- Email: [email protected]
A rapid reliable method to use specific probes labelling polymerase chain reaction (PCR) products
Journal of Biochemical and Biophysical Methods, 24 (1992) 167-169
167
© 1992 Elsevier Science Publishers B.V. All rights reserved 0165-022X/92/$C~.00
JBBM 00929
A rapid reliable method to use specific probes labelling polymerase chain reaction (PCR) products A. Liras Istituto Nazionale Neurologico C. Besta, Milan, Italy (Received 7 October 1991) (Accepted 20 November 1991)
Summary Polymerase chain reaction (PCR) has allowed highly sensitive detection and amplification of individual DNA sequences. To generate specific probes for genes or cDNAs that have not yet been cloned, it is often necessary to label PCR products which are then used in Southern or Northern hybridizations or for screening cDNA and genomic DNA libraries. In this paper a rapid and versatile method of using PCR products, as specific probes, is described, after digestion with EcoRI in buffer H, in the presence of PCR reaction buffer, and purification of the PCR products for avoid the interference by competition of unlabelled dCTP in the directionaily random labelling. Key words: Polymerase chain reaction; Probe labelling; DNA cloning
Introduction Polymerase chain reaction (PCR) using the thermostable DNA polymerase derived from the bacterium Thermus aquaticus (Taq) [1], has allowed highly sensitive detection and amplification of individual DNA sequences. Under several conditions used to ensure the efficient amplification of the sequence to be detected, an extraordinary sensitivity and high specificity is achieved with the PCR method. Polymerase chain reaction methods have a wide range of application in research; for instance, to generate specific probes for genes or cDNAs that have not yet been cloned. It is often necessary to label PCR products, which are then used in Southern or Northern hybridizations, or for screening cDNA and genomic DNA libraries. Correspondence address: A. Liras, C / F e r r a z 114, 4°D, 28008 Madrid, Spain.
168
Here, a rapid and versatile method making use of PCR products for directionally random labelling of these fragments, after amplification, EcoRI restriction enzyme digestion and removal dCTP nucleotide, is reported.
Materials and Methods
The eDNA library for human fetal liver in the expression vector Agtll was a gift from Jan P. Kraus (Health Sciences Center, University of Colorado, Denver). EcoRI restriction enzyme and dNTPs were obtained from Boehringer Mannheim (Mannheim, Germany). Taq DNA polymerase (GeneAmp)was purchased from Perkin-Elmer Cetus Instruments. All other products were of analytical grade from Merck (Darmstadt, Germany). The first step was the amplification of phage DNA obtained from eDNA clones isolated by screening of a Agt11 eDNA library from human fetal liver by standard procedures [2]. Agt11 oligonucleotide primers used (24-mers), forward 5'd(GGTGGCGACGACTCCTGGAGCCCG)3', and reverse 5'd(TI'GACACCAGACCAACTGGTAATG)3', were synthesized using a Gene Assembler Plus (Pharmacia). Each PCR contained 25 pmol of primers, 200/~M each dNTP, 10 ng of phage DNA (clones LaC and L~A), 3 mM MgCl 2, 50 mM KCI, 10 mM Tris-HCl (pH 8.3), 0.01% gelatin, and 2.5 units of Thermus aquaticus of (Taq) polymerase, in a total volume of 100 /zl. Reactions were performed in 0.5-ml microcentrifuge tubes with the Perkin-Elmer Cetus Thermal Cycler. After a cycle of denaturation at 94°C for 3 min 30 s, primer annealing at 55°C for 2 rain 30 s, and extension at 72°C for 3 min, the thermal profile involved 24 cycles of amplification (94°C for 1 min 30 s, 55°C for 2 min 30 s, and 72°C for 3 min). 100/~l of mineral oil were added for reducing evaporation. After amplification, 100/~l of high purity chloroform were added and the aqueous phase containing the amplified DNA was removed. 20 /~l aliquots of this fraction were directly digested with 5 units of EcoRI and buffer H (50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 100 mM NaCl, 1 mM DTE) at 37°C in a 25-/~1 reaction for 2 h. EcoRI-digested PCR products were precipitated for removing soluble nucleotides (dNTPs) in 2 M ammonium acetate and 2 volumes of ice-cold ethanol in dry ice/acetone for 1 h. After centrifugation, the DNA pellet was washed once with 70% ethanol, dried and resuspended in 100 /zi of TE buffer (10 mM Tris-HC! (pH 8.0), 1 mM EDTA).
Results and Discussion
Fig. 1 shows the PCR amplified fragments electrophoresed on a 2% agarose gel after digestion, and undigested PCR products from phage DNA obtained from clones LIA (lanes 1 and 4) and L3C, with an internal EcoRI site (lanes 2 and 5). The digested PCR reaction (20-40 ng DNA inserts)was then directly radiolabelled with [a-32p]dCTP by the random primer DNA-labelling method [3] to a
169
12
3
45
hp _1786 - 1412 -
850 764
-
288
Fig. 1. Ethidium bromide stained PCR amplified fragments, electrophoresed on a 2% agarose gel. Lane 3: Marker DNA, ADNA Hindlll digest. EcoRl-digested (lanes I and 2) and undigested (lanes 4 and 5) PCR amplifications of phage DNA prepared from clones LIA (lanes 1 and 4) and L3C, with an internal EcoRl site, (lanes 2 and 5). The size of the amplified inserts is shown on the right.
final specific activity of 1.4 × 109 cpm//zg of DNA, and routinely used for Northern blotting analysis (results not shown). The polymerase chain reaction is used to amplify selectively a segment of DNA by a series of synthetic reactions with oligonucleotides are primers. By using the above-described protocol, a specific probe with the possibility directly random labelling is successfully obtained. Thus, isolation of the PCR products, after a process of amplification from a template DNA of a Agtll expression vector is not necessary to perform the random primer labelling, and a digestion with EcoRI restriction enzyme in buffer H may be achieved in the presence of PCR reaction mixture, before removal of unlabelled dCTP nucleotide by ethanol precipitation to avoid its interference by competition. Labelled specific probe is quickly obtained and may then be used, in our particular case, in Northern blotting analysis, and in general, in molecular cloning and analysis of DNA, including generation of specific probes for uncloned genes, analysis of mutations or chromosome crawling. References 1 Innis, M.A., Myambo, K.B., Gelfand, D.H. and Brow, M.A.D. (1988) DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction-amplified DNA. Proc. Natl. Acad. Sci. USA 85, 9436-9440. 2 Maniatis, T., Fritsch, E.F. and Sambrook, J. 0989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 2nd Edn., New York, 1.21-1.32 and 1.90-1.104. 3 Feinberg, P.A. and Vogelstein, B. (1984) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137, 266-267.
167
© 1992 Elsevier Science Publishers B.V. All rights reserved 0165-022X/92/$C~.00
JBBM 00929
A rapid reliable method to use specific probes labelling polymerase chain reaction (PCR) products A. Liras Istituto Nazionale Neurologico C. Besta, Milan, Italy (Received 7 October 1991) (Accepted 20 November 1991)
Summary Polymerase chain reaction (PCR) has allowed highly sensitive detection and amplification of individual DNA sequences. To generate specific probes for genes or cDNAs that have not yet been cloned, it is often necessary to label PCR products which are then used in Southern or Northern hybridizations or for screening cDNA and genomic DNA libraries. In this paper a rapid and versatile method of using PCR products, as specific probes, is described, after digestion with EcoRI in buffer H, in the presence of PCR reaction buffer, and purification of the PCR products for avoid the interference by competition of unlabelled dCTP in the directionaily random labelling. Key words: Polymerase chain reaction; Probe labelling; DNA cloning
Introduction Polymerase chain reaction (PCR) using the thermostable DNA polymerase derived from the bacterium Thermus aquaticus (Taq) [1], has allowed highly sensitive detection and amplification of individual DNA sequences. Under several conditions used to ensure the efficient amplification of the sequence to be detected, an extraordinary sensitivity and high specificity is achieved with the PCR method. Polymerase chain reaction methods have a wide range of application in research; for instance, to generate specific probes for genes or cDNAs that have not yet been cloned. It is often necessary to label PCR products, which are then used in Southern or Northern hybridizations, or for screening cDNA and genomic DNA libraries. Correspondence address: A. Liras, C / F e r r a z 114, 4°D, 28008 Madrid, Spain.
168
Here, a rapid and versatile method making use of PCR products for directionally random labelling of these fragments, after amplification, EcoRI restriction enzyme digestion and removal dCTP nucleotide, is reported.
Materials and Methods
The eDNA library for human fetal liver in the expression vector Agtll was a gift from Jan P. Kraus (Health Sciences Center, University of Colorado, Denver). EcoRI restriction enzyme and dNTPs were obtained from Boehringer Mannheim (Mannheim, Germany). Taq DNA polymerase (GeneAmp)was purchased from Perkin-Elmer Cetus Instruments. All other products were of analytical grade from Merck (Darmstadt, Germany). The first step was the amplification of phage DNA obtained from eDNA clones isolated by screening of a Agt11 eDNA library from human fetal liver by standard procedures [2]. Agt11 oligonucleotide primers used (24-mers), forward 5'd(GGTGGCGACGACTCCTGGAGCCCG)3', and reverse 5'd(TI'GACACCAGACCAACTGGTAATG)3', were synthesized using a Gene Assembler Plus (Pharmacia). Each PCR contained 25 pmol of primers, 200/~M each dNTP, 10 ng of phage DNA (clones LaC and L~A), 3 mM MgCl 2, 50 mM KCI, 10 mM Tris-HCl (pH 8.3), 0.01% gelatin, and 2.5 units of Thermus aquaticus of (Taq) polymerase, in a total volume of 100 /zl. Reactions were performed in 0.5-ml microcentrifuge tubes with the Perkin-Elmer Cetus Thermal Cycler. After a cycle of denaturation at 94°C for 3 min 30 s, primer annealing at 55°C for 2 rain 30 s, and extension at 72°C for 3 min, the thermal profile involved 24 cycles of amplification (94°C for 1 min 30 s, 55°C for 2 min 30 s, and 72°C for 3 min). 100/~l of mineral oil were added for reducing evaporation. After amplification, 100/~l of high purity chloroform were added and the aqueous phase containing the amplified DNA was removed. 20 /~l aliquots of this fraction were directly digested with 5 units of EcoRI and buffer H (50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 100 mM NaCl, 1 mM DTE) at 37°C in a 25-/~1 reaction for 2 h. EcoRI-digested PCR products were precipitated for removing soluble nucleotides (dNTPs) in 2 M ammonium acetate and 2 volumes of ice-cold ethanol in dry ice/acetone for 1 h. After centrifugation, the DNA pellet was washed once with 70% ethanol, dried and resuspended in 100 /zi of TE buffer (10 mM Tris-HC! (pH 8.0), 1 mM EDTA).
Results and Discussion
Fig. 1 shows the PCR amplified fragments electrophoresed on a 2% agarose gel after digestion, and undigested PCR products from phage DNA obtained from clones LIA (lanes 1 and 4) and L3C, with an internal EcoRI site (lanes 2 and 5). The digested PCR reaction (20-40 ng DNA inserts)was then directly radiolabelled with [a-32p]dCTP by the random primer DNA-labelling method [3] to a
169
12
3
45
hp _1786 - 1412 -
850 764
-
288
Fig. 1. Ethidium bromide stained PCR amplified fragments, electrophoresed on a 2% agarose gel. Lane 3: Marker DNA, ADNA Hindlll digest. EcoRl-digested (lanes I and 2) and undigested (lanes 4 and 5) PCR amplifications of phage DNA prepared from clones LIA (lanes 1 and 4) and L3C, with an internal EcoRl site, (lanes 2 and 5). The size of the amplified inserts is shown on the right.
final specific activity of 1.4 × 109 cpm//zg of DNA, and routinely used for Northern blotting analysis (results not shown). The polymerase chain reaction is used to amplify selectively a segment of DNA by a series of synthetic reactions with oligonucleotides are primers. By using the above-described protocol, a specific probe with the possibility directly random labelling is successfully obtained. Thus, isolation of the PCR products, after a process of amplification from a template DNA of a Agtll expression vector is not necessary to perform the random primer labelling, and a digestion with EcoRI restriction enzyme in buffer H may be achieved in the presence of PCR reaction mixture, before removal of unlabelled dCTP nucleotide by ethanol precipitation to avoid its interference by competition. Labelled specific probe is quickly obtained and may then be used, in our particular case, in Northern blotting analysis, and in general, in molecular cloning and analysis of DNA, including generation of specific probes for uncloned genes, analysis of mutations or chromosome crawling. References 1 Innis, M.A., Myambo, K.B., Gelfand, D.H. and Brow, M.A.D. (1988) DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction-amplified DNA. Proc. Natl. Acad. Sci. USA 85, 9436-9440. 2 Maniatis, T., Fritsch, E.F. and Sambrook, J. 0989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 2nd Edn., New York, 1.21-1.32 and 1.90-1.104. 3 Feinberg, P.A. and Vogelstein, B. (1984) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137, 266-267.