A plasmid to visualize and assay termination and antitermination of transcription in Escherichia coli

PLASMID

21,31-42

(1989)

A Plasmid

to Visualize and Assay Termination of Transcription in Escherichia NAOMI

Biology

Department

and Howard Received

Hughes

C. FRANKLIN

Medical

September

and Antitermination co/i

Institute,

University

20, 1988; revised

December

of Ulah.

Sali Lake

Cily,

Utah 84112

16, 1988

To facilitate the analysis of termination and antitermination of transcription in prokaryotes, a complex operon has been assembled into the pBR322 @icon, drawing upon natural and synthetic DNA elements. This operon is initiated from a strongly inducible promoter without temperature restraints. It includes a severe transcription terminator and therefore requires antitermination of transcription to express a downstream lacZ reporter gene. Antitermination can bc provided by an upstream N-utilizufion site from phage X, working in conjunction with N protein supplied in frans from a compatible plasmid. In this situation, the nusA gene of Salmonella. substituted into the Escherichia coli host, prevents lacZ function, confirming that a good facsimile of X’s specific antitermination mechanism has been recreated. The nonessential, easily assayed product of this operon, fl-galactosidase, is also screenable by colony color on chromogenic substrate. The plasmid described will therefore serve as a tester for mutations affecting the various aspects of transcription regulation by termination. o tsss Academic press, tnc.

Regulation of transcription subsequent to initiation provides a means for affecting gene expression that supplements the regulation of transcription at initiation. Known from many situations in prokaryotes, regulation by transcription pausing or termination is also becoming known in eukaryotes (Platt, 1986; Bentley and Groudine, 1988; Kerppola and Kane, 1988). In bacteria, this mode of regulation, attenuation, is known to modulate the expression of distal portions of operons. The structures of termination signals in attenuators, determined by mRNA sequence, can be weakened or strengthened in response to upstream expression, dependent upon cell metabolism (Landick and Yanofsky, 1987). Other opportunities for termination regulation within bacterial operons have been postulated (Askoy et al., 1984; Peacock et al., 1985). It is, however, only in the lambdoid bacteriophages, where all functions essential to phage development depend upon antitermination, that particular phage-coded proteins have been identified as instrumental in antiterminating transcription within specific phage operons (Friedman et al., 1987).

To examine the factors, sites, and structures involved in termination and antitermination of transcription (TAT)’ in Escherichia co/i, a pBR322-derived family of plasmids (pTAT) that will allow substitutions and mutations affecting termination to be visualized by colony color and their effects quantitated in vivo by easy and sensitive enzymatic assay has been constructed. In these plasmids, transcription originates from a single, isopropylD-D-thiogalactopyranoside (IPTG)-inducible promoter. The resulting mRNA is translatable into two reporter gene products whose expression not only is visualizable in colonies growing on chromogenic substrates but also is readily and quantitatively assayable in permeabilized cells. Between the two reporter genes are unique cloning sites for the introduction of termination signals affecting the downstream reporter, lacZ, but not the upstream reporter, phoA, making the ratio of the two reporter products an internally controlled ’ Abbreviations used TAT, termination and antitermination of transcription; IF’TG, isopropyl+D-thiogalactopyranoside. 31

0147-619X/89

$3.00

Copyright 8 1989 by Academic Press, Inc. All rights of reproduclion in any form reserved.

32

NAOMI

C. FRANKLIN

measure of the degree of termination. Between the promoter and the reporters are unique cloning sites for the introduction of sequences potentially recognizable by factors affecting termination or antitermination. Such factors can be provided by the host chromosome or by a second compatible plasmid. These arrangements allow introduction and assessment of termination signals, and of adjunct proteins and their recognition sites, whether normal, mutant, or heterospecific. A plasmid providing a nonessential, termination-dependent end product, visualizable during colony formation, will have uses in the in vivo unraveling of these matters, most particularly in the generation of mutations affecting the various relationships. Although the pTAT plasmids may potentially serve a number of purposes, they were particularly designed to support the mutational analysis of transcription antitermination, a mechanism peculiar to the lambdoid bacteriophages of E. coli and its relatives. The major operons of lambdoid bacteriophages are fitted, between open reading frames, with a series of termination signals that must be overcome if transcription is to be completed. Of several lambdoid phages examined (Franklin, 1985), each codes for an early-expressed antitermination protein, generically called N. The N protein of X has been shown to enter into a transcription complex (Barik et al., 1987; Horwitz et al., 1987), endowing that complex with the capacity to read through termination signals. Although the N proteins work in trans, the N proteins of phages X, P22, and 21 do not substitute for one another under normal conditions and are therefore characterized as type-specific. Type specificity of N depends upon recognition between N and DNA-coded nuts (for N-utilization site) (Salstrom and Szybalski, 1978), where nut must be located cis to each operon affected and downstream from the transcrip tion start point. In addition, the function of N proteins depends upon several host proteins, Nus proteins, identified initially by mutations (see Friedman et al., 1984) and currently by biochemistry (Batik et al., 1987; Horwitz et al., 1987). The Nus proteins also may show

type specificity, both with respect to nut sites and with respect to N (Schauer et al., 1987; Franklin and Doelling, 1989). Within the nut sites of X, 21, and P22, a relatively conserved boxA sequence has been implicated in the functioning of NusA protein (Schauer et al., 1987). Located 8-14 nucleotides downstream from boti in each of these phages is an interrupted palindrome of lo- 19 nucleotides referred to as boxB. In X, mutations between the inverted repeats of boxB prevent N function, indicating boxB as the site of N recognition (Salstrom and Szybalski, 1978; Somasekhar et al., 1982). The sequences of boxBs diverge widely among the different phages, although they are closely conserved between the left and the right early operons of each phage, reinforcing the notion that boxB is the seat of N specificity (Franklin, 1985). The basic pTAT plasmid described here (Fig. 1) is unable to express its downstream 1acZ reporter gene because of the strong terminator complex that precedes it. If, however, a boxA-boxB site for NusA and NX utilization is added between the promoter and the upstream reporter gene, phoA, while NX protein is provided simultaneously in tram, 1acZ function increases over 800-fold. Mutation in nut or in the host nusA gene prevents this response. Thus the expression of 1acZ on the pTAT plasmid closely mimics the requirements for antitermination of transcription known from in vivo analysis of X in E. cob. MATERIALS

AND METHODS

The source plasmids and bacteria have been reported (Franklin-and DoeIling, 1989). E. coli K12 strain N566 is thi- sup” trpE9851(Am) la@ AlacZMlS AphoA20, Ret+ X”. Alterations in nusA can be introduced by transduction with phage Pl vir, taking advantage of closely linked argG: :TnS, selecting for either kanamycin resistance or Arg+ (Schauer et al., 1987). Similarly, rho mutations can be introduced by selection for closely linked Tn5 in ifv. For plasmid propagation, all bacteria are made ReC (N567) by transducing in ArecA : :Tn 10 and selecting for tetracycline re-

TRANSCRIPTION

REGULATION

BY TERMINATION

33

FIG. 1. Genetic map of pTAT-6, not drawn to scale, showing unique or rare restriction endonuclease cleavage sites and physical distances in nucleotides. Coordinates for this plasmid are given at the top, in nucleotides, starting from the EcoRI site 35 nucleotides downstream from the transcription start point. This plasmid has a total length of 9360 bp, the entire sequence of which is known for each of its components.

sistance (Csonka and Clark, 1979). To provide N function, strain N567 was transformed with pBR322-compatible plasmids derived from pACYC, whose Cm gene provides chloramphenicol resistance: pACiV has inserted into Tc a 450-bp fragment from X that barely spans the 307-pb N’ (Franklin, 1985), while pA@tacN has both ptac and N inserted within Tc (Franklin and Doelling, 1989). Plasmids under construction for TAT were transformed into N567 or N567 with a compatible N+ plasmid. Transformants were selected on tryptone agar plates containing 100 mg/liter ampicillin, or 15 mg/liter chloramphenicol, or both. The drug-containing plate was overlaid with a 30-ml hardened layer of nonselective tryptone agar, so that cells could be plated directly after transformation, thereby assuring the recovery of independent ligations (Shortle et al., 1980). The nonselective top layer contained either XP (5-bromo-4-chloro3-indolylphosphate-ptoluidene) at 0.1 mM (Brickman and Beckwith, 1975) or XGal(5bromo-4-chloro-3-indolyl-/3-Dgalactopyranoside) at 0.08 IrIM (Miller, 1972) to facilitate, respectively, the scoring of phoA or lad expression. Gene phoA was cloned without its normal promoter, which is derepressed by phosphate (Brickman and Beckwith, 1975). When cloned phoA is expressed from ptac, no care need be taken for the phosphate present

in tryptone agar. The addition of XP to tryptone plates at 0.1 mM gives phoA+ colonies a light blue color within a day at 37°C; colonies are dark blue ifO.O3-.3 n&t IPTG is also added to cells with @c-driven phoA. IPTG is a lactose analog able to derepress the mc promoter (deBoer et al., 1983). Both alkaline phosphatase, the product of phoA, and @galactosidase can be assayed from the same permeabilized cell suspensions, using, respectively, the colorogenic substrates p nitrophenyl phosphate (Sigma 104) (Torriani, 1966; Brickman and Beckwith, 1975) and onitrophenyl-&Dgalactopyranoside (ONPG) (Miller, 1972). Because alkaline phosphatase is inhibited by phosphate, cells for both assays were grown on 12 1peptone medium (Torriani, 1966), with 0.5% glycerol for carbon source and antibiotics to restrict the growth of plasmid-free segregants. Methods not given in Franklin and Doelling (1989) are as follows. For probing to find clones not distinguishable by function, the same DNA segment used for cloning was also nick-translated by the simplified procedure of C. Fauron (personal communication), using deoxyadenosine 5’-[cY-32P]triphosphate. The radioactive DNA was then hybridized to transformed colonies which had been transferred to GeneScreen and lysed by alkali to release denatured DNA; the DNA was then

34

NAOMI

C. FRANKLIN

bonded to the GeneScreen by heat and uv irradiation (Church and Gilbert, 1984). DNA was sequenced from double-stranded plasmid DNA, prepared from 40-ml cultures grown to late lag phase on rich broth. DNA was prepared in supercoiled form by a procedure modified (J. Doelling, personal communication) from that of Maniatis et al. (1982). DNA was sequenced using the sequenase kit from U.S. Biochemical Corp., labeling with [ol-32P]dATP, or deoxyadenosine 5’-a[35S]thiotriphosphate, using for primer the “-40” 17-mer that pairs with the coding strand of 1acZ (New England Biolabs) or 20mer oligos synthesized to pair with the noncoding strand upstream of ptac or the coding strand near the N-terminal of phoA. Oligonucleotides were synthesized in the HHMI laboratory of the Human Genetics Department, University of Utah, on an Ap plied Biosystems 380B synthesizer. RESULTS

Cloning of Promoterless E. Coli phoA Because phoA is a relatively small gene (1412 bp; Chang et al., 1986) with an easily assayable product (Torriani, 1966; Brickman and Be&with, 1975), it promised to be suitable as a reporter gene for plasmid transcription. The DNA sequence of phoA (Chang et al., 1986) showed, furthermore, the presence of a convenient RsaI restriction target between the promoter and the GTG start of the phoA signal peptide. Beyond the end of the phoA gene lies a Sau3AJ site, situated between phoA’s putative transcription terminator @hoAt) and the close promoter of the next gene. These cleavage sites formed the basis for separating phoA from adjacent promoters so that it could be cloned under the exclusive control of ptac (deBoer et al., 1983) on a multicopy plasmid, without the introduction of any extraneous promoters. Because there are several RsaI and Sau3AI sites within phoA, it was necessary to clone this gene in three segments, cut from a prior clone that spanned the gene (PHI 1; Inouye et al., 198 1). First, a 904-bp RsaI fragment spanning the N-terminal of the gene was intro-

duced into the unique SmaI site of pptacla@9 (Franklin and Doelling, 1989), a derivative of pBR322 in which the cloning region of M 13mp18 (Yanisch-Perron et al., 1985),ptac2 (deBoer et al., 1983), and a’trpAtrptl-la& fragment replace the segment from the unique EcoRI to the unique Bali site just downstream from Tc (Fig. 2, lines 1 and 2). Although a shorter fragment (PvuII727bp-ZWII) ofphoA had been found to confer alkaline phosphatase activity (Inouye et al., 198 I), the RsaI fragment did not; its presence in direct orientation with respect to ptac was nonetheless detectable by probing and physical analysis. To be able to make use of the EcoRI site introduced on Rsa-904, the EcoRI sites bordering ptac were temporarily removed by substituting the region spanning them (AatII to Kpnl) with a short oligonucleotide synthesized as two complementary pieces that provided AatII and KpnI ends (partial AatII digestion, to avoid cutting the AatII site in la&) (Fig. 2, line 3). A 360-bp EcoRI-Sau3AI (partial digest) segment spanning the C-terminal ofphoA was then isolated and substituted between the EcoRI site in phoA’ and the unique BamHI site, residual of the original cloning region (Fig. 2, line 4). The product of this step thus contained both the N- and the C-terminals of phoA, but lacked a 330-bp midsection bounded by EcoRI sites. This midsection was isolated and ligated into the unique EcoRI site of phoA’-‘phoA (line 5). When the ligation mixture was transformed into the AphoA host N567, in the presence of XP substrate, PhoA+ colonies were, at last, readily detected. It then remained only to replace ptac by substituting the original excerpt for the oligo between AatII and KpnI (line 6). The product of these operations contained the elements ptac phoA phoA-t ‘trpA trp-tl lacZ’, as well as the original bla (ampicillin resistance) and ori segments from pBR322. It is named pTAT- 1. Introduction of an Oligonucleotide Linker with Multiple Restriction Targets Because the restriction sites of the original “cloning region” had been dissipated by the

TRANSCRIPTION

< bla 1

1)

2)

CblaI

3)

< bla 1

41

51

, ,m A 1

10)

< bla 1

11) < blal

12)W

OtiGO

?Fl

‘52

Ipho A’) I I 5 MX

j’trp

A >tl

bri

*5213

1 IaC Z+>

ari

=p2-3

IphoA’j’phoA>t I I L

[ lac Z+>

*9

l/32

PtaE

, ,otac A

ptaE A

&-p A > tl 1 lac Z+>

Fl

i

phoA+>t

RrpA

25

1

II LL

1I

K

phoA+>tII

I

phoA+>t

cc

tr

K

1 I1 SK niii

potac I II SK A

I x

1 lacZ+>

~13-2 =pTAT-

m

l

fi

t Ra (trP A > tl 1 IaC i! > $1 snx

x

x1

phoA+>t II EC

x

nut* I I1 sI SK

>tl

x44-3

Xba linker (It-P A > tl [ laC Z’> YI YI

phoA+>t II LC

I ptac I nut* I II A s SK ptac

>tl

PhoA II +>t I cc x

K

A

I $trpA

X

I

K

m

A

=pptaclac

A > tl [ lac Z+>

K

A

< bla 1

33 OAC

j’trp

1

OliGO

< blal

g,

A > tl 1 lac Z+>

IphoA? I II E MX

I I c K

A

< blal

j’trp

35

BY TERMINATION

K

61 < bla 1

8)

,I, I I I f SKSIlMX

A

< bla 1


s

OliGO

A

7)

I c

REGULATION

tRa St

1 tl t%ltl

ItnP’I ‘lac OS

>

Bri

ItntSj 1‘lac OS

>

Fl

phoA+I, >t I tl tl tltl I knrsI I‘tat CL x BC OS

>

phoA+II >t 1,111 Itnlsj 1‘lac CL xnsnm OS

zi7

)

1

pTAT-2

pTAT-3

pT AT-5

ari

pTAT-6

pTAT-7

Flc. 2. Genotypes of the succession of plasmids generated en route to a tester for transcription termination. The maps are not to scale. Restriction sites are abbreviated as A, A&II; B, BglII, BA, BumHI; BS, Bsu361; E, k&RI; K, KpnI; L, BclI, N, Nsrl; S, SacI; SN, SnuBI; ST, &I; X, XbaI; and Bal” is the BUD site inactivated by insertion of ZucF. Other symbols and the synthetic steps are described in the text.

36

NAOMI

C. FRANKLIN

prior operations, it seemed desirable to introduce a new set of unique restriction sites to provide cloning opportunities for terminator sequences between phoA and 1acZ. For this

purpose two 44-base complementary oligonucleotides were synthesized, such that the duplex provided XbuI-complementing ends. The two sequences were:

TCTAGATGCATTACGTAATGATCAGATCTAAGGCCTAGAGCTCAT3’ XbaI

NSiI

SnuBI

Ben

BgnI

SCUI

3’TACGTAATGCATTACTAGTCTAGATTCCGGATCTCGAGTAGATC These paired oligos were ligated into the unique XbuI site downstream from the phoA terminator and were recovered in either orientation (Fig. 2, line 7). The restriction targets thus provided are all unique except for SacI, which is also found within 1ucZ as well as between ptac and phoA.

Sac1

XbaI 5’

which had been inserted with its Sac1 site closest to phoA (pTAT-2) (Fig. 2, line 8). This tR2 insertion eliminates the SacI, S&I, and BgnI sites of the linker, but adds two close S&I sites near its putative termination point. Surprisingly, there was little effect of this insert on 1acZ expression (below), although a 433-bp Sau3A 1 piece with the same Sau3A 1 endpoint had caused a significant reduction in 1acZ Introduction of Transcription Terminators expression in a very similar plasmid (J. Doellbetween phoA and 1acZ ing, personal communication). Either tR2 is ineffective or some feature of the plasmid conAs constructed, pTAT-1 was expected to struct interferes with termination, as is disgive only limited expression of lucZ, because cussed below. of at least three signals to terminate transcripA terminator complex with even more tion present between phoA and 1acZ. The phoA stringent potential became available in the gene as cloned is followed by its normal ter- tandem array of four terminators, T14, from minator, a palindrome with potential for a 1O- the end of the rrnB ribosomal RNA operon 14 base stem with a 10-2 base loop, followed of E. coli (Brosius et al., 1981). The tandem by seven uridines in the transcript. The ‘trpA arrangement of these terminators had arisen gene segment which follows has been shown during a prior cloning (Simons et al., 1987). to have a substantial polar effect on down- From that prior cloning, an 1 lOO-bp fragment stream lacZ’, apparently because it provides (SspI to SmaI) spanning TZ4 was cloned into 758 bp of nontranslated DNA (Franklin and the StuI site of the Xba polylinker, and then Doelling, 1989). Furthermore the trpA seg- subcloned on a SnaBI-Sac1 (blunted) fragment is followed by trp-tl, a partial terminator ment into the S&I site within tR2, the latter of the trp operon. These three elements should move chosen to eliminate the Sac1 site assobe causing some limit to 1ucZ expression, but ciated with the Xba polylinker (see below and assays of &galactosidase (below) nonetheless Fig. 2, line 10). showed substantial rates of expression. On the premise that termination down- Expression of 1acZ Curtailed by Fusion to a stream of phoA must be insufficient, further Weak Translation Start Signal terminators were introduced between the two Because the 1acZ gene was still strongly exreporter genes. A DNA fragment, HgiAI- 174 bpSau3AI (positions 40495-40669 on the pressed in pTAT-2, despite the upstream prescomplete X sequence), spanning the tR2 ter- ence of a variety of transcription terminators, it was hypothesized that the strong expression minator of phage X (Kroger and Hobom, 1982), was introduced between the Sac1 (par- of 1ucZ from the multicopy plasmid was outtial cut) and the BglII sites of the XbaI linker, stripping the sensitive assay/indicator used to

TRANSCRIPTION

REGULATION

detect it. Indeed, the Kleckner laboratory had shown that even a reduction by two orders of magnitude in the translatability of la& transcribed from a poor promoter would still give substantial synthesis of &alactosidase from their pBR322-derived plasmid (Simons et al., 1987). A major reduction in the translatability of 1acZ was accomplished by fusion between the initial sequences of ISlO, including the translation start and first 77 codons of transposase (tnp), and the eighth codon of la&, resulting in a protein fusion with &galactosidase activity, but a low level of expression (Simons et al., 1987; Raleigh and Kleckner, 1986). The very poor translatability of tnp was alleviated some lo-fold by a mutation (K’7) affecting the ribosome binding region of tnp (Chaitanya Jain, Personal communication). The tnp-K’7 fusion to 1acZ was integrated into the present plasmid system by cutting the promoterless segment Nr&400 bpBsu361 (the latter in 1acZ) from pNK2257 (kindly provided by N. Kleckner and C. Jain) and ligating it to replace the segment in pTAT-2 between SnaBI of the Xba polylinker and Bsu361 in 1acZ (Fig. 2, line 9). The effect of this was to eliminate the ‘trpA-trpt segment, leaving the poorly translated trip’‘IacZ fusion directly downstream from thephot and tR2 terminators. This plasmid is pTAT3. DNA sequencing confirmed the expected conjunction of polylinker/tnp-K’7/‘lacZ, as drawn on line 9 of Fig. 2, and with more detail in Fig. 1. The T14 tandem terminator described above was introduced on a blunted fragment

boxA 5’

CGACGCTCTTAAAAATTAAGCCCTG

BY TERMINATION

37

into the StuI site within tR2 of pTAT-3, giving pTAT-5 (Fig. 2, line 10). When spread on tryptone agar with XG at 50 mM, cells carrying pTAT-3 and pAC&&V remain white in the absence of IPTG and become blue if IPTG is present at 0.1 mM. Cells carrying pTAT-5 and pACptacN remain white even when IPTG is present. Thus 1ucZ expression was finally mastered by a combination of low-efficiency translation and strong upstream termination of transcription. Another possible element activating 1ucZ function would be a fortuitous promoter within ‘trpA, downstream from all of the terminators except trp-tl. The existence of such a promoter was indicated by Simons et al. (1987). We have no independent evidence, except for the unexpectedly strong 1acZ function from pTAT- 1 and -2, even in the absence of IPTG. The replacement of ‘trpA by tnp’ in pTAT-3 (and thereafter) would have replaced the putative promoter as well as curtailing 1ucZ translation, either or both of which would have contributed to mastering 1acZ expression. Introduction of the nut Recognition Site for Phage X’s N Antitermination Protein Because the DNA sequence in the region of nutL in X does not provide convenient, close restriction targets (Franklin, 1985), a sequence spanning boxA and boxB of nutLX but presenting the GAAAA loop sequence of nutR” was obtained from two complementary 48mer oligonucleotides whose paired strands provided overhangs complementary to Sac1 restriction cuts: boxB AAAAAGGGCAGCATTCAAGAGCT

3’ TCGAGCTGCGAGAATTTTTAATTCGGGACTTTTTCCCGTCGTAAGTTC This duplex was cloned into the Sac1 site between ptac and phoA of pTAT-3, where it had the effect of stimulating synthesis of @-galactosidase when the N protein was provided (see below). The correct orientation and sequence of this insert were confirmed by DNA sequencing. This nut+ plasmid is called pTAT-

4. The BoxA-BoxB segment could be excised with unidirectional ends by cutting first with KpnI and then with partial amount of SacI. Transfer of this segment into pTAT-5 provided nut function in the resulting derivative, pTAT-6 (line 11, Fig. 2).

38 Deletion of T14

NAOMI

C. FRANKLIN

additional 60 min with 0 or 0.5 mM IPTG, permeabilized, and assayed for alkaline phosThe T14 tandem terminators were deleted phatase and fl-galactosidase. Data represenfrom pTAT-6 by cutting at its unique XbaI tative of several repeat assays are given in Taand BgfiI targets on either side of T14, re- ble 1. placing the terminators with the XbaI-NszIAlkaline phosphatase is seen to be substanSnuBI-BclI-BgAI half of the %a polylinker tial in all strains tested, except for those car(pTAT-7; line 12, Fig. 2). These unique re- rying the parental plasmid pptaclacZ9, which striction enzyme targets are now available for includes no phoA gene: no alkaline phosphathe insertion of other sequences to be tested tase was measurable in any of the hosts carfor termination. rying this plasmid. Induction of alkaline phosphatase by IPTG is about lo-fold in strains with phoA+ plasmids. An undesirable Expression of 1acZ and phoA from the fluctuation in the day-to-day values for alkaConstructed Plasmids line phosphatase activity limits the desired use The series of seven pTAT plasmids de- ofphoA as an internal quantitative control for scribed here were transformed into a set of plasmid copy number. It is nevertheless qualisogenic E. coli hosts that provided, in addition itatively clear that phoA remains strongly acto the standard laclq repressor, the possibility tive when &galactosidase activity becomes of mutations in nusA or rho and the possibility curtailed by the constructions in pTAT-3, -4, of adding compatible plasmids synthesizing N -5, and -6, showing that these constructions protein of phage X. The basic JMB9 strain with affect readthrough expression of 1acZ rather laclq, AlacZol, and AphoA could accept sub- than plasmid stability, inducibility of ptac, or stitutions by the nusA gene of Salmonella other extrinsic factors. (nusA”‘) or the rho102 mutation (see MethThe expression of 1acZ is seen to be influods). To provide a low level of X’s N protein, enced by many factors. In pptaclacZ9-carthe N” gene alone was cloned into the Tc gene tying strains, lacZ is strongly expressed but is of pACYC, probably being expressed from the induced by IPTG only lo-fold, although norTc promoter. Higher levels of N were supplied mal chromosomal induction is about lOOOfrom a double cloning of ptac and N into the fold. On the one hand the top level of 4500 same Tc. When the latter construct is present units with IPTG may be at the limit of the in the same cell as a pTAT plasmid, addition cell’s total synthetic capacity. On the other of IPTG induces both expression of N and hand the low induction ratio may reflect the expression ofphoA/lacZ, where 1acZ may also high basal level, possibly due to incomplete be N-dependent. It is possible that the ptac repression of ptac, lac repressor becoming depromoter/operator in pACpta& contributes pleted by the lac operator on the multicopy to titration of luc repressor by ptac in the tester plasmid. The high noninduced level, however, plasmid, weakening the repression of both ptac seen also with pTAT-1 and -2, may equally promoters, but the low copy number (5) of well signal the presence of an IPTG-indepenpACYC relative to the high copy number (40) dent promoter, already hypothecated to exist of pBR322 should make this effect minor. in the ‘trpA segment by Simons et al. (1987). The composite bacteria were colony purified The high basal level is not increased by N or on tryptone agar containing ampicillin (to by rho-, either of which would increase readmaintain selection for pTATs) and chloramthrough of termination signals between phoA phenicol (to maintain selection for pACn! if and lacZ, particularly the polarity caused by present). To observe phoA or 1acZ function, nontranslated ‘trpA (Franklin and Doelling, XP or XGal was included in the agar together 1989). Therefore the hypothesis of an IPTGwith 0 or 0.005-0.25 mM IPTG. For enzyme independent promoter downstream from the assaysthe bacteria were grown to log phase at polarity signal in ‘trpA seems favored. This 37°C in 12 1-peptone medium, aerated for an promoter must not be separated from 1acZ bv

TRANSCRIPTION

REGULATION TABLE

UNITS

OF @-CALACXOSIDASE

AND

CARRYING

ALKALINE

PHOSPHATASE

pTAT

THE VARIOUS

PLASMIDS,

1 ACTIVITY INDUCED

Host

39

BY TERMINATION

MEASURED OR NOT

IN PERMEABILIZED

BY IPTG

(-1

BACTERIA

OR +I)

-

bacteria

llUSA+~

IIUSA-"

rho102 NON

Plasmid

pTAT-

(phoA+ 'trpA)

pTAT-3 (fR2 trip’ ‘/mZ) pTAT-4 (nut+tR2 trip’) pTAT-5

(Tl4 mp"lacZ) pTAT-6

(nur'

T/4 PIP')

pTAT-7

(nut+ trip" 'IacZ) Now carrying

120

2500

20 337

490 3800

213

2300

13

315

15

290

10

280

-

-

350

270

2500

320

3500

370

4100

390

4100

-

-

tl



tl

cl



tl

tl

4

380

2800

1

1

220 80 80

3500 4600 1500

40 400

120 3600

70 200

Host cells for the Dlasmids were N567 (=nusAcO"). PACN+~ (weak N) or pACptacN+” (medium N).

+I

4500

1100

3000


4000 2500 5ooo 2500 960 2400

810

2 550 140 500 180 10 120




520

3000



-1

10 210


+I

220 1800


2500

N567 muAM', and N567

any rho-dependent terminator. The promoter would be removed when trip’ replaces ‘trpA in pTAT-3, and thereafter. It is seen that N has a significant effect on IucZ expression in cells carrying pTAT-1, -2, and -3, despite the absence of a known nut site. In the first place, the limitation on 1acZ expression imposed by the introduction of phuA and phoAt (pTAT- 1) and tR2 (pTAT-2) limits lacZ expression sufficiently that capacity is opened to see an N effect. In the second place, the introduced sequences could provide sequences suitable for N protein interaction. We have already noted that antitermination by excess N may occur in the absence of known nut sequences, and particularly within the untranslated ‘trpA stretch (Franklin and Doelling, 1989). That effect was attributed either to the ability of excess N to function in absence of any nut site or to the fortuitous presence of quasi-nut sequences in the untranslated ‘trpA segment. Replacement of ‘trpA in pTAT-3, however, does not eliminate N’s ability to activate 1ucZ expression. Neverthe-

rholO2, carrying

-1

No N

260 4

41

-I

MedN

4500
760 7 800 300 900 500 70 330

+1

N

540 6 520 250 490 300 9 190

700 250

-I

Weak

4000 1 1500 2000 900 2400 190

400

(rR2 'rrpA)

-

NON

+I

1

pTAT-2

Med N

-1

)

I

N

+1

540

pptaclacZ+9 WPA

-I

-

Weak

70 670

3 1300

no additional

+1

-1

608 400 180 600

360 2200


+I

loo0 2000 400 4000

tl


1100

2700

Cl


1000

3200

plasmid

(no N) or

less, when a known both-boxB sequence is added to pTAT-3, giving pTAT-4, the N effect on 1ucZ is strengthened. But since 1ucZ expression in the absence of IFTG is also increased, boxA-boxB may be serving other purposes, e.g., a site for NusA entry. The influence of N is limited to host cells with nUdcoli , suggesting that N is acting specifically. Although 1acZ expression is reduced, it remains at a moderate level in cells carrying pTAT-3 and -4, despite removal of the putative promoter in trpA and introduction of translation limitation, Expression of 1ucZ becomes immeasurable with the further introduction of a strong terminator, T14, giving pTAT-5. It should be noted, however, that when @galactosidase is not detectable in the permeabilized cell assay used here, it may yet be detectable in cell extracts, where monomers present at fewer than 4 per cell can interact to give active enzyme (Raleigh and Kleckner, 1986). The very low (if any) 1acZ expression in pTAT-5 cannot be activated by N without the insertion of a known nut sequence, as in

40

NAOMI

C. FRANKLIN

pTAT-6. Activation by N in pTAT-6 is about 800-fold. Activation by N is only 4-fold (960/ 190 or 2300/490) in pTAT-3 or -4, presumably because transcription termination is not as limiting in those constructs. In pTAT-6, boxA-boxB does not of itself activate measurable 1ucZ expression. Rather a combination of nut, N, and NusAColi is required, suggesting that a true facsimile of N function in X has been achieved. When TZ4 is deleted from pTAT-6 to give pTAT-7, Bgalactosidase is strongly synthesized even in the absence of N, showing that T14 was a major impediment to 1ucZ expression in pTAT-6. The high expression of 1acZ with pTAT-7 is no lower than that with pptaclucZ9, despite reduced translatability due to the trip fusion in pTAT-7. The high values in both cases, but especially with No. 9, may be deceptively low, limited by cell synthetic capacity. Because insertion of the trip1acZ fusion was coupled with deletion of ‘trpA in making pTAT-3, we cannot be certain of the importance of translation limitation to the testability of N effect on pTAT-6. The presence of the fusion, with its K’7 mutation increasing translation lo-fold above that of normal tnp (C. Jain, pers. commun.), was confirmed by DNA sequencing of pTAT-6 and is presumed to limit 1ucZ expression beyond the limitation due to termination. The limitation of 1ucZ expression is important in another way, bringing Bgalactosidase levels into the range of detectability by XGal, during growth of colonies on XGal-supplemented agar. The coloration of colonies growing in the presence of the XGal substrate of @galactosidase can be correlated approximately with the level of enzyme present in extracts of logphase cells. For cells with less than 300 units of @-galactosidase, colonies are not colored. Cells with more than 800 units saturate the color response. Between 300 and 800 units, the blueness of colonies is proportional to /3galactosidase levels. Thus pTAT-6 in the presence of IPTG and high N shows distinct blueness. This color response should make it possible to screen for mutations affecting various aspects of the termination/antitermination regulatory system.

DISCUSSION

Described here is the construction of a plasmid which has the characteristics desired of a surrogate for E. coli or its lambdoid bacteriophages in regulating transcription by termination or antitermination. In pTAT-6, the downstream reporter gene, lacZ, is preceded by a strong terminator that blocks 1acZ function. Excision of that terminator results in strong synthesis of fl-galactosidase, more than sufficient to give blue color to colonies growing on plates with the indicator substrate XGal. Alternatively, 1ucZ can be activated in the presence of the terminator by the effect of N protein acting at a boxA-boxB sequence cis to 1ucZ. Neither N nor boxA-boxB alone suffices to activate lucZ, nor do both work together if the nusA gene of E. coli is replaced by the analogous gene of Salmonella. The expression of 1ucZ in this construction thus shows its dependence on transcription termination and responsiveness to the X mechanism that reverses termination. Because the plasmid carries a single reporter operon with nonessential but easily detectable products, it should be helpful in characterizing by mutation each of the several components involved in the termination mode of transcription regulation. The possibility of observing gradations in 1ucZ expression by colony color should allow subtle as well as extreme effects to be identified for extended analysis. Although considerable effort has been given to the characterization of termination sequences (Rosenberg and Court, 1979; Platt, 1986), understanding, especially of rho-dependent terminators, remains incomplete (Richardson et al., 1987). The pTAT-7 plasmid offers another opportunity to introduce units to be tested as terminators and to modify such units by directed mutagenesis. Previous success along these lines with a different plasmid system is noted (Rosenberg et al., 1983). The ability to challenge with N in the present situation will distinguish terminators from other impairments. One class of N-resistant impairment, however, may be an N-resistant terminator of intrinsic interest. The Nus proteins of E. coli were discovered

TRAN!XRII’TION

REGULATION

by selections for host functions essential for phage X development (Friedman et al., 1984). Current biochemistry is confirming their roles as components of transcription complexes (Barik et al., 1987; Horwitz et al., 1987). Further mutational characterization would now be possible in relationship to changed sequences at boa+boxB or in relationship to N proteins of different specificities. What is it, for example, about the NusA protein of Salmonella that makes it able to serve E. co/i but not X (Schauer et al., 1987)? The nut site of X also was initially identified by mutation (Salstrom and Szybalski, 1978), and directed mutagenesis has shown the importance particularly of the boxB “loop” sequence for N function (Somasekhar et al., 1982). Because pTAT-5 offers unique cloning sites between mc and phoA, there is opportunity for cassette mutagenesis of boxA-boxB to identify the sequences needed for function both with NX and with N proteins of different specificities (Doelling and Franklin, in prep aration). Finally, the phage N proteins will be a prime target for mutational characterization with pTAT-6, because screening for 1acZ function will be a potent positive screen for N mutants capable of functioning with altered nuts or Nus’s. Because it is anticipated that N recognizes the nut sequence in RNA rather than that in DNA, the basis for that protein/RNA recognition is likely to inform the analysis of a new class of specific macromolecular interactions. Unanticipated difficulties were encountered during the development of the pTAT plasmids. The ptac promoter was chosen to provide maximal operon expression and regulation without temperature dependence, but its strong action may contribute to incomplete repression, reduced termination, and a lethal overexpression of plasmid genes. Because of the low expression level of pTAT-6, these considerations can be ignored. 1acZ was chosen as reporter gene because of its well-known properties and the ease of assaying its product. Its high level of expression, however, especially in conjunction with ptac, exceeded the level at which termination could have major effect,

initially

BY TERMINATION

41

making it necessary to partially disable 1acZ by reducing its translatability. One learns that a certain balance must be struck for different modes of regulation to dominate. In the application of the pTAT tester plasmids, it will be essential to note the possibility of reactivating IacZ by means other than antitermination, e.g., the emergence of accidental promoters or increased translatability either by point mutations or by deletion/fusion. Mutagenesis should therefore not be applied in the presence of pTAT, pTATs should rather be used only as testers for components mutated independently of itself. ACKNOWLEDGMENTS

I am thankful to Nancy KIeckner for providingplasmids and valuable insights. Andrew Wright kindly sent the phoA plasmid. Jed Doelling extrapolated his sequencing to my needs and reviewed the manuscript with care. Diane Dunn and Bob Weiss at HHMI were diligent in synthesizing oligonucleotides, and Bob helped over several rough spots. Sandy Parkinson continued computer education. Howard Hughes Medical Institute provided salary. National Science Foundation Grant DMB-84 I6285 provided research support.

REFERENCES ASKOY, S., SQUIRES,C. L., AND SQUIRES,C. (1984). Evidence for antitermination in Escherichiu coli rRNA transcription. J. Bacterial. 159, 260-264. BARIK, S., GHOSH, B., WHALEN, W., LAZINSKI, D., AND DAS, A. (1987). An antitermination protein engages the elongating transcription apparatus at a promoter-proximal recognition site. Cell 50,885-899. BENTLEY, D. L., AND GROUDINE, M. (1988). Sequence requirements for premature termination of transcription in the human c-myc gene. Cell 53,245-256. BRICKMAN, E., AND BECKWITH, J. (I 975). Analysis of the regulation of Escherichia coli alkaline phosphatase synthesis using deletions and 680 transducing phages. J. Mol. Biol. 96, 307-3 16. BROSIUS,J., DULL, T. J., SLEETER, D. D., AND NOLLER, H. F. ( 198 1). Gene organization and primary structure of a ribosomal RNA operon from Escherichiu coli. J. Mol. Biol. 148, 107-127. CHANG, C. N., KUANG, W.-J., AND CHEN, E. Y. (1986). Nucleotide sequence of the alkaline phosphatase gene of Escherichia coli. Gene 44, 12 I - 125. CHURCH, G. M., AND W. GILBERT (1984). Genomic sequencing. Proc. Natl. Acad. Ski. USA 81, 1991-1995. CSONKA, L. N., AND CLARK, A. J. (1979). Deletions generated by the transposon TN10 in the srl recA region of the Escherichia coli K- I2 chromosome. Genetics 93, 321-343. DEBOER,H. A., COMSTOCK, L. J., AND VASSER,M. (I 983).

42

NAOMI

C. FRANKLIN

The tacpromoter: A functional hybrid derived from the trp and lac promoters. Proc. Natl. Acad. Sci. USA 80, 21-25. FRANKLIN, N. C. (1985). Conservation of genome form but not sequence in the transcription antitermination determinants of bacteriophages X, (b2I, and P22. J. Mol. Biol.

181,75-84.

FRANKLIN, N. C., AND DOELLING, J. H. (1989). Overexpression of “N” antitermination proteins of bacteriophages X, 21, and p22 causes loss of N specificity. J. Bacterial., in press. FRIEDMAN, D. I., IMPERIALE, M. J., AND ADHYA, S. (1987). RNA 3’ end formation in the control of gene expression. Annu. Rev. Genet. 21,453-488. FRIEDMAN, D. I., OLSON, E. R., GEORGOPOULOS, C., TILLY, K., HERSKOWITZ, I., AND BANUETT, F. (1984). Interactions of bacteriophage and host molecules in the growth of bacteriophage h. Microbial. Rev. 48, 299325. HORWITZ, R. J., LI, J., AND GREENBLATT, 3. (1987). An elongation control particle containing the N gene transcriptional antitermination protein of bacteriophage lambda. Cell 51, 631-641. INOUYE,H., MICHAELIS, S., WRIGHT, A., AND BECKWITH, J. (198 I). Cloning and restriction mapping ofthe alkaline phosphatase structural gene @hoA) of Escherichia coli and generation of deletion mutants in vitro. J. Bacterial. 146,668-675. KERPPOLA, T. K., AND KANE, C. M. (1988). Intrinsic sites of transcription termination and pausing in the c-myc gene. Mol. Cell. Biol. 8,4389-4394. KROGER, M., AND HOBOM, G. (1982). A chain of interlinked genes in the ninR region of bacteriophage lambda. Gene 20,25-38. LANDICK, R., AND YANOFSKY, C. (1987). Transcription attenuation. In “Escherichia coli and Salmonella Typhimuriam” (F. C. Neidhardt, Ed.), pp 1276-l 301. Amer. Sot. Microbial., Washington, DC. MANIATIS, T., FRITSCH,E. F., AND SAMBROOK, J. (1982). “Molecular Cloning, a Laboratory Manual.” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. MILLER, J. H. (1972). “Experiments in Molecular Genetics.” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. PEACOCK,S., LUPSKI, J. R., GODSON,G. N., AND WEISS BACH, H. (1985). In vitro stimulation of Escherichia coli RNA polymerase sigma subunit synthesis by NusA protein. Gene 33,227-234. ITA=, T. (1986). Transcription termination and the reg-

ulation of gene expression. Annu. Rev. Biochem. 55, 339-372. RALEIGH, E. A., AND KLECKNER, N. (1986). Quantitation of insertion sequence IS10 transposase gene expression by a method generally applicable to any rarely expressed gene. Proc. Nat/. Acad. Sri. USA 83, 1787-1791. RICHARDSON, J. P., RUTESHOUSER,E. C., AND CHEN, C.-Y. A. (1987). Identification of upstream sequence components of rho-dependent transcription terminators. In “RNA Polymerase and the Regulation of Transcrip tion” (W. S. Reznikoff, R. R. Burgess, J. E. Dahlberg, C. A. Gross, M. T. Record, and M. P. Wickens, Eds.), pp. 335-345. Elsevier, New York. ROSENBERG,M., AND COURT, D. (1979). Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13, 319-353. ROSENBERG,M., CHEPELINSKY,A. B., AND MCKENNEY, K. (1983). Studying promoters and terminators by gene fusion. Science 222, 734-739. SALSTROM, J. S., AND SZYBALSKI, W. (1978). Coliphage XnutL-: A unique class of mutants defective in the site of N utilization for antitermination of leftward transcription. J. Mol. Biol. 124, 195-22 1. SCHAUER,A. T., CARVER, D. L., BIGELOW, B., BARON, L. S., AND FRIEDMAN, D. I. (1987). X N antitermination system: Functional analysis of phage interactions with the host nusA protein. J. Mol. Biol. 194,679-690. SHORTLE, D., KOSHLAND, D., WEINSTOCK, G. M., AND BOTSTEIN, D. (1980). Segment-directed mutagenesis: Construction in vitro of point mutations limited to a small predetermined region of a circular DNA molecule. Proc. Natl. Acad. Sci. USA 77, 5375-5379. SIMONS, R. W., HOUMAN, F., ANDKLECKNER, N. (1987). Improved single and multicopy la&as& cloning vectors for protein and operon fusions. Gene 53, 85-96. SOMASEKHAR, G., DRAHOS, D., SALSTROM, J.. AND SZYBALSKI, W. (1982). Sequence changes in coliphage lambda mutants affecting the nutL antitermination site and termination by tL1 and tL2. Gene 20,477-480. TORRIANI, A. (1966). Alkaline phosphatase from Escherichia coli. In “Procedures in Nucleic Acid Research” (G. L. Cantoni and D. R. Davies, Eds.), pp. 224-235. Harper & Row, New York. YANISCH-PERRON, C., VIERA, J., AND MESSING,J. (1985). Improved M 13 cloning vectors and host strains Nucleotide sequences of the M I 3mp 18 and pUC I9 vectors. Gene 33: 103- 119. Communicated by Donald R. Helinski