the cyprinodontiform fishes (Teleostei, Atherinomorpha). The Bulletin of the American Museum of Natural History 168, 335–557. Parker, A., Kornfield, I., 1995. Molecular perspective on evolution and zoogeography of cyprinodontid killifishes (Teleostei; Atherinomorpha). Copeia 1995, 8–21. Potthoff, T., 1984. Clearing and staining techniques. In: Moser, H.G., Richards, W.J., Cohen, D.M., Fahay, M.P., Kendall, A.W., Richardson, S.L. (Eds.), Ontogeny and Systematics of Fishes (based on an international symposium dedicated to the memory of Elbert Halvor Ahlstrom. Am Soc Ichthyol Herpetol/Allen Press, Lawrence, KS, pp. 35–37. Reichenbacher, B., Sienknecht, U., Küchenhoff, H., Fenske, N., 2007. Combined otolith morphology and morphometry for assessing taxonomy and diversity in fossil and extant killifish (Aphanius, Prolebias). Journal of Morphology 268, 898–915. Reichenbacher, B., Feulner, G.R., Schulz-Mirbach, T., 2009a. Geographic variation in otolith morphology among freshwater populations of Aphanius dispar (Teleostei, Cyprinodontiformes) from the southeastern Arabian Peninsula. Journal of Morphology 270, 469–484. Reichenbacher, B., Kamrani, E., Esmaeili, H.R., Teimori, A., 2009b. The endangered cyprinodont Aphanius ginaonis (Holly, 1929) from southern Iran is a valid species: evidence from otolith morphology. Environmental Biology of Fishes 86, 507–521. Reuter, M., Piller, W.E., Harzhauser, M., Mandic, O., Berning, B., Rögl, F., Kroh, A., Aubry, M.P., Wielandt-Schuster, U., Hamedani, A., 2009. The Oligo-/Miocene Qom Formation (Iran): evidence for an early Burdigalian restriction of the Tethyan Seaway and closure of its Iranian gateways. The International Journal of Earth Sciences 98, 627–650. Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Rosenthal, A., Coutelle, O., Craxton, M., 1993. Large-scale production of DNA sequencing templates by microtitre format PCR. Nucleic Acids Research 21, 173–174. Rüppell, W.P.E.S., 1829. Beschreibung und Abbildung mehrerer neuer Fische, im Nil entdeckt. Brönner, Frankfurt am Main, pp. 1–12. Sienknecht, U., 1999. Kreuzungsgenetische Analyse des Überganges von Paarflossen bis zu fehlendem Extremitätengürtel: entwickelt am Beispiel der normogenetischen Ventralflossenbildung von Aphanius iberus Cuv and Val 1846 im Vergleich zur Anormogenese seiner Hybriden mit A apodus Gervais, 1853. Cyprinodontidae Der Andere Verlag, Bad Iburg, Teleostei. Sözer, F., 1942. Türkiye Cyprinodontid’leri hakkında Contributions à la connaissance des Cyprinodontides de la Turquie. Revue de la Faculté des Sciences de l’Université d’Instanbul, Série B. Sciences Naturelles 7, 307–316. SPSS Inc., 2012. PASW 20.0 Base. SPSS Inc., Chicago. Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. Teimori, A., Esmaeili, H.R., Reichenbacher, B., 2011. Aphanius farsicus, a replacement name for A. persicus (Jenkins, 1910) (Teleostei, Cyprinodontidae). Zootaxa 3096, 53–58. Teimori, A., Schulz-Mirbach, T., Esmaeili, H.R., Reichenbacher, B., 2012a. Geographical differentiation of Aphanius dispar (Teleostei: Cyprinodontidae) from Southern Iran. Journal of Zoological Systematics and Evolutionary Research 50, 251–337. Teimori, A., Jawad, J.L.A., Al-Kharusi, L.H., Al-Mamry, J.M., Reichenbacher, B., 2012b. Late Pleistocene to Holocene diversification and historical zoogeography of the Arabian killifish (Aphanius dispar) inferred from otolith morphology. Scientia Marina 76, 637–645. Vasilyan, D., Reichenbacher, B., Carnevale, G., 2009. A new fossil Aphanius species from the Upper Miocene of Armenia (Eastern Paratethys). Paläontol Z 83, 511–519. Villwock, W., 1964. Genetische Untersuchungen an altweltlichen Zahnkarpfen der Tribus Aphaniini (Pisces, Cyprinodontidae) nach Gesichtspunkten der Neuen Systematik. Journal of Zoological Systematics and Evolutionary Research 2, 267–383.

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001

G Model JCZ-25269; No. of Pages 11

ARTICLE IN PRESS A. Teimori et al. / Zoologischer Anzeiger xxx (2014) xxx–xxx

Villwock, W., 1982. Aphanius Nardo, 1827 and Cyprinodon Lacépède, 1803 (Pisces: Cyprinodontidae), an attempt for a genetic interpretation of speciation. Journal of Zoological Systematics and Evolutionary Research 20, 187–197. Villwock, W., Scholl, A., Krupp, F., 1983. Zur Taxonomie, Verbreitung und Speziation des Formenkreises Aphanius dispar (Rüppell, 1828) und Beschreibung von Aphanius sirhani n. sp. (Pisces, Cyprinodontidae). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut 80, 251–277. Villwock, W., 1984. Schuppen- und Ventralflossenreduktionen, Phänomene regressiver Evolution am Beispiel altweltlicher Zahnkarpfen der Tribus Aphaniini (Pisces: Cyprinodontidae). In: Herre, W. (Ed.), Regressive Evolution und Phylogenese. Fortschritte Zoologie System Evolutionsforschung Verlag Paul Parey, Hamburg and Berlin, pp. 72–100.

11

Villwock, W., 1999. Biogeography of cyprinodontiform fishes (Teleostei: Cyprinodontidae) of the Mediterranean region. In: Valenciana, G. (Ed.), Peces cyprinodontidos ibéricos: Fartet y Samaruc. Consellería de Medio Ambiente, Valencia, pp. 13–33. Wildekamp, R.H., 1993. A world of killies. Atlas of the oviparous cyprinodontiform fishes of the world. The genera Adamas, Adinia, Aphanius, Aphyoplatys and Aphyosemion. American Killifish Association, Indiana. Wildekamp, R.H., Küc¸ük, F., Ünlüsayin, M., Neer, W.V., 1999. Species and subspecies of the genus Aphanius Nardo 1897 (Pisces: Cyprinodontiformes) in Turkey. The Turkish Journal of Zoology 23, 23–44.

Please cite this article in press as: Teimori, A., et al., A new and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zool. Anz. (2014), http://dx.doi.org/10.1016/j.jcz.2013.12.001