- Email: [email protected]
A novel fibrinogenase from Agkistrodon acutus venom protects against DIC via direct degradation of thrombosis and activation of protein C
Biochemical Pharmacology 84 (2012) 905–913
Contents lists available at SciVerse ScienceDirect
Biochemical Pharmacology journal homepage: www.elsevier.com/locate/biochempharm
A novel fibrinogenase from Agkistrodon acutus venom protects against DIC via direct degradation of thrombosis and activation of protein C Jie-zhen Qi a,1, Xi Lin b,1,**, Jia-shu Chen a,*, Zhen-hua Huang a, Peng-xin Qiu a, Guang-mei Yan a a b
Department of Pharmacology, Zhongshan Medical College, SUN Yat-Sen University, Guangzhou 510080, China Department of Pharmacology, Medical College, Ji-nan University, Guangzhou 510632, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 April 2012 Accepted 13 June 2012 Available online 20 June 2012
The incidence of disseminated intravascular coagulation (DIC), which leads to multiple organ dysfunction and high mortality, has remained constant in recent years. At present, treatments of DIC have focused on preventing cytokine induction, inhibiting coagulation processes and promoting fibrinolysis. Recent clinical trials have supported the use of antithrombin and activated protein C supplementation in DIC. To better understand the mechanism of treatment on DIC, we here report a novel fibrinogenase from Agkistrodon acutus (FIIa) that effectively protected against LPS-induced DIC in a rabbit model, and detected the tissue factors expression in HUVE cells after using FIIa. In vivo, administration of FIIa reduced hepatic and renal damage, increased the concentration of fibrinogen, the activities of protein C, the platelet count, APTT, PT, FDP, the level of AT-III and t-PA, decreased the level of PAI-1, and increased survival rate in LPS-induced DIC rabbits. In vitro experiments, we further confirmed that FIIa up-regulated the expression of t-PA and u-PA, down-regulated the expression of PAI-1, and directly activated protein C. Our findings suggest that FIIa could effectively protect against DIC via direct degradation of microthrombi and activation of protein C as well as provide a novel strategy to develop a single proteinase molecule for targeting the main pathological processes of this disease. Crown Copyright ß 2012 Published by Elsevier Inc. All rights reserved.
Keywords: DIC Fibrinogenase Lipopolysaccharide Microthrombi Protein C
1. Introduction Disseminated intravascular coagulation (DIC) is an acquired syndrome characterized by the activation of intravascular coagulation and subsequent intravascular fibrin formation. This process may be accompanied by secondary fibrinolysis, which often leads to a bleeding tendency, or deficient fibrinolysis [1,2], which can cause diffuse microthrombi formation in the organs, severe cases can lead to multiple organ function failure and finally death [3]. DIC is a life threatening syndrome arising from various causes including disseminated sepsis. It is generally associated with an
Abbreviations: APC, activated protein C; APTT, activated partial thromboplastin time; AT-III, antithrombin III; DIC, disseminated intravascular coagulation; EGF, endothelial growth factor; FDP, fibrin(-ogen) degradation products; FIIa, fibrinogenase II from Agkistrodon acutus; HUVECs, human umbilical vein endothelial cells; LPS, Lipopolysaccharide; PAI-1, plasminogen activator inhibitor-1; PT, plasma prothrombin time; t-PA, tissue-type plasminogen activators; TNF-a, tumor necrosis factor-a; u-PA, urokinase-like plasminogen activators; VEGF, vascular endothelial growth factor. * Corresponding author. Tel.: +86 20 87330553; fax: +86 20 87330553. ** Co-corresponding author. Tel.: +86 20 85220242; fax: +86 20 85228865. E-mail addresses: [email protected] (X. Lin), [email protected] (J.-s. Chen). 1 These two authors contributed equally to this article.
adverse outcome [4,5]. If severe or life-threatening hemorrhage occurs, replacement with platelets, fresh plasma, and possibly cryoprecipitate, is indicated [6], but the intravascular fibrin formation and organ dysfunction are often irreversible by the fact that the timing of therapy is crucial. The standard anticoagulant therapy such as heparin and low molecular weight heparin is thought to enhance the effects of thrombolysis by preventing formation of new fibrin in organs. Thus far, however, there is no indication from clinical studies that anticoagulation offers any survival benefit in patients with DIC. Another therapeutical choice in treating DIC is to administer plaminogen activators(t-PA, u-PA) to induce fibrinolysis of existing and developing clots. Experimental studies with u-PA have shown modest effects [7]. Plasminogen activator inhibitor(PAI)-1 is the principal inhibitor of plasminogen activation and appears to be the most involved in DIC [8,9]. Increased PAI-1 has been associated with a predisposition to thrombosis, which is a specific inhibitor of t-PA released from endothelial cells. These conditions may ‘‘overflow’’ the systemic circulation that leads to systemic fibrinolysis and degradation of other clotting proteins [10], increases the bleeding tendency. Combination therapy with multiple anticoagulatory agents may ultimately prove to be the best approach for treating DIC. One recent study found that combining ATIII and protein C-supplement therapy reduced TNF-a levels and hypotension associated with
0006-2952/$ – see front matter . Crown Copyright ß 2012 Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.bcp.2012.06.011
906
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
endotoxin-induced experimental sepsis, though no effect on coagulation parameters was evident [11]. Recombinant human activated protein C has shown efficacy in decreasing mortality in patients with sepsis accompanied with DIC, but it is not clear to which extent this benefit is caused by amelioration of DIC. Many therapeutic avenues are being developed based on recent findings into the causes and progression of DIC, but really no effective therapy available [12–14]. FIIa is a noval fibrinolytic enzyme purified from Agkistrodon acutus venom, which is belonged to the snake vemon metalloproteinase family. The crystal structure of FIIa features that it has a Zn2+ ion in the active site which is essential for hydrolytic activity [15,16]. In vitro FIIa directly degrades a-chains and b-chains of fibrin/fibrinogen, whereas in vivo studies show it dissolves thrombus without activating plasminogen or influencing the activities of t-PA, urokinase, and PAI-1 [17]. This shows that FIIa has a different mechanism of action from t-PA and urokinase. Additionally, in the examination of tissue sections from kidney, liver, heart, and lung [17], the thrombolytic activities of FIIa lacked hemorrhaging. These results suggest that FIIa should be a safe and attractive agent for treating DIC. To better understand the effect of FIIa, which may be a potential clinical use in DIC, here we report the activity of FIIa on a lipopolysaccharide (LPS)-induced model of DIC and investigated the mechanism of its action in laboratory. 2. Materials and methods 2.1. Reagents LPS, heparin, and human fibrinogen (95% clottable) were purchased from Sigma (St. Louis, Mo). The fibrinogen concentration determination reagent pack (Clauss method) and the reagent packs for the activity assays of antithrombin III (ATIII), protein C, plasminogen, PAI-1, and t-PA were obtained from Sun Biotechnology Company (Shanghai, China); The human t-PA ELISA kit and the human u-PA ELISA kit were purchased from ASSAYPRO (USA). The human PAI-1 ELISA kit, the human recombined TNF-a and its antibody, the VEGF, the t-PA antibody and the u-PA antibody were purchased from R&D systems, Inc (USA). The protein C and EGF were purchased from abcam (USA), and the human APC ELISA kit was from USCN LIFE (USA); all other reagents were analytical grade from commercial sources. 2.2. Animals Adult male New Zealand white rabbits (weight 2–3 kg) were supplied by the Experimental Animal Center of Guangdong Province. 2.3. Purification of the enzyme The fibrinogenase II(FIIa) isolated from Agkistrodon acutus vemon, was prepared according to the method previously described [18]. 2.4. Experiments in vivo 2.4.1. Experimental animal models All procedures were conducted according to the ethical guidelines of the Animal Care and Use Committee at SUN Yat-Sen University. DIC experimental models were performed by the method of Jose Hermida [19], which were induced by infusing LPS in 60 ml of saline solution at a rate of 100 mg/kg/h (10 ml/h) through the marginal ear vein of rabbits over a period of 6 h. Animals were anesthetized by an intramuscular injection of 30 mg/kg ketamine
hydrochloride, followed by intramuscular supplements of ketamine hydrochloride given throughout the experiment. Treatments, which were according to the method of Lin [20], started simultaneously with LPS infusion through the contralateral marginal ear vein. Six different groups were established, one of which contains 10 animals: treatment groups (low-, medium-, and high-dose FIIa) were given 0.1, 0.3 and 0.6 mg/kg/h in 60 ml of saline solution over a period of 6 h (10 ml/h). The LPS control group was infused with saline solution, which was at a rate of 10 ml/h, over a period of 6 h. The heparin control group was infused with heparin at a rate of 100 IU/kg/h (10 ml/h) over a period of 6 h. The normal control group, which was given neither LPS nor FIIa, was infused with saline solution through both marginal ear veins of the animals. 2.4.2. Sample collection and handling Blood samples were taken through a catheter inserted into a femoral artery immediately before LPS infusion and at 2 and 6 h postinfusion. Blood samples were collected in 3.8% sodium citrate (1:10 vol/vol citrate/blood). The blood was centrifuged at 2000 g for 15 min at 4 8C. Blood for the measurement of t-PA was collected in Stabilyte tubes (Biopool, Umea, Sweden) in order to avoid the interference with its inhibitors. All samples were stored at 70 8C until assayed. 2.4.3. Laboratory methods Fibrinogen consentration was measured according to the method of Clauss. ATIII, protein C, plasminogen, PAI-1, and t-PA activity were measured according to the reagent pack instruction based on chromogenic substrates. 2.4.4. Tissue preparation for histologic examination Kidney, liver tissue specimens were fixed in formalin, embedded in paraffin, stained with phosphotungstic acid-hematoxylin stain, and examined for the presence of fibrin microthrombi by a pathologist. 2.5. Experiments in vitro 2.5.1. Human umbilical vein endothelial cells (HUVEC) cultures Primary HUVEC were isolated from normal umbilical cords as described by Jaffe EA [21]. HUVEC were cultured in Medium 199 (Gibco BRL, Grand Island, NY, USA) containing 20% fetal bovine calf serum (Hyclone, Logan, UT, USA), endothelial growth supplement (Sigma, St. Louis, MO, USA), 5% penicillin/streptomycin (Gibco BRL), and 25 ug/ml heparin (Sigma), and 50 ng/ml ECGs (abcam). For assays, HUVEC were plated at a concentration of 1 105 cell/ ml and grown for 24 h with a humidified atmosphere of 5% CO2 at 37 8C prior to experimentation. All experiments utilized cells grown within five passages. In the following experiments, the concentration of FIIa is 2.5 mg/ml and the density of HUVEC is 1 105/well. 2.5.2. The action of FIIa on TNF-a-induced PAI-1 cell model 2.5.2.1. Observation of PAI-1 protein by immunofluorescence. Four different groups were established, control group was given M199 only. The positive group was given TNF-a (100 ng/ml), meanwhile the treatment group was given TNF-a (100 ng/ml) and FIIa. The fourth group was only given FIIa. The protocol of immunofluorescence is the same as the above describe, except that the primer antibody is PAI-1 antibody. 2.5.2.2. Measurement of PAI-1 concentration by ELISA assays. The concentration of PAI-1 in the supernatant was determined using Human Serpin E1/PAI-1 ELISA kit (R & D systems, USA), according to the assay procedures.
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
2.5.2.3. Measurement of PAI-1 mRNA level by RT-PCR. Cells were harvested in TRIzol reagent (Sigma), and the recommended protocol was followed to extract total RNA. RNA was quantified using SmartSpecTM 3000(BIO-RAD, USA), reversely transcribed using SuperscriptTM III reverse transcriptase (GibcoBRL, USA), and cDNA was then subjected to PCR using GoTaq1 Green Master Mix (Promega, USA). cDNA was used for PCR, and the primer sequences of PAI-1 are: 50 GTCTGCTGTGCACCATCCCCCATC30 (sense primer), 50 -TTGTCATCAATCTTGAATCCCATA-30 (antisense primer). The primer sequences of GAPDH are the same as the above describe. Conditions for the PCR reaction were: template denaturation at 94 8C for 45 s; primer annealing at 60 8C for 45 s; primer extension at 72 8C for 45 s for 28 cycles, and an additional 5 min extension at 72 8C to complete the reaction. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized with ethidium bromide staining. 2.5.3. The actions of FIIa on t-PA and u-PA 2.5.3.1. Observation of t-PA and u-PA protein by immunofluorescence. Briefly, three different groups were established, containing two wells each, control group was given M199 only. The treatment group was given FIIa, meanwhile the positive group was given VEGF (50 ng/ml). All cells were incubated for 24 h. Attached cells treated by different reagents were rinsed with phosphate-buffered saline (PBS) prior to fixation in 4% (v/v) paraform for 20 min and then permeabilized with 0.5% (v/v). Triton X-100 in PBS for 20 min. Cells, which were added primary antibody: t-PA antibody and u-PA antibody respectively, were incubated with 5% (v/v) BSA for 30 min to block non-specific binding sites before incubation for 24 h at 4 8C. Then cells were rinsed in PBS and incubated with the secondary antibody in the dark for 45 min (fluorescein isothiocyanate-conjugated goat anti-mouse IgG, 1:150 in PBS). Cells were then gently rinsed and examined with Zeiss (Carl Zeiss Microimaging, Thornwood, NY) confocal laser-scanning microscope (LSCM). 2.5.3.2. Measurement of t-PA and u-PA concentration by ELISA assays. The concentration of t-PA and u-PA in the supernatant was determined using Human Tissue – Type Plasminogen Activator ELISA kit and Human Urokinase ELISA kit (ASSAYPRO, USA) respectively, according to the assay procedures.
907
2.5.4. The action of FIIa on protein C 2.5.4.1. Measurement of protein C activity by ELISA assays. 0.1 u mol human recombined protein C (abcam) was dissolved in 5 ml buffer (0.038 mol/l NaCL, 0.01% Tween 80 and PH 7.4, 0.05 mol/l Tris– HCL) and incubated with 0.1, 0.5, 2.5, 12.5ug/ml FII for 30, 60, 90, 120 min respectively at 37 8C in vitro. Protac1 was the positive control. APC concentration was measured by Human activated protein C, APC ELISA kit (USCN LIFE, USA). 2.5.4.2. Measurement of protein C mRNA level by RT-PCR. Three different groups were established, control group was given M199 only. The positive groups was given Protac1 (50 ng/ml), and the treatment group was given FIIa. Cells were harvested in TRIzol reagent (Sigma), and the recommended protocol was followed to extract total RNA. RNA was quantified using SmartSpecTM 3000(BIO-RAD, USA), reversely transcribed using SuperscriptTM III reverse transcriptase (Gibco-BRL, USA), and cDNA was then subjected to PCR using GoTaq1 Green Master Mix (Promega, USA). cDNA was used for PCR, and the primer sequences of protein C are: 50 -CAGGCTTGGAGAGTATGAC-30 (sense primer), 50 -ATGAAGTTGAGGACGAAGG-30 (antisense primer). Conditions for the PCR reaction were: template denaturation at 94 8C for 45 s; primer annealing at 60 8C for 45 s; primer extension at 72 8C for 45 s for 28 cycles, and an additional 5 min extension at 72 8C to complete the reaction. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized with ethidium bromide staining. 2.6. Data analysis Differences between data groups were evaluated for significance using Student t-test of unpaired data or one-way analysis of variance. Repeated measures analysis of variance was used for multivariate analysis. Data are presented as mean SD of three separate experiments. Data in Table 1 at 2 and 6 h were converted to percentages, with a value of 100% assumed for basal data. Survival curves of LPS-induced DIC were analyzed by the Kaplan–Meyer logrank test. A result with a P value of < 0.05 was considered statistically significant. 3. Results 3.1. FIIa decreased the mortality of LPS-induced DIC rabbits
2.5.3.3. Measurement of t-PA and u-PA mRNA level by RT-PCR. Cells were harvested in TRIzol reagent (Sigma), and the recommended protocol was followed to extract total RNA. RNA was quantified using SmartSpecTM 3000(BIO-RAD, USA), reversely transcribed using SuperscriptTM III reverse transcriptase (GibcoBRL, USA), and cDNA was then subjected to PCR using GoTaq1 Green Master Mix (Promega, USA). cDNA was used for PCR, and the primer sequences are as follows: t-PA:50 -CAGGCTGACGTGGGAGTACTG-30 (sense primer), 50 CTCCTGTGCTTGGCAAAGATG-30 (antisense primer); u-PA: 50 -ATCTGCCTGCCCTCGATGTATAAC-30 (sense primer) 50 -ATTCCAGTCAAAGTCATGCGGCCT-30 (antisense primer) GAPDH: 50 -CCACCCATGGCAAATTCCATGGCA-30 (sense primer) 50 -TCTAGACGGCAGGTCAGGTCCACC-30 (antisense primer).
We firstly investigated the protective effect of FII in the LPSinduced DIC model in rabbits, a clinically relevant model for human DIC [22,23]. FII treatment was started simultaneously with LPS induction of DIC. Six of the 10 rabbits in the LPS group died within the first 6 h and 9 died within 24 h. Two of the 10 rabbits in the low-dose FII group died within the first 6 h and 7 died within 24 h. However, none of the 10 rabbits in the medium- and highdose groups died within the first 6 h, whereas 5 died within 24 h in the medium-dose FII group, and 4 died within 24 h in the highdose FII group. The mortality rates in the low-, medium- and highdose groups were significantly lower than in the LPS group at both 6 h (Fig. 1A) and 24 h (Fig. 1B) (P < 0.01). These data suggested that FIIa was capable of protecting against LPS-induced DIC. 3.2. FIIa improved the hemostatic parameters in LPS-induced DIC rabbits
Conditions for the PCR reaction were: template denaturation at 95 8C for 30 s; primer annealing at 55 8C for 30 s; primer extension at 72 8C for 45 s for 32 cycles, and an additional 5 min extension at 72 8C to complete the reaction. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized with ethidium bromide staining.
Two-hour post-intravenous injection of LPS (100 mg/kg/h) into rabbits caused a significant decrease in the concentration of fibrinogen and the activities of protein C, ATIII, plasminogen, and t-PA (P < 0.05, compared with the saline solution group). However, PAI-1 activity increased under similar experimental conditions
Heparin
0.6 mg/kg FII
0.3 mg/kg FII
0.1 mg/kg FII
LPS
2h 6h 2h 6h 2h 6h 2h 6h 2h 6h 2h 6h Normal
*P < 0.05 and #P < 0.01 as compared to the LPS-treated group. Data are presented as the mean S.D. LPS: infusion of 0.1 mg/kg/h LPS for 6 h. 0.1 mg/kg FIIa: simultaneous infusion of 0.1 mg/kg/h LPS and 0.1 mg/kg FIIa. 0.3 mg/kg FIIa: simultaneous infusion of 0.1 mg/kg/h LPS and 0.3 mg/kg FII. 0.6 mg/kg FIIa: simultaneous infusion of 0.1 mg/kg/h LPS and 0.6 mg/kg FIIa. Heparin: simultaneous infusion of 0.1 mg/kg/h LPS and 100 IU/kg/h heparin.
101.64 14.53# 99.21 10.92# 64.15 17.58 46.76 18.65 96.32 29.97# 107.02 32.38# 90.05 36.47# 94.39 30.99# 104.45 32.68# 109.21 33.92# 80.36 20.67# 76.19 26.57#
102.73 7.09# 105.36 9.27# 230.18 40.56 262.17 44.27 171.63 29.50# 154.21 23.29# 130.41 25.99# 108.06 31.43# 110.18 28.36# 109.73 26.74# 150.31 24.62# 124.98 29.04#
T-PA (%)
98.14 8.78# 101.21 10.32# 53.12 17.25 40.85 12.01 87.62 21.46# 93.51 23.72v 106.45 30.47# 120.86 27.16# 108.16 24.63# 133.89 23.74# 83.17 19.26# 81.14 17.98# <0.05# <0.05# 74.3 20.16 95.24 26.48 36.36 12.41# 30.58 13.62# 34.45 16.24# 24.59 12.03# 27.97 14.68# 72.35 23.16 36.99 14.52# 26.37 11.61#
99.12 6.21* 101.36 7.72# 84.17 18.32 52.18 23.11 94.62 7.73 93.13 12.14# 97.41 6.23 98.26 10.64# 99.56 5.73* 101.46 4.89# 83.41 14.57 84.68 7.06#
Protein C (%) FDP
4.04 1.02 4.14 1.59# 3.74 1.13 1.68 0.52 3.93 1.38 2.64 0.81# 3.97 1.29 3.56 0.83# 4.02 1.48 2.15 0.84 4.01 1.64 2.76 1.14# 440.24 20.78# 462.13 47.09# 330.61 43.28 163.26 26.56 360.15 53.48 223.72 55.14# 386.87 43.91* 283.92 28.67# 410.25 52.24# 330.47 29.38# 373.76 25.92# 290.11 19.16# 6.87 1.16 7.01 0.84# 12.39 4.06 20.54 5.12 9.42 3.29 12.67 5.14# 8.83 2.51* 10.24 2.82# 8.42 1.73# 9.69 2.45# 9.15 1.38* 11.83 1.19# 13.14 2.01 14.29 1.89# 24.62 5.42 38.38 8.31 19.94 4.53 30.35 6.20* 18.20 3.41* 26.71 4.87# 16.62 2.75# 26.36 4.01# 16.82 2.41# 27.95 4.62#
Time (h) Goups
APTT (s)
#
PT (s)
#
Platelets (*109/l)
Fibrinogen (g/l)
AT-III (%)
PAI-1 (%)
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913 Table 1 Hemostatic parameters 2 and 6 h after LPS infusion into rabbits in normal, LPS-treated, FIIa-treated and heparin-treated groups. Plasma levels of activated partial thromboplastin time (APTT), prothrombin time (PT), platelet count, fibrinogen, fibrin and degradation product (FDP) were shown. Plasma levels of protein C, AT-III, t-PA and PAI-1 were converted to percentages with a value of 100% assumed for basal data.
908
(P < 0.05). At 6 h postinjection, fibrinogen concentration and the activities of protein C, plasminogen, t-PA, an ATIII decreased (P < 0.05), whereas PAI-1 activity increased (P < 0.05, Table 1), which is consistent with the data obtained at 2 h. We found that infusion of a low, medium, and high dose of FIIa ameliorated the activities of protein C, ATIII, plasminogen, FDP, and PAI-1 at 2 h when compared with LPS control group (P < 0.05). Sixhour measurements made at all doses of infused FIIa showed a significant increase in the activities of protein C, plasminogen, t-PA, FDP, and ATIII (P < 0.01), whereas PAI-1 activity decreased (P < 0.05). Low and medium doses of FIIa also ameliorated fibrinogen concentration. The activities of protein C and plasminogen were increased at the high-dose FIIa group (P < 0.01, Table 1), compared with the saline control group. 3.3. FII reduced the hepatic and renal damage in LPS-induced DIC rabbits Two-hour and six-hour post-intravenous injection of LPS (100 mg/kg/h) into rabbits caused a significant increase in plasma levels of alanine aminotransferase (ALT) (an indicator of liver injury), and BUN (an indicator of renal injury), compared with the saline group. However, we found that infusion of a low, medium, and high dose of FIIa the levels of ALT and BUN were significantly decreased, which was also demonstrated in heparin treatment (Fig. 2A and B). Intense fibrin deposition was detected in most LPStreated rabbits in kidney and liver. A high level of fibrin deposition was detected in most of the low-dose FIIa group, whereas a lower level of fibrin deposition was detected in most of the medium-dose FIIa group. No fibrin deposition was detected in most of the highdose FIIa group, little fibrin deposition was detected in most of the treated heparin group (Fig. 2C and D). These findings indicated that FIIa was able to ameliorated hepatic and renal injury after injection of LPS. 3.4. FIIa down-regulated the expression of PAI-1 in TNF-a-induced cells FIIa did not decrease the cell number at the concentration of 0.1 ug/ml to 2.5 ug/ml (Supplementary Fig. 1A). Nevertheless, FIIa exhibited little cytotoxic effect on HUVEC cells from 0.5 ug/ml to 62.5 ug/ml in dose-dependent fashion (Supplementary Fig. 1B). Therefore, FIIa at the concentration of 2.5 ug/ml, was employed in the following experiments design. The result of ELISA kit assay showed that FIIa inhibited the PAI-1 secretion stimulated by TNFa, but FIIa alone caused no effect on the production of PAI-1 in HUVEC cells (Fig. 3A). To further determine the inhibitory effect of FIIa on PAI-1 production induced by TNF-a, We performed the immunofluorescence assay and analyzed the expression of PAI-1 in HUVEC cells. As Fig. 3B shown, TNF-a treatment exhibited the higher expression of PAI-1 than the control and FIIa suppressed the up-regulation induced by TNF-a, which was consistent with human PAI-1 ELISA assay. 3.5. FIIa stimulates the expression of t-PA and u-PA at transcriptional level in HUVEC cells T-PA and u-PA catalyze the conversion of plasminogen to plasmin and are important drugs in the treatment of thromboembolic disease such as DIC [24]. During DIC vascular endothelial cells are suffered from inflammatory damage and thus reduce the secretion of t-PA and u-PA. To further detect the reason why FIIa blocked the reduction in t-PA concentration in LPS-induced DIC rabbits, we first observed the effect of FIIa on t-PA protein level in HUVEC cells. As shown in Fig. 4A, C, FIIa increased the production and protein expression of t-PA. RT-PCR assay demonstrated that
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
909
Fig. 1. FIIa decreased the mortality of LPS-induced DIC induced rabbits. 0.1, 0.3, 0.6 mg/kg FIIa and 100 IU/kg heparin were administered simultaneously with LPS by intravenous injection. Survival rate was monitored at 6 h (A) and 24 h (B) after LPS infusion.
Fig. 2. FIIa attenuated the hepatic and renal injury in LPS-induced DIC rabbits. Blood samples were taken immediately in the normal group (before LPS infusion), the LPStreated group (at 2 h and 6 h after the infusion), the FIIa-treated group (low-, medium-, and high-dose) and the heparin-treated group. Plasma levels of ALT (A) and BUN (B) at 2 h and 6 h were converted to percentages assuming a value of 100% for basal data. Values are expressed as the mean S.D. (n = 10) percent of the initial value before LPS infusion. *P < 0.05 and **P < 0.01 as compared to the LPS group. Intense fibrin deposition was detected in most LPS-treated rabbits in kidney and liver. A high level of fibrin deposition was detected in most of the low-dose FIIa group, whereas a lower layer of fibrin deposition was detected in most of the medium-dose FIIa group. No fibrin deposition was detected in most of the high-dose FIIa group, little fibrin deposition was detected in most of the treated heparin group (C and D).
910
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
Fig. 3. The effect of FIIa on PAI-1 expression in TNF-a-treated HUVEC cells. Cells were incubated with 100 ng/ml TNF-a for 24 h and then were or not exposed to 2.5 ug/ml FIIa for an additional 24 h for ELISA assay (A) and for immunofluorescence assay (B) to evaluate PAI-1 protein expression. Results are the means SD (n = 3) for three repeats (**P < 0.01). Blots were representative of three independent experiments.
FIIa was able to up-regulate the t-PA gene expression of HUVEC cells as well as VEGF. In addition, we also found that FIIa also increased the u-PA protein (Fig. 4B, D) and mRNA level (Fig. 4F) as well as VEGF. These results demonstrated that FIIa stimulates the expression of t-PA and u-PA at transcriptional level in HUVEC cells. 3.6. FIIa activated protein C in vitro Protein C is converted to its active form (APC) when thrombin is bound to thrombomodulin (TM) on the endothelium and this activation is augmented by endothelial cell protein C receptor (EPCR) [25]. APC inactivated the cofactors Va and VIIIa and is an inhibitor of thrombin formation, which is the key mechanism underlying anticoagulant activity of APC [26]. In DIC patients, the lack of TM and EPCR lead to the disorder of protein C activation and thus aggratate microvascular thrombosis. In Fig. 5A, FIIa was shown to be able to activate protein C to APC in dose- and timedependent manner (P < 0.01) and APC concentration got to its maximum at 12.5 ug/ml after 90 min of FIIa exposure in vitro. The activated effect of FII on protein C at the dose of 2.5 ug/ml was significantly stronger than the Protac1, the positive activator of protein C [27]. RT-PCR assay showed that FIIa did not change the mRNA level of protein C in HUVEC cells (Fig. 5B). These results suggested that FIIa could directly activate protein C,but could not up-regulate protein C on the m-RNA level, thus it may be an important mechanism of FIIa against DIC caused by LPS in rabbits. 4. Discussion Disseminated intravascular coagulation (DIC) is a life-threatening syndrome caused by different reasons. Because there is no effective therapy for DIC, the clinical prognosis is poor and the mortality is high, up to 50–60% [28]. The recent studies are focus on the pathogenesis of DIC to gain better therapies for the patients with DIC. In this investigation LPS, which is a constituent of the outer membrane of the gram-negative bacteria, was used to induce DIC in rabbits. The induction of DIC leads to the generation of cytokines produced by monocytes and endothelial cells, which activate
coagulation and fibrinolytic pathways [29]. This study has shown that, the administration of LPS resulted in typical changes of DIC characterized by a significant decrease in the activities of plasminogen, ATIII, protein C, t-PA, platelets count, and fibrinogen concentration, extension in APTT, PT, and FDP, and a dramatic increase in PAI-1 activity, intense liver and kidney fibrin deposition. In the LPS-induced rabbits, we found that administering low-, medium-, and high-dose of FIIa improve the activities of protein C, plasminogen, ATIII, t-PA, PAI-1, and the concentration of fibrinogen (P < 0.05). It improved the platelets count, the APTT, PT and FDP. It could also decrease the mortality of animals treated with all 3 doses of FIIa at both 6 h and 24 h (P < 0.01). This dramatic benefit was further verified by a significant reduction in fibrin deposition observed in the histological liver and kidney tissue. Several naturally occurring systems, such as protein C system, antithrombin III (ATIII), act to attenuate the effects to a procoagulant state. Some complicated combinations activate Protein C, which is a plasma, vitamin K-dependent zymogen of a serine protease [30], which proteolytically inactivates factors Va and VIIIa, cofactors Xa and Ixa, respectively. The protein C anticoagulant pathway is a major mechanism in controlling microvascular thrombosis. ATIII is a plasma serine protease inhibitor that acts not only on thrombin, but has significant inhibitory on factors VIIa (in complex with tissue factor), Ixa, Xa, Xia, XIIa, kallikrein, and plasmin [31–33]. In addition to anticoagulant activity, FIIa is also related to the degradation of gelatin and collagen [34], whereas activated protein C can activate gelatinase A [35] In this study the improvements in protein C and ATIII activity by FIIa were remarkable among the changes observed in coagulation-related paramerters. Furthermore with increasing dosage of FIIa, the activity of protein C increased over baseline. The chief cause of protein C and ATIII deficiency in LPS-induced DIC is not a decrease in production but enhanced generation of thrombin [36] .We confirmed that FIIa only could activate protein C directly, however, it can not up-regulate protein C on m-RNA level. This evidence suggests that FIIa might have succeeded in enhancing the activity of protein C. Recent researches have shown activated protein C was a good therapy for DIC.
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
911
Fig. 4. The effect of FIIa on the protein and gene expression of t-PA and u-PA in HUVEC cells. Cells were incubated with 2.5 ug/ml FIIa for 24 h or 50 ng/ml VEGF for 24 h. The effect of FIIa and VEGF on t-PA (A) or u-PA (B) production of HUVEC cells. The effect of FIIa and VEGF on protein expression of t-PA (C) or u-PA (D). The effect of FIIa and VEGF on gene expression of t-PA (E) or u-PA (F). Results are the means SD (n = 3) for three repeats. Statistical differences compared with the controls are given as **, P < 0.01. Blots were representative of three independent experiments.
There is strong evidence that the fibrinolytic system is activated and reciprocally inhibited in septic and DIC patients. Plasmin is the central enzyme of fibrinolysis. It is formed from a precursor, plasminogen, by both tissue-type and urokinase-like plasminogen activators (t-PA and u-PA, respectively). Fibrin is cleaved into degradation products by plasmin, eliminating soluble fibrin from the circulation and solubilizing existing clots. Plasminogen activator inhibitor (PAI-1) is the principal inhibitor (PAI)-1 is the principal inhibitor of plasminogen activation and appears to be the most involved DIC. In the LPS-induced DIC rabbit model, FIIa did influence fibrinolysis concomitant with the changes in the activities of PAI-1, t-PA, and plasminogen. Such treatments with FIIa reduced liver and kidney microvasscular thrombosis induced by LPS. In addition, FIIa not only up-regulated the expression of tPA and u-PA on the m-RNA level as VEGF, but also down-regulated the expression of PAI-1 directly. FIIa degraded fibrin without activating the plasminogen by our previous work [18]. Protein C has a secondary antithrombotic action by forming comolexes with PAI-1 to prevent its inhibition of fibrinolysis [34], and the activity of protein C was found to be enhanced by FIIa in vivo and directly
activaed protein C in vitro. Therefore, the improvement in the activities of t-PA and PAI-1 by FIIa could be partly explained by the enhanced and activity of protein C. It seems likely that FIIa might stimulate the production of plasminogen in vivo and in vitro. Additional work is needed to assess this issue. In this study, FIIa reduced the mortality caused by LPS-induced DIC. DIC has widespread effect on blood coagulation activated, which results in the intravascular formation of fibrin. This process may lead to thrombotic occlusion of small and mid-sized vessels that contribute to multiple organ failure. These vessels have been considered as important causes of DIC death. Furthermore, protein C also plays a role in pathogenesis of microthrombosis. In the light of our data, FIIa not only degrades fibrinogen and dissolves the microvascular thrombosis in vivo, but it may also enhance the activity of protein C. These findings suggest that FIIa can have a benefit in improving LPS-induced DIC by degrading fibrinogen and enhancing the activity of protein C. In addition, FIIa diminished the values of FDP, APTT, PT and ameliorated the concentration of frinogen and platelets in LPS-induced DIC rabbits. These effects mainly were ascribed to the activity of FIIa degrading directly
912
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
Fig. 5. The effect of FIIa on protein C activity and gene expression. 20 umol protein C was incubated with different dose FIIa and 1 U/ml protac respectively for 30, 60, 90 and 120 min in vitro and then the concentration of APC was measured. FIIa activated protein C to APC in time- and dose-dependent manner (A). HUVEC cells were incubated with 2.5 ug/ml and 50 ng/ml VEGF respectively for 24 h and then were subjected to RT-PCR analysis (B). Results are the means SD (n = 3). Statistical differences compared with the controls are given as **,##, ~~, , , !!, P < 0.01. Blots were representative of three independent experiments.
microthrombi without activation of plasminogen and reducing the consumption of coagulation factors, which suggested that FII may effectively improve the bleeding induced by DIC. Therefore our findings may provide to FIIa beneficial property compared with heparin and other anticoagulant drugs in use clinically. In summary, FIIa was able to protect significantly against LPSinduced DIC and DIC-induced organ dysfunction. The protective effect was likely due to the direct activation of protein C, the increased expression of t-PA and u-PA, and the inhibition of cytokines-induced PAI-1 production. Our data supported the hypothesis that FIIa is developed to be a novel candidate in the treatment of DIC, and therefore it appears to be an attractive strategy for DIC therapy. More work is needed to develop this valuable drug. Acknowledgments Project supported by the National Natural Science Foundation of China(No 81000209), the key Project of Chinese Ministry of Education (NO. 210255), and the Fundamental Research for the Central Universities (NO. 21609304)
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.bcp.2012.06.011.
References [1] Vercellotti GM, Wickham NW, Gustafson KS, Yin HQ, Hebert M, Jacob HS. Thrombin-treated endothelium primes neutrophil functions: inhibition by platelet-activating factor receptor antagonists. J Leukoc Biol 1989;45(6): 483–90. [2] Robboy SJ, Major MC, Colman RW, Minna JD. Pathology of disseminated intravascular coagulation (DIC). Analysis of 26 cases. Hum Pathol 1972;3(3):327–43. [3] Taylor Jr FB, Toh CH, Hoots WK, Wada H, Levi M. Towards definition, clinical and laboratory criteria, and a scoring system for disseminated intravascular coagulation. Thromb Haemost 2001;86(5):1327–30. [4] Levi M, de Jonge E, ten CH. Disseminated intravascular coagulation. Ned Tijdschr Geneeskd 2000;144(10):470–5. [5] Levi M. Disseminated intravascular coagulation: what’s new? Crit Care Clin 2005;21(3):449–67. [6] Rubin RN, Colman RW. Disseminated intravascular coagulation. Approach to treatment. Drugs 1992;44(6):963–71. [7] Hardaway RM, Williams CH, Sun Y. A new approach to the treatment of experimental septic shock. J Surg Res 1996;61(2):311–6. [8] Vervloet MG, Thijs LG, Hack CE. Derangements of coagulation and fibrinolysis in critically ill patients with sepsis and septic shock. Semin Thromb Hemost 1998;24(1):33–44. [9] Asakura H, Jokaji H, Saito M, Uotani C, Kumabashiri I, Morishita E, et al. Study of the balance between coagulation and fibrinolysis in disseminated intravascular coagulation using molecular markers. Blood Coagul Fibrinolysis 1994;5(5): 829–32. [10] Ouriel K. Comparison of safety and efficacy of the various thrombolytic agents. Rev Cardiovasc Med 2002;3(Suppl 2):17–24. [11] Fourrier F, Jourdain M, Tournoys A, Gosset P, Mangalaboyi J, Chopin C. Effects of a combined antithrombin III and protein C supplementation in porcine acute endotoxic shock. Shock 1998;10(5):364–70. [12] Feinstein DI. Diagnosis and management of disseminated intravascular coagulation: the role of heparin therapy. Blood 1982;60(2):284–7.
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913 [13] Lehmann C, Usichenko TI, Pavlovic D. Heparins in sepsis-induced disseminated intravascular coagulation: low weight-high impact? Crit Care Med 2005;33(6):1455–7. [14] Freeman BD, Zehnbauer BA, Buchman TG. A meta-analysis of controlled trials of anticoagulant therapies in patients with sepsis. Shock 2003;20(1): 5–9. [15] Shimamura K, Oka K, Nakazawa M, Kojima M. Distribution patterns of microthrombi in disseminated intravascular coagulation. Arch Pathol Lab Med 1983;107(10):543–7. [16] Fay WP, Garg N, Sunkar M. Vascular functions of the plasminogen activation system. Arterioscler Thromb Vasc Biol 2007;27(6):1231–7. [17] de Fouw NJ, de Jong YF, Haverkate F, Bertina RM. Activated protein C increases fibrin clot lysis by neutralization of plasminogen activator inhibitor—no evidence for a cofactor role of protein S. Thromb Haemost 1988;60(2):328–33. [18] Xiuxia L, Jiashu C, Yingna Z, Pengxin Q, Guangmei Y. Purification and biochemical characterization of F II(a), a fibrinolytic enzyme from Agkistrodon acutus venom. Toxicon 2001;39(8):1133–9. [19] Hermida J, Montes R, Paramo JA, Rocha E. Endotoxin-induced disseminated intravascular coagulation in rabbits: effect of recombinant hirudin on hemostatic parameters, fibrin deposits, and mortality. J Lab Clin Med 1998;131(1): 77–83. [20] Lin X, Liang XX, Chen JS, Chen Q, Qiu PX, Yan GM. The effect of fibrinolytic enzyme FIIa from Agkistrodon acutus venom on disseminated intravascular coagulation in rabbits. Transl Res 2007;150(5):295–302. [21] Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest 1973;52(11):2745–56. [22] Elsayed YA, Nakagawa K, Ichikawa K, Ohkawara S, Sueishi K. Expression of tissue factor and interleukin-1 beta in a novel rabbit model of disseminated intravascular coagulation induced by carrageenan and lipopolysaccharide. Pathobiology 1995;63(6):328–40. [23] Levi M, ten CH, van der Poll T, van Deventer SJ. Pathogenesis of disseminated intravascular coagulation in sepsis. JAMA 1993;270(8):975–9. [24] Liu Y, Wang C, Yang Y, Hou X, Wang J. Pro-urokinase up-regulates the expression of urokinase-type plasminogen activator (u-PA) in human pulmonary arterial endothelial cells. Thromb Res 2008;121(4):485–91.
913
[25] Taylor Jr FB, Peer GT, Lockhart MS, Ferrell G, Esmon CT. Endothelial cell protein C receptor plays an important role in protein C activation in vivo. Blood 2001;97(6):1685–8. [26] Marlar RA, Endres-Brooks J, Miller C. Serial studies of protein C and its plasma inhibitor in patients with disseminated intravascular coagulation. Blood 1985;66(1):59–63. [27] Gable PS, Le DT, McGehee W, Rapaport SI. A protac-based screening test for activated protein C-resistant factor Va and other defects of the protein C anticoagulant pathway. Blood Coagul Fibrinolysis 1997;8(6):327–35. [28] Kowalik MM, Smiatacz T, Hlebowicz M, Pajuro R, Dziarmaga-Piasecka N, Gesing M, et al. Occurrence of disseminated intravascular coagulation in purulent meningitis and influence on mortality in 118 patients. Przegl Epidemiol 2006;60(2):281–9. [29] Warr TA, Rao LV, Rapaport SI. Disseminated intravascular coagulation in rabbits induced by administration of endotoxin or tissue factor: effect of anti-tissue factor antibodies and measurement of plasma extrinsic pathway inhibitor activity. Blood 1990;75(7):1481–9. [30] Walker FJ, Fay PJ. Regulation of blood coagulation by the protein C system. FASEB J 1992;6(8):2561–7. [31] Mammen EF. Antithrombin: its physiological importance and role in DIC. Semin Thromb Hemost 1998;24(1):19–25. [32] Rao LV, Rapaport SI, Hoang AD. Binding of factor VIIa to tissue factor permits rapid antithrombin III/heparin inhibition of factor VIIa. Blood 1993;81(10):2600–7. [33] Rao LV, Nordfang O, Hoang AD, Pendurthi UR. Mechanism of antithrombin III inhibition of factor VIIa/tissue factor activity on cell surfaces. Comparison with tissue factor pathway inhibitor/factor Xa-induced inhibition of factor VIIa/ tissue factor activity. Blood 1995;85(1):121–9. [34] Wang QQ, Chen JS, Liang XX, Qiu PX, Wang YW, Yan GM. Hemorrhagic activity and mechanism of FIIa, a fibrinolytic enzyme from Agkistrodon acutus venom. Acta Pharmacol Sin 2004;25(4):514–21. [35] Nguyen M, Arkell J, Jackson CJ. Activated protein C directly activates human endothelial gelatinase A. J Biol Chem 2000;275(13):9095–8. [36] Taylor Jr FB, Chang A, Esmon CT, D’Angelo A, Vigano-D’Angelo S, Blick KE. Protein C prevents the coagulopathic and lethal effects of Escherichia coli infusion in the baboon. J Clin Invest 1987;79(3):918–25.
Contents lists available at SciVerse ScienceDirect
Biochemical Pharmacology journal homepage: www.elsevier.com/locate/biochempharm
A novel fibrinogenase from Agkistrodon acutus venom protects against DIC via direct degradation of thrombosis and activation of protein C Jie-zhen Qi a,1, Xi Lin b,1,**, Jia-shu Chen a,*, Zhen-hua Huang a, Peng-xin Qiu a, Guang-mei Yan a a b
Department of Pharmacology, Zhongshan Medical College, SUN Yat-Sen University, Guangzhou 510080, China Department of Pharmacology, Medical College, Ji-nan University, Guangzhou 510632, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 April 2012 Accepted 13 June 2012 Available online 20 June 2012
The incidence of disseminated intravascular coagulation (DIC), which leads to multiple organ dysfunction and high mortality, has remained constant in recent years. At present, treatments of DIC have focused on preventing cytokine induction, inhibiting coagulation processes and promoting fibrinolysis. Recent clinical trials have supported the use of antithrombin and activated protein C supplementation in DIC. To better understand the mechanism of treatment on DIC, we here report a novel fibrinogenase from Agkistrodon acutus (FIIa) that effectively protected against LPS-induced DIC in a rabbit model, and detected the tissue factors expression in HUVE cells after using FIIa. In vivo, administration of FIIa reduced hepatic and renal damage, increased the concentration of fibrinogen, the activities of protein C, the platelet count, APTT, PT, FDP, the level of AT-III and t-PA, decreased the level of PAI-1, and increased survival rate in LPS-induced DIC rabbits. In vitro experiments, we further confirmed that FIIa up-regulated the expression of t-PA and u-PA, down-regulated the expression of PAI-1, and directly activated protein C. Our findings suggest that FIIa could effectively protect against DIC via direct degradation of microthrombi and activation of protein C as well as provide a novel strategy to develop a single proteinase molecule for targeting the main pathological processes of this disease. Crown Copyright ß 2012 Published by Elsevier Inc. All rights reserved.
Keywords: DIC Fibrinogenase Lipopolysaccharide Microthrombi Protein C
1. Introduction Disseminated intravascular coagulation (DIC) is an acquired syndrome characterized by the activation of intravascular coagulation and subsequent intravascular fibrin formation. This process may be accompanied by secondary fibrinolysis, which often leads to a bleeding tendency, or deficient fibrinolysis [1,2], which can cause diffuse microthrombi formation in the organs, severe cases can lead to multiple organ function failure and finally death [3]. DIC is a life threatening syndrome arising from various causes including disseminated sepsis. It is generally associated with an
Abbreviations: APC, activated protein C; APTT, activated partial thromboplastin time; AT-III, antithrombin III; DIC, disseminated intravascular coagulation; EGF, endothelial growth factor; FDP, fibrin(-ogen) degradation products; FIIa, fibrinogenase II from Agkistrodon acutus; HUVECs, human umbilical vein endothelial cells; LPS, Lipopolysaccharide; PAI-1, plasminogen activator inhibitor-1; PT, plasma prothrombin time; t-PA, tissue-type plasminogen activators; TNF-a, tumor necrosis factor-a; u-PA, urokinase-like plasminogen activators; VEGF, vascular endothelial growth factor. * Corresponding author. Tel.: +86 20 87330553; fax: +86 20 87330553. ** Co-corresponding author. Tel.: +86 20 85220242; fax: +86 20 85228865. E-mail addresses: [email protected] (X. Lin), [email protected] (J.-s. Chen). 1 These two authors contributed equally to this article.
adverse outcome [4,5]. If severe or life-threatening hemorrhage occurs, replacement with platelets, fresh plasma, and possibly cryoprecipitate, is indicated [6], but the intravascular fibrin formation and organ dysfunction are often irreversible by the fact that the timing of therapy is crucial. The standard anticoagulant therapy such as heparin and low molecular weight heparin is thought to enhance the effects of thrombolysis by preventing formation of new fibrin in organs. Thus far, however, there is no indication from clinical studies that anticoagulation offers any survival benefit in patients with DIC. Another therapeutical choice in treating DIC is to administer plaminogen activators(t-PA, u-PA) to induce fibrinolysis of existing and developing clots. Experimental studies with u-PA have shown modest effects [7]. Plasminogen activator inhibitor(PAI)-1 is the principal inhibitor of plasminogen activation and appears to be the most involved in DIC [8,9]. Increased PAI-1 has been associated with a predisposition to thrombosis, which is a specific inhibitor of t-PA released from endothelial cells. These conditions may ‘‘overflow’’ the systemic circulation that leads to systemic fibrinolysis and degradation of other clotting proteins [10], increases the bleeding tendency. Combination therapy with multiple anticoagulatory agents may ultimately prove to be the best approach for treating DIC. One recent study found that combining ATIII and protein C-supplement therapy reduced TNF-a levels and hypotension associated with
0006-2952/$ – see front matter . Crown Copyright ß 2012 Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.bcp.2012.06.011
906
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
endotoxin-induced experimental sepsis, though no effect on coagulation parameters was evident [11]. Recombinant human activated protein C has shown efficacy in decreasing mortality in patients with sepsis accompanied with DIC, but it is not clear to which extent this benefit is caused by amelioration of DIC. Many therapeutic avenues are being developed based on recent findings into the causes and progression of DIC, but really no effective therapy available [12–14]. FIIa is a noval fibrinolytic enzyme purified from Agkistrodon acutus venom, which is belonged to the snake vemon metalloproteinase family. The crystal structure of FIIa features that it has a Zn2+ ion in the active site which is essential for hydrolytic activity [15,16]. In vitro FIIa directly degrades a-chains and b-chains of fibrin/fibrinogen, whereas in vivo studies show it dissolves thrombus without activating plasminogen or influencing the activities of t-PA, urokinase, and PAI-1 [17]. This shows that FIIa has a different mechanism of action from t-PA and urokinase. Additionally, in the examination of tissue sections from kidney, liver, heart, and lung [17], the thrombolytic activities of FIIa lacked hemorrhaging. These results suggest that FIIa should be a safe and attractive agent for treating DIC. To better understand the effect of FIIa, which may be a potential clinical use in DIC, here we report the activity of FIIa on a lipopolysaccharide (LPS)-induced model of DIC and investigated the mechanism of its action in laboratory. 2. Materials and methods 2.1. Reagents LPS, heparin, and human fibrinogen (95% clottable) were purchased from Sigma (St. Louis, Mo). The fibrinogen concentration determination reagent pack (Clauss method) and the reagent packs for the activity assays of antithrombin III (ATIII), protein C, plasminogen, PAI-1, and t-PA were obtained from Sun Biotechnology Company (Shanghai, China); The human t-PA ELISA kit and the human u-PA ELISA kit were purchased from ASSAYPRO (USA). The human PAI-1 ELISA kit, the human recombined TNF-a and its antibody, the VEGF, the t-PA antibody and the u-PA antibody were purchased from R&D systems, Inc (USA). The protein C and EGF were purchased from abcam (USA), and the human APC ELISA kit was from USCN LIFE (USA); all other reagents were analytical grade from commercial sources. 2.2. Animals Adult male New Zealand white rabbits (weight 2–3 kg) were supplied by the Experimental Animal Center of Guangdong Province. 2.3. Purification of the enzyme The fibrinogenase II(FIIa) isolated from Agkistrodon acutus vemon, was prepared according to the method previously described [18]. 2.4. Experiments in vivo 2.4.1. Experimental animal models All procedures were conducted according to the ethical guidelines of the Animal Care and Use Committee at SUN Yat-Sen University. DIC experimental models were performed by the method of Jose Hermida [19], which were induced by infusing LPS in 60 ml of saline solution at a rate of 100 mg/kg/h (10 ml/h) through the marginal ear vein of rabbits over a period of 6 h. Animals were anesthetized by an intramuscular injection of 30 mg/kg ketamine
hydrochloride, followed by intramuscular supplements of ketamine hydrochloride given throughout the experiment. Treatments, which were according to the method of Lin [20], started simultaneously with LPS infusion through the contralateral marginal ear vein. Six different groups were established, one of which contains 10 animals: treatment groups (low-, medium-, and high-dose FIIa) were given 0.1, 0.3 and 0.6 mg/kg/h in 60 ml of saline solution over a period of 6 h (10 ml/h). The LPS control group was infused with saline solution, which was at a rate of 10 ml/h, over a period of 6 h. The heparin control group was infused with heparin at a rate of 100 IU/kg/h (10 ml/h) over a period of 6 h. The normal control group, which was given neither LPS nor FIIa, was infused with saline solution through both marginal ear veins of the animals. 2.4.2. Sample collection and handling Blood samples were taken through a catheter inserted into a femoral artery immediately before LPS infusion and at 2 and 6 h postinfusion. Blood samples were collected in 3.8% sodium citrate (1:10 vol/vol citrate/blood). The blood was centrifuged at 2000 g for 15 min at 4 8C. Blood for the measurement of t-PA was collected in Stabilyte tubes (Biopool, Umea, Sweden) in order to avoid the interference with its inhibitors. All samples were stored at 70 8C until assayed. 2.4.3. Laboratory methods Fibrinogen consentration was measured according to the method of Clauss. ATIII, protein C, plasminogen, PAI-1, and t-PA activity were measured according to the reagent pack instruction based on chromogenic substrates. 2.4.4. Tissue preparation for histologic examination Kidney, liver tissue specimens were fixed in formalin, embedded in paraffin, stained with phosphotungstic acid-hematoxylin stain, and examined for the presence of fibrin microthrombi by a pathologist. 2.5. Experiments in vitro 2.5.1. Human umbilical vein endothelial cells (HUVEC) cultures Primary HUVEC were isolated from normal umbilical cords as described by Jaffe EA [21]. HUVEC were cultured in Medium 199 (Gibco BRL, Grand Island, NY, USA) containing 20% fetal bovine calf serum (Hyclone, Logan, UT, USA), endothelial growth supplement (Sigma, St. Louis, MO, USA), 5% penicillin/streptomycin (Gibco BRL), and 25 ug/ml heparin (Sigma), and 50 ng/ml ECGs (abcam). For assays, HUVEC were plated at a concentration of 1 105 cell/ ml and grown for 24 h with a humidified atmosphere of 5% CO2 at 37 8C prior to experimentation. All experiments utilized cells grown within five passages. In the following experiments, the concentration of FIIa is 2.5 mg/ml and the density of HUVEC is 1 105/well. 2.5.2. The action of FIIa on TNF-a-induced PAI-1 cell model 2.5.2.1. Observation of PAI-1 protein by immunofluorescence. Four different groups were established, control group was given M199 only. The positive group was given TNF-a (100 ng/ml), meanwhile the treatment group was given TNF-a (100 ng/ml) and FIIa. The fourth group was only given FIIa. The protocol of immunofluorescence is the same as the above describe, except that the primer antibody is PAI-1 antibody. 2.5.2.2. Measurement of PAI-1 concentration by ELISA assays. The concentration of PAI-1 in the supernatant was determined using Human Serpin E1/PAI-1 ELISA kit (R & D systems, USA), according to the assay procedures.
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
2.5.2.3. Measurement of PAI-1 mRNA level by RT-PCR. Cells were harvested in TRIzol reagent (Sigma), and the recommended protocol was followed to extract total RNA. RNA was quantified using SmartSpecTM 3000(BIO-RAD, USA), reversely transcribed using SuperscriptTM III reverse transcriptase (GibcoBRL, USA), and cDNA was then subjected to PCR using GoTaq1 Green Master Mix (Promega, USA). cDNA was used for PCR, and the primer sequences of PAI-1 are: 50 GTCTGCTGTGCACCATCCCCCATC30 (sense primer), 50 -TTGTCATCAATCTTGAATCCCATA-30 (antisense primer). The primer sequences of GAPDH are the same as the above describe. Conditions for the PCR reaction were: template denaturation at 94 8C for 45 s; primer annealing at 60 8C for 45 s; primer extension at 72 8C for 45 s for 28 cycles, and an additional 5 min extension at 72 8C to complete the reaction. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized with ethidium bromide staining. 2.5.3. The actions of FIIa on t-PA and u-PA 2.5.3.1. Observation of t-PA and u-PA protein by immunofluorescence. Briefly, three different groups were established, containing two wells each, control group was given M199 only. The treatment group was given FIIa, meanwhile the positive group was given VEGF (50 ng/ml). All cells were incubated for 24 h. Attached cells treated by different reagents were rinsed with phosphate-buffered saline (PBS) prior to fixation in 4% (v/v) paraform for 20 min and then permeabilized with 0.5% (v/v). Triton X-100 in PBS for 20 min. Cells, which were added primary antibody: t-PA antibody and u-PA antibody respectively, were incubated with 5% (v/v) BSA for 30 min to block non-specific binding sites before incubation for 24 h at 4 8C. Then cells were rinsed in PBS and incubated with the secondary antibody in the dark for 45 min (fluorescein isothiocyanate-conjugated goat anti-mouse IgG, 1:150 in PBS). Cells were then gently rinsed and examined with Zeiss (Carl Zeiss Microimaging, Thornwood, NY) confocal laser-scanning microscope (LSCM). 2.5.3.2. Measurement of t-PA and u-PA concentration by ELISA assays. The concentration of t-PA and u-PA in the supernatant was determined using Human Tissue – Type Plasminogen Activator ELISA kit and Human Urokinase ELISA kit (ASSAYPRO, USA) respectively, according to the assay procedures.
907
2.5.4. The action of FIIa on protein C 2.5.4.1. Measurement of protein C activity by ELISA assays. 0.1 u mol human recombined protein C (abcam) was dissolved in 5 ml buffer (0.038 mol/l NaCL, 0.01% Tween 80 and PH 7.4, 0.05 mol/l Tris– HCL) and incubated with 0.1, 0.5, 2.5, 12.5ug/ml FII for 30, 60, 90, 120 min respectively at 37 8C in vitro. Protac1 was the positive control. APC concentration was measured by Human activated protein C, APC ELISA kit (USCN LIFE, USA). 2.5.4.2. Measurement of protein C mRNA level by RT-PCR. Three different groups were established, control group was given M199 only. The positive groups was given Protac1 (50 ng/ml), and the treatment group was given FIIa. Cells were harvested in TRIzol reagent (Sigma), and the recommended protocol was followed to extract total RNA. RNA was quantified using SmartSpecTM 3000(BIO-RAD, USA), reversely transcribed using SuperscriptTM III reverse transcriptase (Gibco-BRL, USA), and cDNA was then subjected to PCR using GoTaq1 Green Master Mix (Promega, USA). cDNA was used for PCR, and the primer sequences of protein C are: 50 -CAGGCTTGGAGAGTATGAC-30 (sense primer), 50 -ATGAAGTTGAGGACGAAGG-30 (antisense primer). Conditions for the PCR reaction were: template denaturation at 94 8C for 45 s; primer annealing at 60 8C for 45 s; primer extension at 72 8C for 45 s for 28 cycles, and an additional 5 min extension at 72 8C to complete the reaction. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized with ethidium bromide staining. 2.6. Data analysis Differences between data groups were evaluated for significance using Student t-test of unpaired data or one-way analysis of variance. Repeated measures analysis of variance was used for multivariate analysis. Data are presented as mean SD of three separate experiments. Data in Table 1 at 2 and 6 h were converted to percentages, with a value of 100% assumed for basal data. Survival curves of LPS-induced DIC were analyzed by the Kaplan–Meyer logrank test. A result with a P value of < 0.05 was considered statistically significant. 3. Results 3.1. FIIa decreased the mortality of LPS-induced DIC rabbits
2.5.3.3. Measurement of t-PA and u-PA mRNA level by RT-PCR. Cells were harvested in TRIzol reagent (Sigma), and the recommended protocol was followed to extract total RNA. RNA was quantified using SmartSpecTM 3000(BIO-RAD, USA), reversely transcribed using SuperscriptTM III reverse transcriptase (GibcoBRL, USA), and cDNA was then subjected to PCR using GoTaq1 Green Master Mix (Promega, USA). cDNA was used for PCR, and the primer sequences are as follows: t-PA:50 -CAGGCTGACGTGGGAGTACTG-30 (sense primer), 50 CTCCTGTGCTTGGCAAAGATG-30 (antisense primer); u-PA: 50 -ATCTGCCTGCCCTCGATGTATAAC-30 (sense primer) 50 -ATTCCAGTCAAAGTCATGCGGCCT-30 (antisense primer) GAPDH: 50 -CCACCCATGGCAAATTCCATGGCA-30 (sense primer) 50 -TCTAGACGGCAGGTCAGGTCCACC-30 (antisense primer).
We firstly investigated the protective effect of FII in the LPSinduced DIC model in rabbits, a clinically relevant model for human DIC [22,23]. FII treatment was started simultaneously with LPS induction of DIC. Six of the 10 rabbits in the LPS group died within the first 6 h and 9 died within 24 h. Two of the 10 rabbits in the low-dose FII group died within the first 6 h and 7 died within 24 h. However, none of the 10 rabbits in the medium- and highdose groups died within the first 6 h, whereas 5 died within 24 h in the medium-dose FII group, and 4 died within 24 h in the highdose FII group. The mortality rates in the low-, medium- and highdose groups were significantly lower than in the LPS group at both 6 h (Fig. 1A) and 24 h (Fig. 1B) (P < 0.01). These data suggested that FIIa was capable of protecting against LPS-induced DIC. 3.2. FIIa improved the hemostatic parameters in LPS-induced DIC rabbits
Conditions for the PCR reaction were: template denaturation at 95 8C for 30 s; primer annealing at 55 8C for 30 s; primer extension at 72 8C for 45 s for 32 cycles, and an additional 5 min extension at 72 8C to complete the reaction. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized with ethidium bromide staining.
Two-hour post-intravenous injection of LPS (100 mg/kg/h) into rabbits caused a significant decrease in the concentration of fibrinogen and the activities of protein C, ATIII, plasminogen, and t-PA (P < 0.05, compared with the saline solution group). However, PAI-1 activity increased under similar experimental conditions
Heparin
0.6 mg/kg FII
0.3 mg/kg FII
0.1 mg/kg FII
LPS
2h 6h 2h 6h 2h 6h 2h 6h 2h 6h 2h 6h Normal
*P < 0.05 and #P < 0.01 as compared to the LPS-treated group. Data are presented as the mean S.D. LPS: infusion of 0.1 mg/kg/h LPS for 6 h. 0.1 mg/kg FIIa: simultaneous infusion of 0.1 mg/kg/h LPS and 0.1 mg/kg FIIa. 0.3 mg/kg FIIa: simultaneous infusion of 0.1 mg/kg/h LPS and 0.3 mg/kg FII. 0.6 mg/kg FIIa: simultaneous infusion of 0.1 mg/kg/h LPS and 0.6 mg/kg FIIa. Heparin: simultaneous infusion of 0.1 mg/kg/h LPS and 100 IU/kg/h heparin.
101.64 14.53# 99.21 10.92# 64.15 17.58 46.76 18.65 96.32 29.97# 107.02 32.38# 90.05 36.47# 94.39 30.99# 104.45 32.68# 109.21 33.92# 80.36 20.67# 76.19 26.57#
102.73 7.09# 105.36 9.27# 230.18 40.56 262.17 44.27 171.63 29.50# 154.21 23.29# 130.41 25.99# 108.06 31.43# 110.18 28.36# 109.73 26.74# 150.31 24.62# 124.98 29.04#
T-PA (%)
98.14 8.78# 101.21 10.32# 53.12 17.25 40.85 12.01 87.62 21.46# 93.51 23.72v 106.45 30.47# 120.86 27.16# 108.16 24.63# 133.89 23.74# 83.17 19.26# 81.14 17.98# <0.05# <0.05# 74.3 20.16 95.24 26.48 36.36 12.41# 30.58 13.62# 34.45 16.24# 24.59 12.03# 27.97 14.68# 72.35 23.16 36.99 14.52# 26.37 11.61#
99.12 6.21* 101.36 7.72# 84.17 18.32 52.18 23.11 94.62 7.73 93.13 12.14# 97.41 6.23 98.26 10.64# 99.56 5.73* 101.46 4.89# 83.41 14.57 84.68 7.06#
Protein C (%) FDP
4.04 1.02 4.14 1.59# 3.74 1.13 1.68 0.52 3.93 1.38 2.64 0.81# 3.97 1.29 3.56 0.83# 4.02 1.48 2.15 0.84 4.01 1.64 2.76 1.14# 440.24 20.78# 462.13 47.09# 330.61 43.28 163.26 26.56 360.15 53.48 223.72 55.14# 386.87 43.91* 283.92 28.67# 410.25 52.24# 330.47 29.38# 373.76 25.92# 290.11 19.16# 6.87 1.16 7.01 0.84# 12.39 4.06 20.54 5.12 9.42 3.29 12.67 5.14# 8.83 2.51* 10.24 2.82# 8.42 1.73# 9.69 2.45# 9.15 1.38* 11.83 1.19# 13.14 2.01 14.29 1.89# 24.62 5.42 38.38 8.31 19.94 4.53 30.35 6.20* 18.20 3.41* 26.71 4.87# 16.62 2.75# 26.36 4.01# 16.82 2.41# 27.95 4.62#
Time (h) Goups
APTT (s)
#
PT (s)
#
Platelets (*109/l)
Fibrinogen (g/l)
AT-III (%)
PAI-1 (%)
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913 Table 1 Hemostatic parameters 2 and 6 h after LPS infusion into rabbits in normal, LPS-treated, FIIa-treated and heparin-treated groups. Plasma levels of activated partial thromboplastin time (APTT), prothrombin time (PT), platelet count, fibrinogen, fibrin and degradation product (FDP) were shown. Plasma levels of protein C, AT-III, t-PA and PAI-1 were converted to percentages with a value of 100% assumed for basal data.
908
(P < 0.05). At 6 h postinjection, fibrinogen concentration and the activities of protein C, plasminogen, t-PA, an ATIII decreased (P < 0.05), whereas PAI-1 activity increased (P < 0.05, Table 1), which is consistent with the data obtained at 2 h. We found that infusion of a low, medium, and high dose of FIIa ameliorated the activities of protein C, ATIII, plasminogen, FDP, and PAI-1 at 2 h when compared with LPS control group (P < 0.05). Sixhour measurements made at all doses of infused FIIa showed a significant increase in the activities of protein C, plasminogen, t-PA, FDP, and ATIII (P < 0.01), whereas PAI-1 activity decreased (P < 0.05). Low and medium doses of FIIa also ameliorated fibrinogen concentration. The activities of protein C and plasminogen were increased at the high-dose FIIa group (P < 0.01, Table 1), compared with the saline control group. 3.3. FII reduced the hepatic and renal damage in LPS-induced DIC rabbits Two-hour and six-hour post-intravenous injection of LPS (100 mg/kg/h) into rabbits caused a significant increase in plasma levels of alanine aminotransferase (ALT) (an indicator of liver injury), and BUN (an indicator of renal injury), compared with the saline group. However, we found that infusion of a low, medium, and high dose of FIIa the levels of ALT and BUN were significantly decreased, which was also demonstrated in heparin treatment (Fig. 2A and B). Intense fibrin deposition was detected in most LPStreated rabbits in kidney and liver. A high level of fibrin deposition was detected in most of the low-dose FIIa group, whereas a lower level of fibrin deposition was detected in most of the medium-dose FIIa group. No fibrin deposition was detected in most of the highdose FIIa group, little fibrin deposition was detected in most of the treated heparin group (Fig. 2C and D). These findings indicated that FIIa was able to ameliorated hepatic and renal injury after injection of LPS. 3.4. FIIa down-regulated the expression of PAI-1 in TNF-a-induced cells FIIa did not decrease the cell number at the concentration of 0.1 ug/ml to 2.5 ug/ml (Supplementary Fig. 1A). Nevertheless, FIIa exhibited little cytotoxic effect on HUVEC cells from 0.5 ug/ml to 62.5 ug/ml in dose-dependent fashion (Supplementary Fig. 1B). Therefore, FIIa at the concentration of 2.5 ug/ml, was employed in the following experiments design. The result of ELISA kit assay showed that FIIa inhibited the PAI-1 secretion stimulated by TNFa, but FIIa alone caused no effect on the production of PAI-1 in HUVEC cells (Fig. 3A). To further determine the inhibitory effect of FIIa on PAI-1 production induced by TNF-a, We performed the immunofluorescence assay and analyzed the expression of PAI-1 in HUVEC cells. As Fig. 3B shown, TNF-a treatment exhibited the higher expression of PAI-1 than the control and FIIa suppressed the up-regulation induced by TNF-a, which was consistent with human PAI-1 ELISA assay. 3.5. FIIa stimulates the expression of t-PA and u-PA at transcriptional level in HUVEC cells T-PA and u-PA catalyze the conversion of plasminogen to plasmin and are important drugs in the treatment of thromboembolic disease such as DIC [24]. During DIC vascular endothelial cells are suffered from inflammatory damage and thus reduce the secretion of t-PA and u-PA. To further detect the reason why FIIa blocked the reduction in t-PA concentration in LPS-induced DIC rabbits, we first observed the effect of FIIa on t-PA protein level in HUVEC cells. As shown in Fig. 4A, C, FIIa increased the production and protein expression of t-PA. RT-PCR assay demonstrated that
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
909
Fig. 1. FIIa decreased the mortality of LPS-induced DIC induced rabbits. 0.1, 0.3, 0.6 mg/kg FIIa and 100 IU/kg heparin were administered simultaneously with LPS by intravenous injection. Survival rate was monitored at 6 h (A) and 24 h (B) after LPS infusion.
Fig. 2. FIIa attenuated the hepatic and renal injury in LPS-induced DIC rabbits. Blood samples were taken immediately in the normal group (before LPS infusion), the LPStreated group (at 2 h and 6 h after the infusion), the FIIa-treated group (low-, medium-, and high-dose) and the heparin-treated group. Plasma levels of ALT (A) and BUN (B) at 2 h and 6 h were converted to percentages assuming a value of 100% for basal data. Values are expressed as the mean S.D. (n = 10) percent of the initial value before LPS infusion. *P < 0.05 and **P < 0.01 as compared to the LPS group. Intense fibrin deposition was detected in most LPS-treated rabbits in kidney and liver. A high level of fibrin deposition was detected in most of the low-dose FIIa group, whereas a lower layer of fibrin deposition was detected in most of the medium-dose FIIa group. No fibrin deposition was detected in most of the high-dose FIIa group, little fibrin deposition was detected in most of the treated heparin group (C and D).
910
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
Fig. 3. The effect of FIIa on PAI-1 expression in TNF-a-treated HUVEC cells. Cells were incubated with 100 ng/ml TNF-a for 24 h and then were or not exposed to 2.5 ug/ml FIIa for an additional 24 h for ELISA assay (A) and for immunofluorescence assay (B) to evaluate PAI-1 protein expression. Results are the means SD (n = 3) for three repeats (**P < 0.01). Blots were representative of three independent experiments.
FIIa was able to up-regulate the t-PA gene expression of HUVEC cells as well as VEGF. In addition, we also found that FIIa also increased the u-PA protein (Fig. 4B, D) and mRNA level (Fig. 4F) as well as VEGF. These results demonstrated that FIIa stimulates the expression of t-PA and u-PA at transcriptional level in HUVEC cells. 3.6. FIIa activated protein C in vitro Protein C is converted to its active form (APC) when thrombin is bound to thrombomodulin (TM) on the endothelium and this activation is augmented by endothelial cell protein C receptor (EPCR) [25]. APC inactivated the cofactors Va and VIIIa and is an inhibitor of thrombin formation, which is the key mechanism underlying anticoagulant activity of APC [26]. In DIC patients, the lack of TM and EPCR lead to the disorder of protein C activation and thus aggratate microvascular thrombosis. In Fig. 5A, FIIa was shown to be able to activate protein C to APC in dose- and timedependent manner (P < 0.01) and APC concentration got to its maximum at 12.5 ug/ml after 90 min of FIIa exposure in vitro. The activated effect of FII on protein C at the dose of 2.5 ug/ml was significantly stronger than the Protac1, the positive activator of protein C [27]. RT-PCR assay showed that FIIa did not change the mRNA level of protein C in HUVEC cells (Fig. 5B). These results suggested that FIIa could directly activate protein C,but could not up-regulate protein C on the m-RNA level, thus it may be an important mechanism of FIIa against DIC caused by LPS in rabbits. 4. Discussion Disseminated intravascular coagulation (DIC) is a life-threatening syndrome caused by different reasons. Because there is no effective therapy for DIC, the clinical prognosis is poor and the mortality is high, up to 50–60% [28]. The recent studies are focus on the pathogenesis of DIC to gain better therapies for the patients with DIC. In this investigation LPS, which is a constituent of the outer membrane of the gram-negative bacteria, was used to induce DIC in rabbits. The induction of DIC leads to the generation of cytokines produced by monocytes and endothelial cells, which activate
coagulation and fibrinolytic pathways [29]. This study has shown that, the administration of LPS resulted in typical changes of DIC characterized by a significant decrease in the activities of plasminogen, ATIII, protein C, t-PA, platelets count, and fibrinogen concentration, extension in APTT, PT, and FDP, and a dramatic increase in PAI-1 activity, intense liver and kidney fibrin deposition. In the LPS-induced rabbits, we found that administering low-, medium-, and high-dose of FIIa improve the activities of protein C, plasminogen, ATIII, t-PA, PAI-1, and the concentration of fibrinogen (P < 0.05). It improved the platelets count, the APTT, PT and FDP. It could also decrease the mortality of animals treated with all 3 doses of FIIa at both 6 h and 24 h (P < 0.01). This dramatic benefit was further verified by a significant reduction in fibrin deposition observed in the histological liver and kidney tissue. Several naturally occurring systems, such as protein C system, antithrombin III (ATIII), act to attenuate the effects to a procoagulant state. Some complicated combinations activate Protein C, which is a plasma, vitamin K-dependent zymogen of a serine protease [30], which proteolytically inactivates factors Va and VIIIa, cofactors Xa and Ixa, respectively. The protein C anticoagulant pathway is a major mechanism in controlling microvascular thrombosis. ATIII is a plasma serine protease inhibitor that acts not only on thrombin, but has significant inhibitory on factors VIIa (in complex with tissue factor), Ixa, Xa, Xia, XIIa, kallikrein, and plasmin [31–33]. In addition to anticoagulant activity, FIIa is also related to the degradation of gelatin and collagen [34], whereas activated protein C can activate gelatinase A [35] In this study the improvements in protein C and ATIII activity by FIIa were remarkable among the changes observed in coagulation-related paramerters. Furthermore with increasing dosage of FIIa, the activity of protein C increased over baseline. The chief cause of protein C and ATIII deficiency in LPS-induced DIC is not a decrease in production but enhanced generation of thrombin [36] .We confirmed that FIIa only could activate protein C directly, however, it can not up-regulate protein C on m-RNA level. This evidence suggests that FIIa might have succeeded in enhancing the activity of protein C. Recent researches have shown activated protein C was a good therapy for DIC.
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
911
Fig. 4. The effect of FIIa on the protein and gene expression of t-PA and u-PA in HUVEC cells. Cells were incubated with 2.5 ug/ml FIIa for 24 h or 50 ng/ml VEGF for 24 h. The effect of FIIa and VEGF on t-PA (A) or u-PA (B) production of HUVEC cells. The effect of FIIa and VEGF on protein expression of t-PA (C) or u-PA (D). The effect of FIIa and VEGF on gene expression of t-PA (E) or u-PA (F). Results are the means SD (n = 3) for three repeats. Statistical differences compared with the controls are given as **, P < 0.01. Blots were representative of three independent experiments.
There is strong evidence that the fibrinolytic system is activated and reciprocally inhibited in septic and DIC patients. Plasmin is the central enzyme of fibrinolysis. It is formed from a precursor, plasminogen, by both tissue-type and urokinase-like plasminogen activators (t-PA and u-PA, respectively). Fibrin is cleaved into degradation products by plasmin, eliminating soluble fibrin from the circulation and solubilizing existing clots. Plasminogen activator inhibitor (PAI-1) is the principal inhibitor (PAI)-1 is the principal inhibitor of plasminogen activation and appears to be the most involved DIC. In the LPS-induced DIC rabbit model, FIIa did influence fibrinolysis concomitant with the changes in the activities of PAI-1, t-PA, and plasminogen. Such treatments with FIIa reduced liver and kidney microvasscular thrombosis induced by LPS. In addition, FIIa not only up-regulated the expression of tPA and u-PA on the m-RNA level as VEGF, but also down-regulated the expression of PAI-1 directly. FIIa degraded fibrin without activating the plasminogen by our previous work [18]. Protein C has a secondary antithrombotic action by forming comolexes with PAI-1 to prevent its inhibition of fibrinolysis [34], and the activity of protein C was found to be enhanced by FIIa in vivo and directly
activaed protein C in vitro. Therefore, the improvement in the activities of t-PA and PAI-1 by FIIa could be partly explained by the enhanced and activity of protein C. It seems likely that FIIa might stimulate the production of plasminogen in vivo and in vitro. Additional work is needed to assess this issue. In this study, FIIa reduced the mortality caused by LPS-induced DIC. DIC has widespread effect on blood coagulation activated, which results in the intravascular formation of fibrin. This process may lead to thrombotic occlusion of small and mid-sized vessels that contribute to multiple organ failure. These vessels have been considered as important causes of DIC death. Furthermore, protein C also plays a role in pathogenesis of microthrombosis. In the light of our data, FIIa not only degrades fibrinogen and dissolves the microvascular thrombosis in vivo, but it may also enhance the activity of protein C. These findings suggest that FIIa can have a benefit in improving LPS-induced DIC by degrading fibrinogen and enhancing the activity of protein C. In addition, FIIa diminished the values of FDP, APTT, PT and ameliorated the concentration of frinogen and platelets in LPS-induced DIC rabbits. These effects mainly were ascribed to the activity of FIIa degrading directly
912
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913
Fig. 5. The effect of FIIa on protein C activity and gene expression. 20 umol protein C was incubated with different dose FIIa and 1 U/ml protac respectively for 30, 60, 90 and 120 min in vitro and then the concentration of APC was measured. FIIa activated protein C to APC in time- and dose-dependent manner (A). HUVEC cells were incubated with 2.5 ug/ml and 50 ng/ml VEGF respectively for 24 h and then were subjected to RT-PCR analysis (B). Results are the means SD (n = 3). Statistical differences compared with the controls are given as **,##, ~~, , , !!, P < 0.01. Blots were representative of three independent experiments.
microthrombi without activation of plasminogen and reducing the consumption of coagulation factors, which suggested that FII may effectively improve the bleeding induced by DIC. Therefore our findings may provide to FIIa beneficial property compared with heparin and other anticoagulant drugs in use clinically. In summary, FIIa was able to protect significantly against LPSinduced DIC and DIC-induced organ dysfunction. The protective effect was likely due to the direct activation of protein C, the increased expression of t-PA and u-PA, and the inhibition of cytokines-induced PAI-1 production. Our data supported the hypothesis that FIIa is developed to be a novel candidate in the treatment of DIC, and therefore it appears to be an attractive strategy for DIC therapy. More work is needed to develop this valuable drug. Acknowledgments Project supported by the National Natural Science Foundation of China(No 81000209), the key Project of Chinese Ministry of Education (NO. 210255), and the Fundamental Research for the Central Universities (NO. 21609304)
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.bcp.2012.06.011.
References [1] Vercellotti GM, Wickham NW, Gustafson KS, Yin HQ, Hebert M, Jacob HS. Thrombin-treated endothelium primes neutrophil functions: inhibition by platelet-activating factor receptor antagonists. J Leukoc Biol 1989;45(6): 483–90. [2] Robboy SJ, Major MC, Colman RW, Minna JD. Pathology of disseminated intravascular coagulation (DIC). Analysis of 26 cases. Hum Pathol 1972;3(3):327–43. [3] Taylor Jr FB, Toh CH, Hoots WK, Wada H, Levi M. Towards definition, clinical and laboratory criteria, and a scoring system for disseminated intravascular coagulation. Thromb Haemost 2001;86(5):1327–30. [4] Levi M, de Jonge E, ten CH. Disseminated intravascular coagulation. Ned Tijdschr Geneeskd 2000;144(10):470–5. [5] Levi M. Disseminated intravascular coagulation: what’s new? Crit Care Clin 2005;21(3):449–67. [6] Rubin RN, Colman RW. Disseminated intravascular coagulation. Approach to treatment. Drugs 1992;44(6):963–71. [7] Hardaway RM, Williams CH, Sun Y. A new approach to the treatment of experimental septic shock. J Surg Res 1996;61(2):311–6. [8] Vervloet MG, Thijs LG, Hack CE. Derangements of coagulation and fibrinolysis in critically ill patients with sepsis and septic shock. Semin Thromb Hemost 1998;24(1):33–44. [9] Asakura H, Jokaji H, Saito M, Uotani C, Kumabashiri I, Morishita E, et al. Study of the balance between coagulation and fibrinolysis in disseminated intravascular coagulation using molecular markers. Blood Coagul Fibrinolysis 1994;5(5): 829–32. [10] Ouriel K. Comparison of safety and efficacy of the various thrombolytic agents. Rev Cardiovasc Med 2002;3(Suppl 2):17–24. [11] Fourrier F, Jourdain M, Tournoys A, Gosset P, Mangalaboyi J, Chopin C. Effects of a combined antithrombin III and protein C supplementation in porcine acute endotoxic shock. Shock 1998;10(5):364–70. [12] Feinstein DI. Diagnosis and management of disseminated intravascular coagulation: the role of heparin therapy. Blood 1982;60(2):284–7.
J.-z. Qi et al. / Biochemical Pharmacology 84 (2012) 905–913 [13] Lehmann C, Usichenko TI, Pavlovic D. Heparins in sepsis-induced disseminated intravascular coagulation: low weight-high impact? Crit Care Med 2005;33(6):1455–7. [14] Freeman BD, Zehnbauer BA, Buchman TG. A meta-analysis of controlled trials of anticoagulant therapies in patients with sepsis. Shock 2003;20(1): 5–9. [15] Shimamura K, Oka K, Nakazawa M, Kojima M. Distribution patterns of microthrombi in disseminated intravascular coagulation. Arch Pathol Lab Med 1983;107(10):543–7. [16] Fay WP, Garg N, Sunkar M. Vascular functions of the plasminogen activation system. Arterioscler Thromb Vasc Biol 2007;27(6):1231–7. [17] de Fouw NJ, de Jong YF, Haverkate F, Bertina RM. Activated protein C increases fibrin clot lysis by neutralization of plasminogen activator inhibitor—no evidence for a cofactor role of protein S. Thromb Haemost 1988;60(2):328–33. [18] Xiuxia L, Jiashu C, Yingna Z, Pengxin Q, Guangmei Y. Purification and biochemical characterization of F II(a), a fibrinolytic enzyme from Agkistrodon acutus venom. Toxicon 2001;39(8):1133–9. [19] Hermida J, Montes R, Paramo JA, Rocha E. Endotoxin-induced disseminated intravascular coagulation in rabbits: effect of recombinant hirudin on hemostatic parameters, fibrin deposits, and mortality. J Lab Clin Med 1998;131(1): 77–83. [20] Lin X, Liang XX, Chen JS, Chen Q, Qiu PX, Yan GM. The effect of fibrinolytic enzyme FIIa from Agkistrodon acutus venom on disseminated intravascular coagulation in rabbits. Transl Res 2007;150(5):295–302. [21] Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest 1973;52(11):2745–56. [22] Elsayed YA, Nakagawa K, Ichikawa K, Ohkawara S, Sueishi K. Expression of tissue factor and interleukin-1 beta in a novel rabbit model of disseminated intravascular coagulation induced by carrageenan and lipopolysaccharide. Pathobiology 1995;63(6):328–40. [23] Levi M, ten CH, van der Poll T, van Deventer SJ. Pathogenesis of disseminated intravascular coagulation in sepsis. JAMA 1993;270(8):975–9. [24] Liu Y, Wang C, Yang Y, Hou X, Wang J. Pro-urokinase up-regulates the expression of urokinase-type plasminogen activator (u-PA) in human pulmonary arterial endothelial cells. Thromb Res 2008;121(4):485–91.
913
[25] Taylor Jr FB, Peer GT, Lockhart MS, Ferrell G, Esmon CT. Endothelial cell protein C receptor plays an important role in protein C activation in vivo. Blood 2001;97(6):1685–8. [26] Marlar RA, Endres-Brooks J, Miller C. Serial studies of protein C and its plasma inhibitor in patients with disseminated intravascular coagulation. Blood 1985;66(1):59–63. [27] Gable PS, Le DT, McGehee W, Rapaport SI. A protac-based screening test for activated protein C-resistant factor Va and other defects of the protein C anticoagulant pathway. Blood Coagul Fibrinolysis 1997;8(6):327–35. [28] Kowalik MM, Smiatacz T, Hlebowicz M, Pajuro R, Dziarmaga-Piasecka N, Gesing M, et al. Occurrence of disseminated intravascular coagulation in purulent meningitis and influence on mortality in 118 patients. Przegl Epidemiol 2006;60(2):281–9. [29] Warr TA, Rao LV, Rapaport SI. Disseminated intravascular coagulation in rabbits induced by administration of endotoxin or tissue factor: effect of anti-tissue factor antibodies and measurement of plasma extrinsic pathway inhibitor activity. Blood 1990;75(7):1481–9. [30] Walker FJ, Fay PJ. Regulation of blood coagulation by the protein C system. FASEB J 1992;6(8):2561–7. [31] Mammen EF. Antithrombin: its physiological importance and role in DIC. Semin Thromb Hemost 1998;24(1):19–25. [32] Rao LV, Rapaport SI, Hoang AD. Binding of factor VIIa to tissue factor permits rapid antithrombin III/heparin inhibition of factor VIIa. Blood 1993;81(10):2600–7. [33] Rao LV, Nordfang O, Hoang AD, Pendurthi UR. Mechanism of antithrombin III inhibition of factor VIIa/tissue factor activity on cell surfaces. Comparison with tissue factor pathway inhibitor/factor Xa-induced inhibition of factor VIIa/ tissue factor activity. Blood 1995;85(1):121–9. [34] Wang QQ, Chen JS, Liang XX, Qiu PX, Wang YW, Yan GM. Hemorrhagic activity and mechanism of FIIa, a fibrinolytic enzyme from Agkistrodon acutus venom. Acta Pharmacol Sin 2004;25(4):514–21. [35] Nguyen M, Arkell J, Jackson CJ. Activated protein C directly activates human endothelial gelatinase A. J Biol Chem 2000;275(13):9095–8. [36] Taylor Jr FB, Chang A, Esmon CT, D’Angelo A, Vigano-D’Angelo S, Blick KE. Protein C prevents the coagulopathic and lethal effects of Escherichia coli infusion in the baboon. J Clin Invest 1987;79(3):918–25.