A role for Bach1 and HO-2 in suppression of basal and UVA-induced HO-1 expression in human keratinocytes

Free Radical Biology & Medicine 48 (2010) 196–206

Contents lists available at ScienceDirect

Free Radical Biology & Medicine j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / f r e e r a d b i o m e d

Original Contribution

A role for Bach1 and HO-2 in suppression of basal and UVA-induced HO-1 expression in human keratinocytes Julia Li Zhong 1, Chintan Raval, Gavin P. Edwards, Rex M. Tyrrell ⁎ Department of Pharmacy and Pharmacology, University of Bath, Bath BA2 7AY, UK

a r t i c l e

i n f o

Article history: Received 23 July 2009 Revised 29 September 2009 Accepted 16 October 2009 Available online 27 October 2009 Keywords: UVA HO-1 HO-2 Bach1 Nrf2 Free radicals

a b s t r a c t Ultraviolet A (UVA) radiation is an oxidizing agent that strongly induces the heme oxygenase 1 (HO-1) gene and expression of the protein in cultured human skin fibroblasts but weakly induces it in skin keratinocytes. Lower basal levels of HO-1 and much higher basal levels of HO-2 protein are observed in keratinocytes compared with fibroblasts. Using both overexpression and knockdown approaches, we demonstrate that HO-2 modulates basal and UVA-induced HO-1 protein levels, whereas HO-1 levels do not affect HO-2 levels in skin fibroblasts and keratinocytes. Silencing of Bach1 strongly increases HO-1 levels in transformed HaCaT keratinocytes and these HO-1 levels are not further increased by either UVA irradiation or silencing of HO-2. This is consistent with the conclusion that high constitutive levels of HO-2 expression in keratinocytes are responsible for the resistance of these cells to HO-1 induction by UVA radiation and that Bach1 plays a predominant role in influencing the lack of HO-1 expression in keratinocytes. Bach1 inhibition leading to HO-1 induction reduced UVA-irradiation-induced damage as monitored both by the extent of LDH release and by nuclear condensation, so that Bach1 inhibition seems to protect against UVA-irradiation-induced damage in keratinocytes. © 2009 Elsevier Inc. All rights reserved.

Heme oxygenases (mainly HO-1 and HO-2) catalyze the ratelimiting step in heme catabolism, yielding carbon monoxide, iron, and biliverdin IXa [1]. Human HO-1 (EC 1.14.99.3) is an inducible form of the enzyme and is a sensitive marker of oxidative stress, including long-wavelength UVA (320–380 nm) [2,3]. There is considerable evidence that HO-1 has cytoprotective, anti-inflammatory, and immunomodulatory properties [4]. However, expression of HO-1 may not always be beneficial. For example, overexpression of HO-1 may increase proliferation of murine melanoma cells [5] and the antiapoptotic property of HO-1 may counteract the benefits of aminolevulinic acid-based photodynamic therapy of melanoma [6]. HO-1 gene expression is regulated by the transcription repressor Bach1 (BTB and CNC homology 1) and the activator Nrf2 (erythroid 2related nuclear factor 2), which form heterodimers with Maf protein and modulate promoter activity [4,7,8]. Although Nrf2 nuclear activation was initially found to be repressed by Keap1 [9], heme can also regulate Nrf2 levels, probably by stabilization of the protein [8,10]. Heme is also able to regulate Bach1, in this case by reducing its binding to the MARE sites of the HO-1 promoter, enhancing its nuclear Abbreviations: UVA, ultraviolet A 320–380 nm; HO-1 or HO-2, heme oxygenase 1 or 2; siRNA, small interfering RNA; Bach1, BTB and CNC homology 1; MARE, Maf recognition element; Nrf2, erythroid 2-related nuclear factor 2; RT-PCR, reverse transcription PCR. ⁎ Corresponding author. Fax: +44 1225 383408. E-mail address: [email protected] (R.M. Tyrrell). 1 Current address: College of Bioengineering, Chongqing University, Chongqing 400044, China. 0891-5849/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.freeradbiomed.2009.10.037

export and promoting its degradation. Heme treatment leads to an increase in HO-1 protein levels [4,10,11]. Reducing Bach1 expression by silencing of the Bach1 gene significantly increases HO-1 gene expression in liver cells [12], and a recent study by Reichard et al. has shown the key role of this protein in HO-1 expression in keratinocytes [13]. Bach1-deficient mice show high levels of HO-1 expression in various tissues, such as lung, heart, and liver [7], and have reduced lipopolysaccharide (LPS)-induced liver injury [14]. Other inducers of HO-1, such as cobalt protoporphyrin IX, activate or induce Nrf2 in parallel with Bach1 inactivation [15]. Unlike HO-1, HO-2 is constitutively expressed, has heme-regulatory motifs involved in maintenance of intracellular heme levels, and is also a potential oxygen sensor because of cysteine motifs that are not present in HO-1 [16,17]. Although HO-2 is generally noninducible [1], HO-2 levels can be reduced during hypoxia [18] and induced by NO donors [19]. The constitutive enzyme may also be protective both in vivo and in vitro: for example, overexpression of HO-2 protects human embryonic kidney HEK293 cells against H2O2 and hemininduced cytotoxicity [20]. Down-regulation of HO-2 has been observed in human pathologic pregnancies [21] and deletion of the gene renders cells vulnerable to oxidative stressors such as heme [22]. Conversely, HO-2 overexpression in HeLa cells has been shown to confer transient hypersensitivity to UVA irradiation shortly after heme treatment [23]. There is also evidence that HO-2 gene deletion can lead to a compensatory increase in HO-1, e.g., in lung and pulmonary venous myocardium [24,25]. Down-regulation of HO-2 led to increases in HO-1 levels, whereas modulation of HO-1 levels did not

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

change HO-2 levels in HeLa cells [26] and astrocytes [27]. Nevertheless, loss of either HO-1 or HO-2 sensitizes astrocytes to oxidative membrane damage as measured by the lactate dehydrogenase (LDH) assay [22,27]. Differences between HO-1 and HO-2 expression in fibroblasts and keratinocytes have been proposed to underlie the substantial difference in the sensitivity of these cell types to oxidative membrane damage [28]. More recent findings described above led us to hypothesize that the low basal levels of free heme in keratinocytes that result from constitutively high levels of HO-2 expression may be responsible for the low levels of HO-1 gene expression in this cell type. In an in vivo model, Bach1-deficient mice demonstrated myocardial protection against ischemia/reperfusion [29], as well as reduced LPSinduced hepatic injury [14]. The purpose of the current study was to gain a clearer understanding of the interrelationship between HO-1 and HO-2 expression in skin cells, with particular focus on keratinocytes. The involvement of Nrf2 and Bach1 in HO-1 regulation was examined in a keratinocyte cell line, which, in contrast to human skin fibroblasts, has low basal and UVA-induced levels of HO-1 protein. The effects of inhibition of Bach1 on UVA-mediated cell damage were also investigated. Materials and methods Chemicals and reagents All chemicals were obtained from the Sigma–Aldrich Chemical Co. (UK) or Fisher Ltd unless otherwise stated. Phosphate-buffered saline (PBS) was obtained from Oxoid Ltd (UK). Reagents for molecular biology were obtained from Invitrogen or Promega. Anti-HO-1 (OSA110) and anti-HO-2 (OSA-200) antibodies were from Assay Design (USA). An in-house-generated rabbit polyclonal HO-2 [30] was used most of the time. Bach1 (C20, sc-14700), Nrf2 (H300, sc-13032), GAPDH (sc-20357), and tubulin (sc-9104) antibodies were obtained from Santa Cruz Biotechnology (USA). An additional antibody to Bach1 (A1-5), kindly provided by Dr. Kazuhiko Igarashi (Japan), was used for preliminary experiments. Secondary antibodies anti-goat, anti-rabbit, and anti-mouse/HRP were obtained from the Sigma– Aldrich Chemical Co. The cytotoxicity LDH assay kit was from Roche (Germany). Cell culture Human HaCaT immortalized skin keratinocytes [31] were maintained in Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% (v/v) heat-inactivated fetal calf serum (FCS), and human FEK4 primary skin fibroblasts, HFK-SV61 transformed fetal skin keratinocytes, and HeLa cervical cancer cells were maintained in Earle's modified minimal essential medium (EMEM) supplemented with 15, 10, and 10% (v/v) FCS, respectively. All media contained 2 mM L-glutamine and 50 U/ml penicillin/streptomycin [32]. Cells were maintained at 37°C in a 5% CO2/95% air humidified incubator. Treatments UVA irradiation Cells were irradiated using a broad-spectrum 4-kW UVA lamp (340–400 nm; Sellas, Munich, Germany). The lamp exposure time was calculated using an IL1700 radiometer (International Light Technologies, Peabody, MA, USA) with an SEE400 probe. Before UVA irradiation, the growth medium was removed from the cells and retained; each dish was washed twice with PBS. Cells were then covered with PBS supplemented with 0.01% Ca2+ and 0.01% Mg2+ before irradiation. To maintain a consistent temperature of 25°C throughout the irradiation procedure, irradiation was conducted in an air-conditioned room. The Ca2+/Mg2+-supplemented PBS was removed after irradiation and 1.5%

197

(v/v) FCS–EMEM or 1% (v/v) FCS–DMEM was added back to the FEK4 and HaCaT cells, respectively. Control cells underwent identical treatment, except that they were not irradiated (sham, 0 kJ/m2). Hemin treatment Heme (iron ferrous protoporphyrin IX) treatment was achieved by using hemin (iron ferric protoporphyrin IX), which was dissolved in dimethyl sulfoxide (DMSO). Subconfluent HaCaT cells were incubated with hemin in 1% (v/v) FCS–DMEM for 16 h. Control cells were treated with the same final maximal concentration of DMSO [less than 0.2% (v/v) in medium]. RNA isolation, reverse transcription, and quantitative real-time PCR Total RNA was collected from sham- and UVA-irradiated cultured skin cells using an RNA extraction kit, following the supplier's instructions. RNA samples were quantified by the standard absorbance at 260 nm. Reverse transcription by Superscript III (Invitrogen) was performed using 1 μg of RNA with the first-strand cDNA synthesis kit using oligo(dT). Quantitative real-time PCR primers were as follows: HO-1, forward, AAGAGGCCAAGACTGCGTTC; reverse, GGTGTCATGGGTCAGCAGC; and GAPDH, forward, GACATCAAGAAGGTGGTGAA; reverse, TGTCATACCAGGAAATGAAG. RT-PCR was carried out with a Roche LightCycler 1.5 instrument using the SYBR green assay (Roche). A standard curve was created using serial dilutions of a pooled sample of cDNA. Gene expression levels are presented in arbitrary units normalized to the expression of the housekeeping gene GAPDH [33]. Transient transfection Cells were seeded into six-well plates 40 h before transfection to reach 60% confluency and then transfected with pcDNA3.1-HO-1 and its control vector (both kind gifts from Professor Roland Stocker, Medical Foundation Building, The University of Sydney, Australia) using the transfection reagent Lipofectamine 2000 (Invitrogen), in a 1:2 volume ratio (DNA:Lipofectamine) at room temperature according to the manufacturer's instructions. The DNA–Lipofectamine complex was incubated with cells in Optimum (OPT) medium (Invitrogen) for 6 h and then replaced with growth medium for a further 40 h before UVA irradiation. The transfection efficiency was ∼30%. RNA interference All small interfering RNAs (siRNAs), silencer β-actin siRNA (siβ-actin, AM4607), silencer GAPDH siRNA (siGAPDH, AM4624), and silencer negative controls (scrambled control, Sb), were from Ambion except for an additional scrambled control derived from an siRNA pool (D-001206-13-05), which was from Dharmacon. The specific siRNA sequences and their IDs and targeting exons are shown in Table 1. Subconfluent cells were detached and transfected with siRNAs using the siPORT NeoFX transfection agent (AM4511; Ambion). For HaCaT cells, siRNA was diluted in 75 μl OPT medium, and 3 μl NeoFX was added to 75 μl OPT medium, and the samples were incubated 10 min at room temperature, then mixed well, and incubated at room temperature for a further 10 min to allow the formation of siRNA complexes. The siRNA complexes were then placed in one well of a six-well plate and 1.5 ml of the normal cell growth medium containing 0.6–1 × 105 cells was added to give a total volume of 1.65 ml. For FEK4 cells, 200 μl of the siRNA complex (4 μl NeoFX in 100 μl of OPT medium + siRNA in 100 μl OPT medium) was added to a 60-mm plate with 2 × 105 cells in 2 ml of the normal cell grown medium to give a total volume of 2.2 ml. The next day, 0.5 volume of fresh medium was added and the cells were incubated until further treatment.

198

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

Table 1 siRNA sequences used in this study

siHO2: NM_002134 No. 1, exon 3 No. 2, exons 3, 4 siHO1: NM_002133 No. 1, exon 5 No. 2, exon 2 siNrf2: NM_006164 No. 1, exon 5 No. 2, exon 3 siBach1: NM_001011545 No. 1, exon 3 No. 2, exon 5

ID

Sense (5′–3′)

Antisense (5′–3′)

11243 117046

GGACAUGGAGUAUUUCUUUtt CCAAAGAGAGGAUCGUGGAtt

AAAGAAAUACUCCAUGUCCtt UCCACGAUCCUCUCUUUGGtc

11242 11056

GGCCUUCUUUCUAGAGAGGtt GGCAGAGAAUGCUGAGUUCtt

CCUCUCUAGAAAGAAGGCCtt GAACUCAGCAUUCUCUGCCtg

115764 115763

CCUUAUAUCUCGAAGUUUUtt GCUUUUGGCGCAGACAUUCtt

AAAACUUCGAGAUAUAAGGtg GAAUGUCUGCGCCAAAAGCtg

115188 115189

GCCUUUGUCAGGUACAGACtt CCAUCUAAUUUUCUCCUGAtt

GUCUGUACCUGACAAAGGCtt UCAGGAGAAAAUUAGAUGGtt

Western blotting After treatment, proteins were prepared for Western blotting as previously described [34]. Total protein lysate (30–60 μg according to the experiment) was separated by 8% (for Bach1, 1:300, and Nrf2, 1:200) or 10% (for HO-1, 1:200; HO-2, 1:1000; GAPDH, 1:2000; actin, 1:2500) SDS–PAGE or, in some experiments, on 4–15% gradient gels (Bio-Rad), transferred to PVDF (Millipore) membranes, and blocked with 5% (w/v) nonfat milk in PBS containing 0.1% (v/v) Tween 20 for 1 h at room temperature. The blots were then probed with the indicated antibodies (overnight at 4°C or 1.5 h at room temperature) before proceeding to the wash steps. Appropriate HRP-conjugated secondary antibodies were added for 1 h, and then the blots were washed extensively for 1 h. Immunoreactive proteins were visualized by the ECL Western blot detection system (Amersham Biosciences) using autoradiographic films. PVDF membranes were cut into upper (for Bach1 or Nrf2) and lower parts (for HO-1, HO-2, tubulin, actin, or GAPDH). In some cases, membranes were stripped and reprobed. If required, a second Western blot was carried out using the identical protein lysate. The intensity of the bands was quantified by digital densitometry using NIH ImageJ 1.33 software. Data were normalized to actin and expressed as the percentage or fold change compared with the corresponding control, which was set to 1 or 100. Immunocytochemistry Cells grown on glass coverslips were washed twice with PBS, fixed with 4% (w/v) paraformaldehyde for 10 min at room temperature, and then permeabilized with ice-cold methanol for another 10 min followed by two washes with PBS. The cells were then blocked with Image-iT Fx signal enhancer (Alexa-Fluor system; Invitrogen) and incubated at room temperature for 1 h with the primary antibody Nrf2 (1:200), washed twice in PBS for 30 min, then incubated with secondary antibody Alexa-Fluor 488-conjugated goat anti-rabbit IgG (1:1000; Invitrogen) for 1 h, washed again in PBS, and mounted onto glass microscope slides using Vectashield Hard_Set mounting medium with DAPI (Vector Laboratories, USA). The cells were analyzed at 40× magnification on a Nikon Eclipse TE2000-U epifluorescence microscope. Images were recorded using the software program UltraVIEW. Condensed apoptotic nuclei in blue (DAPI) were counted in 10 randomly chosen microscope fields. Apoptotic cell death was then calculated as a percentage of apoptotic cells over the total blue protein-positive cells and expressed as fold change compared with the corresponding control, which was set to 1. LDH levels The levels of extracellular LDH were determined using the cytotoxicity detection kit for LDH (Roche Applied Science). Six thousand cells per well were transfected with siRNAs and seeded on 96-well microplates and, 48 h later, they were UVA irradiated and reincubated

for 6 h. Fifty microliters of supernatant per well was carefully removed and transferred into corresponding wells for determination of extracellular LDH levels. Then, 50 μl of DMEM with 2% Triton X-100 was added to the 50 μl of assay medium for the adherent cells. Fifty microliters was transferred to a 96-well microplate to determine LDH levels by adding 50 μl of reaction mixture to each sample and incubating for 30 min at room temperature. Optical density was measured using a microplate reader (ELISA), at 490 and 600 nm. The fraction of extracellular LDH was represented as fold increase over control, scrambled sham-treated cells, which was set to 1. Statistical analyses Statistical analyses were carried out using a two-tailed t test and P values below 0.05 were considered statistically significant. The values in the graphs correspond to the mean and the error bars indicate standard error (SE). Results Expression of HO-1, HO-2, Bach1, and Nrf2 protein in FEK4 and HaCaT cells and time and dose dependence of UVA induction of HO-1 HO-1, HO-2, Bach1, and Nrf2 protein expression levels were examined in the human skin keratinocyte line HaCaT and the human fibroblast line FEK4 by Western blotting using 60 μg of total protein. The two cell lines were maintained in culture for similar lengths of time and grown to similar confluencies. HaCaT keratinocytes showed 4.4-fold less HO-1 and 3.3-fold more HO-2 (P b 0.05) compared with FEK4 cells (Fig. 1A). This is consistent with our previous finding that primary skin keratinocytes express much higher levels of HO-2 mRNA but negligible HO-1 mRNA levels compared with primary skin fibroblasts derived from the same biopsy [28]. HaCaT cells contained twice the level of Bach1 and half the level of Nrf2 protein (P b 0.05) as that observed in FEK4 cells. HO-1 is highly inducible by a large number of physical and chemical agents, including UVA irradiation in human skin fibroblast FEK4 cells [2,3], but UVA radiation is a weak inducer of HO-1 in skin keratinocytes [28,35]. To further illustrate this, the skin keratinocyte cell line HaCaT and the skin fibroblast cell line FEK4 were exposed to an environmentally relevant dose of 250 kJ/m2 UVA radiation and changes in HO-1 mRNA accumulation and protein expression were measured 4 and 8 h after UVA irradiation, respectively (Fig. 1B). UVA irradiation induced a 3-fold increase in HO-1 mRNA accumulation in HaCaT skin keratinocytes and a 15- to 20-fold increase in FEK4 fibroblasts (Fig. 1B, top). Correspondingly low and high levels of UVA-induced expression of HO1 protein were observed in HaCaT (2-fold) and FEK4 (approximately 10fold) cells, respectively (Fig. 1B, bottom). UVA irradiation induced a nearly 6-fold increase in mRNA accumulation and a 3-fold increase in levels of HO-1 protein in a second keratinocyte line, HFK-SV61 (Supplementary Fig. 1). The low basal and UVA-induced HO-1

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

199

Fig. 1. (A) Basal expression of HO-2, HO-1, Bach1, and Nrf2 in skin cells and (B) UVA-induced HO-1 in skin cells. Total cell lysates (60 μg) obtained from subconfluent HaCaT and FEK4 cells were subjected to Western blotting and probed with anti-human HO-1, HO-2, Nrf2, Bach1, and tubulin antibodies as described under Materials and methods. Quantification of the optical densities of the bands was carried out using ImageJ. HO-1, HO-2, Bach1, and Nrf2 signals were normalized to the tubulin signal. Relative expression levels are shown above the images. Values for HaCaT cells were set to 100. Data are presented as means ± SE (n = 4). ⁎P b 0.05, ⁎⁎P b 0.01. (B) Subconfluent HaCaT and fibroblast FEK4 cells were either sham irradiated (0 kJ/m2) or irradiated with UVA (250 kJ/m2). Cells were collected 4 (mRNA) and 8 h (protein) after UVA irradiation. Total RNA was extracted and subjected to reverse transcription and PCR using a LightCycler. Relative mRNA accumulation was quantified using the software program LightCycler 4.0, as described under Materials and methods. HO-1 mRNA levels were normalized to GAPDH mRNA and the relative fold induction of HO-1 (relative to the sham-irradiated control) is shown in the bar graph as the mean ± SE (n = 4). ⁎P b 0.05, ⁎⁎P b 0.01 vs sham control. Total protein (40 μg) was subjected to Western blot analysis using anti-HO-1 and actin antibodies (insets), as described under Materials and methods. HO-1 signal was normalized to the actin signal. The expression levels of HO-1 as fold induction relative to the sham-irradiated control (set to 1) are shown in the bar graph. Data are presented as means ± SE (n = 4). ⁎P b 0.05, ⁎⁎P b 0.01 vs sham control. (C) Time and dose response of UVA induction of HO-1 in HaCaT cells. (Left) Untreated (UT), sham, and 250 kJ/m2 UVA-irradiated subconfluent HaCaT cells were collected at 2, 4, 8, and 16 h after irradiation. (Right) Irradiated cells were collected 8 h after irradiation. For each sample, 40 μg of total protein was subjected to Western blot analysis and probed with anti-HO-1, HO-2, and actin antibodies. The expression of HO-1 was normalized and is shown in the bar graph as described above. Data are means ± SE. ⁎P b 0.05 vs sham control.

expression observed in keratinocyte cell lines compared with fibroblasts is supported by our previous observations in primary keratinocyte cell lines [28] and recent studies by Marrot et al. [35]. The properties of the HaCaT cell line are more similar to those of primary keratinocytes with respect to the low basal and UVA-induced HO-1 levels compared to the HFK-SV61 cell line (results not shown), so that the former was used as the model cell line in this study.

After treatment with 250 kJ/m2 UVA irradiation, HO-1 protein also increased in a time-dependent manner and reached a peak at 8 h after irradiation. After 16 h, a decline in protein levels was observed but residual levels were still higher than in untreated cells (Fig. 1C). An 8 h postirradiation period was therefore chosen for all subsequent measurements. Both 250 and 500 kJ/m2 doses induced HO-1 protein 8 h after UVA treatment (Fig. 1C). The environmentally relevant dose

200

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

of 250 kJ/m2 was chosen as the standard dose for all further irradiation experiments unless otherwise stated. HO-2 was not inducible in either HaCaT (Fig. 1C) or FEK4 cells (see Fig. 3) by UVA radiation, consistent with the observation that the HO-2 gene is not inducible by various types of oxidative stress in cultured skin cells ([28] and unpublished data). The relationship between HO-1 and HO-2 protein levels in skin cells Although the relationship between HO-1 and HO-2 levels has been studied in cell lines such as HeLa [26], the relationship between HO-1 and HO-2 protein levels is yet to be investigated in skin cell lines in which a reciprocal relation between HO-1 and HO-2 expression is observed. Down-regulation of HO-2 increases basal and UVA-induced levels of HO-1 protein HO-2 protein levels were lowered in HaCaT cells using RNA interference with two specific short interfering HO-2 RNAs (siHO2) targeting two different exons (see Materials and methods). To achieve maximum knockdown with minimum cytotoxicity, a range of siHO2

concentrations was tested using 64 h exposure (No. 1, Fig. 2A, left), and transfection periods between 24 and 72 h were tested using a concentration of 50 nM siHO2 (No. 2, Fig. 2A, right). These two siHO-2 reagents led to a reduction in HO-2 protein of more than 80% and a statistically significant (P b 0.05) increase in HO-1 protein of nearly twofold using 50 nM siHO2 and 48- to 64-h transfection periods (Fig. 2A), without affecting Bach1 or Nrf2 protein levels (data not shown). HO-1 and HO-2 protein levels did not change in a positive silencer control GAPDH (siGAPDH)-transfected HaCaT cell population and a less than 15% reduction in cell growth and cell death occurred with all siRNA concentrations lower than 100 nM (data not shown). This confirms that the silencing of the HO-2 gene using siRNA targeted to HO-2 was effective, specific, and selective. This finding is in agreement with previous data indicating that a reduction of ∼80% in HO-2 levels increases HO-1 protein by threefold in HeLa cells [26] and demonstrates that down-regulation of HO-2 increases basal expression of HO-1 in HaCaT cells. Next we studied the influence of reduced HO-2 protein levels on UVA-induced HO-1 protein levels. HaCaT cells were exposed to 50 nM siHO2 for 64 h and then UVA irradiated, and the HO-1 levels were measured 2, 4, and 8 h posttreatment. In addition to the twofold increase in basal HO-1 level observed in HaCaT cell populations in

Fig. 2. Silencing of HO-2 protein increases HO-1 protein levels in HaCaT cells: combined effects of siHO2 and UVA irradiation on HO-1 levels in HaCaT cells. (A) HaCaT cells were transfected with vehicle control, negative scramble control siRNA (Sb), No. 1 siHO2 (left), and No. 2 siHO2 (right), using siPORT NeoFX transfection reagent (Ambion) as described under Materials and methods, with the siRNA concentrations and culture times indicated. (B) HaCaT cells were treated with vehicle control (-), 50 nM scramble control siRNA (Sb), or 50 nM siHO2 (No. 1 or 2) and cultured for 64 h (determined and described as for A) and then sham or UVA irradiated. Cell lysates were collected 2, 4, and 8 h after irradiation. Western blot analysis of 40 μg total protein was carried out with the antibodies shown. The intensity of the signal for HO-1 and GAPDH was normalized with respect to the intensity of the actin signal. Relative expression levels of HO-1 protein are shown in the bar graph as the ratio of the normalized value relative to the vehicle (non-siRNA or scrambled controls), which was set to 1. Values are means ± SE (n = 4). ⁎P b 0.05, vs relevant scrambled control.

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

201

which HO-2 protein was reduced to 20% of normal levels, 8 h after UVA irradiation HO-1 protein increased a further twofold to give a total of fourfold HO-1 induction (P b 0.05). HO-1 induction was higher than at either 2 or 4 h after UVA irradiation alone, implying an additive effect of the two (siHO2 and UVA irradiation) treatments on HO-1 induction (Fig. 2B) and indicating that down-regulation of HO-2 increases UVA-induced HO-1 protein in HaCaT cells. Overexpression of HO-1 in HaCaT cells increased UVA-induced HO-1 levels but HO-2 remained the same (Supplementary Fig. 2), indicating that expression of HO-1 does not influence HO-2 levels [36]. The effect of overexpression HO-2 in FEK4 fibroblasts was not examined, but a HeLa cell line (9D5) that stably overexpresses HO-2 (i.e., an approximately ninefold increase in HO-2 protein) demonstrated a twofold decrease in basal levels of HO-1 and a twofold decrease in UVA-induced HO-1 protein levels compared with the parental HeLa cell line (Supplementary Fig. 3). Down-regulation of HO-1 reduces UVA-induced HO-1 levels but not HO-2 levels in fibroblasts Reduction of HO-1 generally does not affect HO-2 levels in various cell lines (for examples, see Refs. [26,27,36–38]). FEK4 fibroblasts have severalfold (4.4-fold) higher levels of HO-1 protein compared with HaCaT cells (Fig. 1A). The effect of reducing HO-1 levels on HO-2 and UVA-induced HO-1 levels was examined in fibroblast populations. FEK4 fibroblasts were treated with two different siRNAs targeting HO-1 at 50 nM (see Materials and methods), which reduced HO-1 protein levels to less than 20% of basal values. This led to a significant reduction (N70%) of UVAinduced HO-1 levels 8 h after UVA irradiation compared with the scrambled- and vehicle-treated controls (2.5-fold vs 9.5-fold, P b 0.001). However, the low HO-2 levels do not change and seem to be entirely independent of the HO-1 protein level (Fig. 3). Reducing HO-1 protein levels in HaCaT cells also reduces basal and UVA-induced HO-1 but does not affect HO-2 protein levels [56]. In summary, changes in HO-1 levels change UVA-induced HO-1 expression but not HO-2 levels in FEK4 cells. Nrf2 involvement in HO-1 induction in HaCaT cells Nrf2 is a potent inducer of cytoprotective genes and there are many reports demonstrating that Nrf2 is involved in HO-1 induction (reviewed by Alam et al. [4]). Nrf2 is increased within a few hours after UVA irradiation of murine dermal fibroblasts [39]. Nrf2 is also increased in the human skin fibroblast line FEK4 by UVA treatment [56]. However, Nrf2 was either not increased or only slightly increased by UVA irradiation in keratinocytes [35,41]. We first verified the lack of Nrf2 inducibility after UVA irradiation. Using Western blotting, basal levels of Nrf2 protein were detected with 30 μg of whole-cell lysate, but the change in Nrf2 protein levels after UVA treatment observed in fibroblasts was not observed in HaCaT cells (Fig. 4A, top). Immunostaining demonstrated Nrf2 protein in the nucleus of shamirradiated control cells (basal) or in cells observed 2 (Fig. 4A, bottom), 4, and 8 h (data not shown) after UVA irradiation. Silencing of Nrf2 decreases basal levels of HO-1 mRNA [35,42], although no reduction in HO-1 protein was detected [40]. We examined the influence of reduced Nrf2 protein levels on basal and UVA-induced HO-1 levels in keratinocytes employing two different siRNA Nrf2 (siNrf2) reagents (see Materials and methods). Treatment with siNrf2 No. 1 at 10 and 50 nM concentrations led to a 50 and 80% reduction in Nrf2 protein in HaCaT cells, respectively. This results in an apparent reduction of both basal expression and UVA-induced HO-1 protein expression levels at 4 (data not shown) and 8 h post-UVA irradiation (Fig. 4B). SiNrf2 No. 2 showed a similar result (data not shown). The result is not quantifiable because of both low basal expression and low UVAinduced HO-1 levels.

Fig. 3. Effects of silencing HO-1 on HO-2 expression and UVA-induced HO-1 expression levels in FEK4 fibroblasts. FEK4 cells were treated with 50 nM No. 1 or 2 siHO1, 50 nM scrambled siRNA (Sb), or vehicle control (-) as described under Materials and methods. Cells were grown for 64 h to reach subconfluency and then sham or UVA treated. Cells were collected 8 h after irradiation, 40 μg total protein lysates was subjected to Western blot analysis, and HO-1 protein levels were normalized as described. Values are means± SE (n = 4). ⁎⁎P b 0.01 vs vehicle control (for No. 1, set to 1) and scrambled control siRNA (for No. 2).

Moderate doses of UVA induced high levels of HO-1 in FEK4 and low levels in HaCaT cells, consistent with the higher and lower levels of Nrf2 protein observed in FEK4 and HaCaT, respectively. In contrast, a high level of HO-1 induction by heme (achieved by hemin treatment) has been well demonstrated in both HaCaT [36] and FEK4 cells [43], as well as many other cell lines. We have proposed that microsomal heme release may be involved in UVA induction of HO-1 in FEK4 cells [44]. Treatment of HaCaT cells with hemin in the concentration range 2 to 20 μM for 16 h increased HO-1 in a concentration-dependent manner and this paralleled the slight increase in nuclear accumulation of Nrf2 shown by immunostaining (data not shown). It is worth noting that hemin treatment slightly increases nuclear Nrf2 accumulation in HaCaT cells, whereas it reduces Bach1, as shown by Western blotting [40], and silencing of Nrf2 reduced hemin-induced HO-1 in KCL22 leukemia cells [42]. Because the effect of Nrf2 on UVA-induced HO-1 in HaCaT cells is not entirely clear, we measured Nrf2 involvement in heme-induced HO-1 protein expression. Whole-cell extracts were analyzed by Western blotting. The results in Fig. 4C demonstrate that 10 and 50 nM No. 2 siNrf2 treatment resulted in a reduction in endogenous (whole-cell) Nrf2 protein to ∼50 and ∼20% of control levels, respectively, and reduced basal levels of HO-1 and hemin-induced (concentration-dependent, P b 0.05) HO-1 levels. Using No. 1 siNrf2 led to a similar result (data not shown). Bach1 involvement in HO-1 induction in HaCaT cells Reduction of Bach1 levels by RNA interference increased HO-1 levels severalfold in hepatoma cells and hemin treatment led to a further increase in levels of the protein [12]. Bach1 knockdown also

202

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

Fig. 4. The effects of Nrf2 knockdown on basal and UVA-induced HO-1 and HO-2 levels and modulation of HO-1 by hemin in HaCaT cells. Sham and UVA-irradiated subconfluent HaCaT cells were collected at the indicated times after UVA irradiation. (A) Western blotting (top) was performed as described before. (Bottom) Cells grown on coverslips were collected and fixed and then permeabilized and immunostained with anti-Nrf2 antibody (1:200, green) for sham or UVA-irradiated (2-h posttreatment induction) samples as described under Materials and methods. DAPI (blue) was used to visualize the nuclei. (B) HaCaT cells were treated with vehicle (-), scramble siRNA (Sb), or 10 or 50 nM No. 1 siNrf2 as described under Materials and methods and cultured for 64 h to reach subconfluency and then sham or UVA irradiated. Lysate was collected at the times indicated after irradiation. Total proteins (30 μg) were subjected to Western blot analysis with anti-HO-1, Nrf2, and actin antibodies. One of three representative experiments is shown. (C) HaCaT cells were transfected with vehicle control (-), 50 nM scrambled control (Sb), or 10 or 50 nM No. 2 siNrf2 and grown for 48 h to reach subconfluency and then treated with DMSO and 5 or 15 μM hemin for 16 h as described under Materials and methods. Western blot analysis of 40 μg of lysate was carried out with the antibodies indicated. HO-1 protein levels were normalized and shown as described. The value for the DMSO vehicle control (-) was set to 1. Values are means ± SE (n = 4). ⁎P b 0.05, ⁎⁎P b 0.01 vs its relevant scrambled control siRNA.

strongly increases both basal and UVA-induced HO-1 protein levels in FEK4 cells (unpublished results). HaCaT cells were treated with 2 and 10 nM concentrations of Bach1 siRNA (No. 1) for 64 h, which reduced Bach1 protein levels to 50 and 20% of basal levels, respectively (Fig. 5A). This led to a significant increase in HO-1 protein, from a few fold (2 nM) to ∼20fold (10 nM), consistent with the recent studies by Reichard et al. [13] and MacLeod et al. [45], who demonstrated that siBach1 significantly increased basal levels of HO-1 protein and mRNA by 30- and over 100fold, respectively. UVA irradiation after siBach1 treatment did not lead to a significant additional increase in HO-1 levels compared with siBach1 alone. Despite a large increase in HO-1 protein levels

observed under these conditions, HO-2 levels did not change (Fig. 5A). A similar result was obtained with No. 2 siBach1 (data not shown). We also examined the effect of combining siHO2 and siBach1 treatments on HO-1 levels in HaCaT cells. Cells were treated with a 50 nM concentration of siHO2 combined with various concentrations of No. 2 siBach1 (1, 3, and 10 nM) for 48 h. Fig. 5B shows that at a low siBach1 concentration (1 nM), at which Bach1 inhibition is partial, there was a slight increase in HO-1 levels by siHO-2 treatment in addition to that caused by the partial inhibition of Bach1. However, at higher concentrations of siBach1 (80% inhibition of Bach1 expression), siHO2 did not lead to an increase in HO-1 protein beyond that

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

203

Discussion

Fig. 5. The effect of siBach1 either alone on UVA-induced HO-1 expression levels or combined with siHO2 on basal levels of HO-1 expression in HaCaT cells. (A) HaCaT cells were treated with vehicle (-), 10 nM scrambled control siRNA (Sb), or 2 or 10 nM No. 1 siBach1 as described under Materials and methods for 64 h and then either sham or UVA irradiated. Cells were collected 8 h after UVA irradiation. (B) HaCaT cells were treated with vehicle (-), 10 nM scrambled control siRNA (Sb), or 1 (+), 3 (++), or 10 nM (+++) No. 2 siBach1 alone or combined with 50 nM siHO2 and cells were grown for 48 h before collection. In both (A) and (B), 40 μg total protein lysate was subjected to Western blotting analysis with the antibodies indicated. A typical experiment of three replicates is shown. HO-2 antibody was from Assay Design (USA; 1:3000). HO-1⁎ indicates saturated HO-1 signal. HO-1 protein was normalized as described for Fig. 1A. Values are means ± SE (n = 3). ⁎P b 0.05, ⁎⁎P b 0.01 vs scrambled control siRNA (Sb).

induced by siBach1 alone (Fig. 5B). A similar result was observed with No. 1 siBach1 (data not shown). Silencing of Bach1 reduces UVA-induced membrane damage in HaCaT cells In HaCaT cells, Bach1 inhibition leads to a greater than 20-fold increase in HO-1 protein so that we examined if this increase in HO-1 protects cells against UVA-mediated cell death. Loss of plasma membrane integrity, a hallmark of cell death, was quantified by measuring release into the culture medium of cytosolic LDH and by counting apoptotic cells (as determined by nuclear condensation and fragmentation after DAPI staining). Exponential growth phase HaCaT cells treated with scrambled siRNA and siBach1 were irradiated with 250 and 500 kJ/m2 UVA and reincubated for 6 h. As shown in Fig. 6, siBach1 pretreatment did not change basal LDH release, but UVA irradiation caused significant LDH release, and this was reduced by pretreatment with siBach1, although the significant reduction in LDH release was found only at a high UVA dose of 500 kJ/m2 (P b 0.05). To investigate the effect of siBach1 on UVA radiation-induced apoptosis of HaCaT keratinocytes, cells were treated with siRNA and then UVA irradiated and, 8 h later, fixed and stained with DAPI using chromatin condensation as a marker for apoptosis. As shown in Fig. 7, pretreatment with siBach1 at 2 and 10 nM did not cause significant cell death (Figs. 7A, left, and 7B) but apoptosis induced by 500 kJ/m2 UVA irradiation was significantly reduced by siBach1 (10 nM) pretreatment compared with scrambled control (P b 0.05; Figs. 7A, right, and 7B).

In this study, we have shown the relationship between HO-1 and HO-2 protein levels in human epidermal skin cells and their interaction with UVA radiation. We found that both Bach1 and HO-2 are responsible for the low levels of both basal and UVA-induced HO-1 expression in the skin keratinocyte cell line HaCaT. This is consistent with our earlier hypothesis that these low levels were linked to the high levels of the constitutively expressed HO-2 enzyme in this cell type [28]. Previous studies by Sun et al. [7,10] showed that the suppression of HO-1 accumulation by the stabilized binding of Bach1 to the key regulatory elements in the promoter under low heme conditions seems to be the major factor in preventing inducible HO-1 gene expression. Recent studies by Reichard et al. [13] and MacLeod et al. [45] have also shown that Bach1 suppresses HO-1 expression in HaCaT cells. We have demonstrated a relationship between HO-1 and HO-2 protein levels, using overexpression and knockdown methodology. Silencing of HO-2 expression leads to an enhancement in the basal levels of expression of HO-1 and to higher UVA-induced levels in the transformed keratinocyte HaCaT model. We propose that, taken together, these changes reflect the lower levels of free heme in cells that have higher levels of HO-2 activity, because low heme will result in both suppression of the Nrf2 transcriptional pathway and strengthening of the suppressor activity of the Bach1 DNA binding protein. Although the levels of free heme are difficult to quantify and were not measured in this study, Kvam et al. [44] demonstrated that the level of heme released by various treatments correlated strongly with the relative level of HO-1 mRNA accumulation induced in FEK4 cells. Epidermal keratinocytes in the upper layer of human skin are exposed to higher levels of the oxidizing solar ultraviolet (mostly UVA) radiation than dermal fibroblasts and show much greater UVA resistance. This resistance is associated with a higher antioxidant capacity of these cells, a significant part of which may be provided by high levels of HO activity contributed by the constitutively expressed HO-2 enzyme [28]. We have hypothesized that this high constitutive HO-2 activity may dampen the induction of HO-1 activity, which is highly inducible in skin fibroblasts (expressing low levels of HO-2) and this study provides evidence in support of this. First, we have demonstrated that in a cell line (HeLa) overexpressing HO-2 protein ninefold, both the basal and the UVA-

Fig. 6. Inhibition of Bach1 increases HaCaT cell resistance to UVA-mediated membrane damage. Cells were treated with vehicle (-) or scrambled siRNA control (0) or siBach1 for 48 h and then sham and UVA irradiated as for Fig. 4. At 6 h after UVA irradiation, LDH was detected using an LDH assay kit (Roche) and expressed as relative fold increase compared with the vehicle-treated sham-irradiated control (-) (set to 1). Values are means ± SE (n = 4). ⁎P b 0.05 compared with its vehicle or scrambled control.

204

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

Fig. 7. Inhibition of Bach1 increases HaCaT cell resistance to UVA-mediated apoptosis. (A) Cells were treated with scrambled siRNA control or siBach1 and grown on coverslips for 48 h and then sham or UVA irradiated (250 and 500 kJ/m2) as for Fig. 4. At 6 h after UVA irradiation, coverslips were collected and fixed and then permeabilized and stained with DAPI and nuclear condensation was counted as described under Materials and methods. (B) The relative increase in condensed and fragmented nuclei is expressed as relative fold increase compared with the scrambled sham-irradiated control (set to 1). Values are means ± SE (n = 4).

induced expression of HO-1 is reduced substantially compared with a cell line with normal levels of expression. Second, knockdown of HO-2 protein levels by two different HO-2 siRNA reagents increases basal levels of HO-1 expression twofold, and UVA treatment increases expression further, leading to levels of expression fourfold higher than basal. The result in untreated cells is in agreement with that of Ding et al. [26], who observed enhanced basal levels of HO-1 expression in both human cervical carcinoma (HeLa) and hepatoma (HepG-2) cells after HO-2 knockdown. However, such a compensatory mechanism does not seem to be common to all cell types. For example, although HO-2 deletion in astrocytes leads to an increase in sensitivity to hemin that can be rescued by artificially increasing HO-1, there is no compensatory increase in HO-1 [22]. HO-2 deletion also compromises the epithelial response to injury with no apparent compensatory increase in HO-1 levels [46]. Although heme oxygenase 1 seems to be involved in the regulation of both iron and heme homeostasis, only heme seems to be directly involved in its regulation. For example, total suppression of UVA-induced release of free iron by epicatechin does not alter UVA induction of HO-1 [47]. Interestingly Bach1 seems to be involved in the induction of transcriptional regulation of both heme oxygenase 1 (e.g., this paper) and ferritin [48], and the release of

free iron by heme oxygenase 1 has been implicated in the upregulation of ferritin [49]. In broad agreement with previous studies in other cell types [26,27,37,50], we show that increasing basal levels of HO-1 protein by transient overexpression of HO-1 in HaCaT or decreasing HO-1 levels in FEK4 fibroblasts has no effect on HO-2 expression, whereas reduction of HO-2 does affect HO-1 levels. An apparent exception to this is where HO-1 induction by tin mesoporphyrin resulted in HO-2 repression in NIH3T3 cells [51]. We have found no evidence for this in skin cells. HO-1-deficient mice suffer severe anemia and iron deposits, whereas human HO-1 deficiency is characterized by hypobilirubinemia, anemia, and iron deposits in the liver [52,53]. Up-regulation of HO-1 reduces endothelial cell damage in diabetic rats [50] and genetic suppression of HO-1 increases renal damage in rats [37]. Both these in vitro and in vivo findings indicate that HO-1 is vital for survival and the severity of HO-1 deletion may partly be due to a lack of a significant compensatory increase in HO-2. In contrast to HO-1−/− mice, HO-2−/− mice are fertile and survive for at least a year under normal conditions [54], possibly because a compensatory mechanism is in place when HO-2 is absent. These results indicate that a lack of HO-1 will have a more significant biological impact than a lack of HO-2 with regard to survival.

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

Heme levels seem to influence HO-1 expression in part by stabilizing Nrf2, a key transcriptional activator, which permits its translocation to the nucleus. Nrf2 is intimately involved in cellular protection against oxidative stress because it acts via the antioxidant response element to induce several phase II detoxifying and antioxidant enzymes [4,55]. In this study we observed that HaCaT cells not only have a lower level of total cellular Nrf2 but also have lower UVA inducibility of this protein compared with human fibroblasts [56]. This is consistent with the low levels of UVA-induced HO-1 protein in this human keratinocyte cell line, so that keratinocytes may have developed mechanisms (such as constitutively high levels of HO-2) to prevent Nrf2 activation, as proposed by Durchdewald et al. [41]. The significance of Nrf2 involvement in HO-1 induction in HaCaT cells was confirmed by showing that siNrf2 reduces heme-induced HO-1 levels. The involvement of Nrf2 in basal levels of expression of HO-1 remains difficult to determine, because of both the sensitivity of the assays employed and the cell-type differences [40,42,45]. In certain cases, silencing of Nrf2 does reduce the basal levels of HO-1 mRNA accumulation [42,45]. We have strong evidence that Nrf2 affects both basal and induced HO-1 protein levels in HaCaT cells in our experimental setup (this study) and in FEK4 fibroblasts [56]. Although the low levels of basal and induced expression of HO-1 in HaCaT cells seem to depend on Nrf2, and knocking down HO-2 expression is able to enhance these effects, the dominant factor affecting HO-1 expression in HaCaT seems to be the suppression mediated by Bach1. Under knockdown conditions of low Bach1 protein levels, the increase in basal levels of HO-1 mRNA and protein is dramatic, a finding supported by recent studies of Reichard et al. [13] and MacLeod et al. [45]. In fibroblasts, UVA treatment further increases the expression of HO-1 in siBach1-treated cells (unpublished results); but in keratinocytes, UVA does not lead to a further significant increase over siBach1 treatment alone. It is possible that the effect of reducing Bach1 levels on the expression of HO-1 is so large that it will mask the small additive affect of UVA irradiation. Interestingly knockdown of HO-2 protein in addition to knockdown of Bach1 protein also has a small to negligible additional effect on HO-1 expression compared to Bach1 alone. These results strongly support the argument that Bach1 is the predominant factor controlling HO-1 expression in keratinocytes and that the very low levels of basal expression of both HO-1 and Nrf2 (or UVA inducibility) in this cell type are due to high levels of stable Bach1 binding to the HO-1 promoter. Bach1 silencing in HaCaT cell populations protected them against cell damage induced by high doses of UVA as monitored by using both LDH assays (membrane damage) and nuclear condensation (apoptosis). There was no significant protection against damage induced by a moderate UVA dose of 250 kJ/m2. This is consistent with observations some years ago that human keratinocytes are many times more resistant to both membrane damage and cell death by UVA radiation [28], so that UVA inactivation of keratinocyte cell populations is observed only at high doses. Although Bach1 seems not to confer resistance against electrophile-induced cytotoxicity in HaCaT cells in the study by MacLeod et al. [45], the current study has demonstrated that the protein is crucial to the resistance of HaCaT cells specifically to a high dose of UVA-induced membrane damage and cell death. This is an indication that Bach1 (as well as Nrf2) is involved in UVA protection, in contrast to the predominant role of Nrf2 observed in protection against electrophiles in HaCaT cells [45]. Results from Igarashi et al. [14,29,57] have shown that Bach1-deficient mice exhibit an increase in HO-1 levels in various tissues, such as lung and heart, and that Bach1 deficiency leads to both liver and myocardial protection. Our results support the notion that Bach1 suppression may provide protection against UVA-mediated oxidative damage in the higher dose range. In summary, we propose that the strong suppression of HO-1 activation in HaCaT keratinocytes is primarily mediated by Bach1.The

205

activity of this suppressor protein is strongly influenced by the high constitutive levels of HO-2 protein, presumably because this will lead to a low free heme pool and prevent the reversal of Bach1–promoter binding. This strong negative regulation leads to low basal and UVAinduced HO-1 expression. Acknowledgments We thank Dr. Charareh Pourzand and Dr. Joerg Bartsch for useful discussions. We also thank Dr. Kazuhiko Igarashi (Japan) who kindly and generously provided the antibody to Bach1 (A1-5) for preliminary experiments. This investigation was supported by BBSRC Grant BB/D521530/1. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.freeradbiomed.2009.10.037. References [1] Maines, M. D.; Kutty, R. K. Characterization of two constitutive forms of rat liver microsomal heme oxygenase: only one molecular species of the enzyme is inducible. J. Biol. Chem. 261:411–419; 1986. [2] Keyse, S. M.; Tyrrell, R. M. Heme oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite. Proc. Natl. Acad. Sci. USA 86:99–103; 1989. [3] Tyrrell, R. M. Solar ultraviolet A radiation: an oxidizing skin carcinogen that activates heme oxygenase-1. Antioxid. Redox Signaling 6:835–840; 2004. [4] Alam, J.; Igarashi, K.; Immenschuh, S.; Shibahara, S.; Tyrrell, R. M. Regulation of heme oxygenase-1 gene transcription: recent advances and highlights from the International Conference (Uppsala, 2003) on Heme Oxygenase. Antioxid. Redox Signaling 6:924–933; 2004. [5] Was, H.; Cichon, T.; Smolarczyk, R.; Dulak, J.; Jozkowicz, A. Overexpression of heme oxygenase-1 in murine melanoma: increased proliferation and viability of tumor cells, decreased survival of mice. Am. J. Pathol. 169:2181–2198; 2007. [6] Frank, J.; Lornejad-Schäfer, M. R.; Schöffl, H.; Biesalski, H. K. Inhibition of heme oxygenase-1 increases responsiveness of melanoma cells to ALA-based photodynamic therapy. Int. J. Oncol. 31:1539–1545; 2007. [7] Sun, J.; Hoshino, H.; Takaku, K.; Nakajima, O.; Muto, A.; Suzuki, H.; Tashiro, S.; Takahashi, S.; Shibahara, S.; Alam, J.; Taketo, M. M.; Yamamoto, M.; Igarashi, K. Hemoprotein Bach1 regulates enhancer availability of heme oxygenase-1 gene. EMBO J. 21:5216–5224; 2002. [8] Alam, J.; Killeen, E.; Gong, P.; Naquin, R.; Hu, B.; Stewart, D.; Ingelfinger, J. R.; Nath, K. A. Heme activates the heme oxygenase 1 gene in renal epithelial cells by stabilizing Nrf2. Am. J. Renal Physiol. 284:743–752; 2003. [9] Itoh, K.; Wakabayashi, N.; Kotoh, Y.; Igarashi, K.; Engel, J. D.; Yamamoto, M. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 13:76–86; 1999. [10] Sun, J.; Brand, M.; Zenke, Y.; Tashiro, S.; Groudine, M.; Igarashi, K. Heme regulates the dynamic exchange of Bach1 and NF-E2-related factors in the Maf transcription factor network. Proc. Natl. Acad. Sci. USA 101:1461–1466; 2004. [11] Igarashi, K.; Sun, J. The heme–Bach1 pathway in the regulation of oxidative stress response and erythroid differentiation. Antioxid. Redox Signaling 8:107–118; 2006. [12] Shan, Y.; Lambrecht, R. W.; Ghaziani, T.; Donohue, S. E.; Bonkovsky, H. L. Role of Bach-1 in regulation of heme oxygenase-1 in human liver cells: insights from studies with small interfering RNAS. J. Biol. Chem. 297:51769–51774; 2004. [13] Reichard, J. F.; Sartor, M. A.; Puga, A. Heme oxygenase-1 induction by NRF2 requires inactivation of the transcriptional repressor BACH1. J. Biol. Chem. 283: 22363–22370; 2008. [14] Iida, A.; Inagaki, K.; Miyazaki, A.; Yonemori, F.; Ito, E.; Igarashi, K. Bach1 deficiency ameliorates hepatic injury in a mouse model. Tohoku J. Exp. Med. 217:223–229; 2009. [15] Shan, Y.; Lambrecht, R. W.; Donohue, S. E.; Bonkovsky, H. L. Role of Bach1 and Nrf2 in up-regulation of the heme oxygenase-1 gene by cobalt protoporphyrin. FASEB J. 20:2651–2653; 2006. [16] McCoubrey Jr., W. K.; Huang, T. J.; Maines, M. D. Heme oxygenase-2 is a hemoprotein and binds heme through heme regulatory motifs that are not involved in heme catalysis. J. Biol. Chem. 272:12568–25674; 1997. [17] Williams, S. E.; Wootton, P.; Mason, H. S.; Bould, J.; Iles, D. E.; Riccardi, D.; Peers, C.; Kemp, P. J. Hemoxygenase-2 is an oxygen sensor for a calcium-sensitive potassium channel. Science 306:2093–2097; 2004. [18] Zhang, Y.; Furuyama, K.; Kaneko, K.; Ding, Y.; Ogawa, K.; Yoshizawa, M.; Kawamura, M.; Takeda, K.; Yoshida, T.; Shibahara, S. Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines: a possible strategy for the maintenance of intracellular heme level. FEBS J. 273:3136–3147; 2006. [19] Kim, Y. M.; Choi, B. M.; Kim, Y. S.; Kwon, Y. G.; Kibbe, M. R.; Billiar, T. R.; Tzeng, E. Protective effect of p53 in vascular smooth muscle cells against nitric oxideinduced apoptosis is mediated by up-regulation of heme oxygenase-2. BMB Rep. 41:164–169; 2008.

206

J.L. Zhong et al. / Free Radical Biology & Medicine 48 (2010) 196–206

[20] Kim, Y. S.; Doré, S. Catalytically inactive heme oxygenase-2 mutant is cytoprotective. Free Radic. Biol. Med. 39:558–564; 2005. [21] Zenclussen, A. C.; Lim, E.; Knoeller, S.; Knackstedt, M.; Hertwig, K.; Hagen, E.; Klapp, B. F. Heme oxygenases in pregnancy. II. HO-2 is downregulated in human pathologic pregnancies. Am. J. Reprod. Immunol. 50:66–76; 2003. [22] Chen, J.; Regan, R. F. Heme oxygenase-2 gene deletion increases astrocyte vulnerability to hemin. Biochem. Biophys. Res. Commun. 318:88–94; 2004. [23] Kvam, E.; Hejmadi, V.; Ryter, S.; Pourzand, C.; Tyrrell, R. M. Heme oxygenase activity causes transient hypersensitivity to oxidative ultraviolet A radiation that depends on release of iron from heme. Free Radic. Biol. Med. 28:1191–1196; 2000. [24] Dennery, P. A.; Spitz, D. R.; Yang, G.; Tatarov, A.; Lee, C. S.; Shegog, M. L.; Poss, K. D. Oxygen toxicity and iron accumulation in the lungs of mice lacking heme oxygenase-2. J. Clin. Invest. 101:1001–1111; 1998. [25] Adachi, T.; Ishikawa, K.; Hida, W.; Matsumoto, H.; Masuda, T.; Date, F.; Ogawa, K.; Takeda, K.; Furuyama, K.; Zhang, Y.; Kitamuro, T.; Ogawa, H.; Maruyama, Y.; Shibahara, S. Hypoxemia and blunted hypoxic ventilatory responses in mice lacking heme oxygenase-2. Biochem. Biophys. Res. Commun. 320:514–522; 2004. [26] Ding, Y.; Zhang, Y. Z.; Furuyama, K.; Ogawa, K.; Igarashi, K.; Shibahara, S. Downregulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines. FEBS J. 273:5333–5346; 2006. [27] Chen, J.; Benvenisti, Z. L.; Regan, R. F. Increasing expression of HO-1 by proteasome inhibition protects astrocytes from heme-mediated oxidative injury. 82:802–810; 2005. [28] Applegate, L. A.; Noël, A.; Vile, G.; Frenk, E.; Tyrrell, R. M. Two genes contribute to different extents to the heme oxygenase enzyme activity measured in cultured human skin fibroblasts and keratinocytes: implications for protection against oxidant stress. Photochem. Photobiol. 61:285–291; 1995. [29] Yano, Y.; Ozono, R.; Oishi, Y.; Kambe, M.; Yoshizumi, M.; Ishida, T.; Omura, S.; Oshima, T.; Igarashi, K. Genetic ablation of the transcription repressor Bach1 leads to myocardial protection against ischemia/reperfusion in mice. Genes Cells 11:791–803; 2006. [30] Ryter, S.; Kvam, E.; Richman, L.; Hartmann, F.; Tyrrell, R. M. A chromatographic assay for heme oxygenase activity in cultured human cells: application to artificial heme oxygenase overexpression. Free Radic. Biol. Med. 24:959–971; 1998. [31] Boukamp, P.; Petrussevska, R. T.; Breitkreutz, D.; Hornung, J.; Markham, A.; Fusenig, N. E. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 106:761–771; 1988. [32] Zhong, J. L.; Yiakouvaki, A.; Holley, P.; Tyrrell, R. M.; Pourzand, C. Susceptibility of skin cells to UVA-induced necrotic cell death reflects the intracellular level of labile iron. J. Invest. Dermatol. 23:771–780; 2004. [33] Basu-Modak, S.; Gordon, M. J.; Dobson, L. H.; Spencer, J. P.; Rice-Evans, C.; Tyrrell, R. M. Epicatechin and its methylated metabolite attenuate UVA-induced oxidative damage to human skin fibroblasts. Free Radic. Biol. Med. 35:910–921; 2003. [34] Zhong, J. L.; Poghosyan, Z.; Pennington, C. J.; Edwards, D. R. Distinct functions of natural ADAM-15 cytoplasmic domain variants in human mammary carcinoma. Mol. Cancer Res. 6:1–12; 2008. [35] Marrot, L.; Jones, C.; Perez, P.; Meunier, J. R. The significance of Nrf2 pathway in (photo)-oxidative stress response in melanocytes and keratinocytes of the human epidermis. Pigment Cell Melanoma Res. 21:79–88; 2008. [36] Jazwa, A.; Loboda, A.; Golda, S.; Cisowski, J.; Szelag, M.; Zagorska, A.; Sroczynska, P.; Drukala, J.; Jozkowicz, A.; Dulak, J. Effect of heme and heme oxygenase-1 on vascular endothelial growth factor synthesis and angiogenic potency of human keratinocytes. Free Radic. Biol. Med. 40:1250–1263; 2006. [37] Olszanecki, R.; Rezzani, R.; Omura, S.; Stec, D. E.; Rodella, L.; Botros, F. T.; Goodman, A. I.; Drummond, G.; Abraham, N. G. Genetic suppression of HO-1 exacerbates renal damage: reversed by an increase in the antiapoptotic signaling pathway. Am. J. Physiol. Renal Physiol. 292:F148–F157; 2007. [38] Chen-Roetling, J.; Benvenisti-Zarom, L.; Regan, R. F. Cultured astrocytes from heme oxygenase-1 knockout mice are more vulnerable to heme mediated oxidative injury. J. Neurosci. Res. 82:802–810; 2005. [39] Hirota, A.; Kawachi, Y.; Itoh, K.; Nakamura, Y.; Xu, X.; Banno, T.; Takahashi, T.; Yamamoto, M.; Otsuka, F. Ultraviolet A irradiation induces NF-E2-related factor 2

[40] [41]

[42] [43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52] [53]

[54]

[55] [56]

[57]

activation in dermal fibroblasts: protective role in UVA-induced apoptosis. J. Invest. Dermatol. 124:825–832; 2005. Reichard, J. F.; Motz, G. T.; Puga, A. BACH1 is a specific repressor of HMOX1 that is inactivated by arsenite. Nucleic Acids Res. 35:7074–7086; 2007. Durchdewald, M.; Beyer, T. A.; Johnson, D. A.; Johnson, J. A.; Werner, S.; auf dem Keller, U. J. Electrophilic chemicals but not UV irradiation or reactive oxygen species activate Nrf2 in keratinocytes in vitro and in vivo. J. Invest. Dermatol. 127: 646–653; 2007. Rushworth, S. A.; MacEwan, D. J. HO-1 underlies resistance of AML cells to TNFinduced apoptosis. Blood 111:3793–3801; 2008. Noël, A.; Tyrrell, R. M. Development of refractoriness of induced human heme oxygenase-1 gene expression to reinduction by UVA irradiation and hemin. Photochem. Photobiol. 66:454–463; 1997. Kvam, E.; Noel, A.; Basu-Modak, S.; Tyrrell, R. M. Cyclooxygenase dependent release of heme from microsomal hemeproteins correlates with induction of heme oxygenase 1 transcription in human fibroblasts. Free Radic. Biol. Med. 26: 511–517; 1999. MacLeod, A. K.; McMahon, M.; Plummer, S. M.; Higgins, L. G.; Penning, T. M.; Igarashi, K.; Hayes, J. D. Characterization of the cancer chemopreventive NRF2dependent gene battery in human keratinocytes: demonstration that the KEAP1– NRF2 pathway, and not the BACH1–NRF2 pathway, controls cytoprotection against electrophiles as well as redox-cycling compounds. Carcinogenesis 30: 1571–1580; 2009. Seta, F.; Bellner, L.; Rezzani, R.; Schwartzman, M. L. Heme oxygenase-2 is a critical determinant for execution of an acute inflammatory and reparative response. Am. J. Pathol. 169:1612–1623; 2006. Basu-Modak, S.; Ali, D.; Gordon, M.; Polte, T.; Yiakouvaki, A.; Pourzand, C.; Rice-Evans, C.; Tyrrell, R. M. Suppression of UVA-mediated release of labile iron by epicatechin—a link to lysosomal protection. Free Radic. Biol. Med. 41:1197–1204; 2006. Hintze, K. J.; Katoh, Y.; Igarashi, K.; Theil, E. C. Bach1 repression of ferritin and thioredoxin reductase1 is heme-sensitive in cells and in vitro and coordinates expression with heme oxygenase1, beta-globin, and NADP(H) quinone (oxido) reductase 1. J. Biol. Chem. 282:34365–34367; 2007. Vile, G. F.; Tyrrell, R. M. Oxidative stress resulting from ultraviolet A irradiation of human skin fibroblasts leads to a heme oxygenase-dependent increase in ferritin. J. Biol. Chem. 268:14678–14681; 1993. Abraham, N. G.; Rezzani, R.; Rodella, L.; Kruger, A.; Taller, D. Li, Volti.; G.; Goodman, A. I., Kappas, A. Overexpression of human heme oxygenase-1 attenuates endothelial cell sloughing in experimental diabetes. Am. J. Physiol. Heart Circ. Physiol. 287:H2468-H2477; 2004. Abate, A.; Zhao, H.; Wong, R. J.; Stevenson, D. K. The role of Bach1 in the induction of heme oxygenase by tin mesoporphyrin. Biochem. Biophys. Res. Commun. 354: 363–757; 2007. Poss, K. D.; Tonegawa, S. Reduced stress defense in heme oxygenase 1-deficient cells. Proc. Natl. Acad. Sci. USA 94:10925–10930; 1997. Yachie, A.; Niida, Y.; Wada, T.; Igarashi, N.; Kaneda, H.; Toma, T.; Ohta, K.; Kasahara, Y.; Koizumi, S. Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. J. Clin. Invest. 103:129–135; 1999. Poss, K. D.; Thomas, M. J.; Ebralidze, A. K.; O'Dell, T. J.; Tonegawa, S. Hippocampal long-term potentiation is normal in heme oxygenase-2 mutant mice. Neuron 15: 867–873; 1995. Hayes, J. D.; McMahon, M. NRF2 and KEAP1 mutations: permanent activation of an adaptive response in cancer. Trends Biochem. Sci. 34:176–188; 2009. Zhong, J. L.; Edwards, G. P.; Raval, C.; Li, H.; Tyrrell, R. M. The role of Nrf2 in ultraviolet A mediated heme oxygenase 1 induction in human skin fibroblasts. Photochem. Photobiol. Sci. (in press), doi:10.1039/b9pp00068b. Mito, S.; Ozono, R.; Oshima, T.; Yano, Y.; Watari, Y.; Yamamoto, Y.; Brydun, A.; Igarashi, K.; Yoshizumi, M. Myocardial protection against pressure overload in mice lacking Bach1, a transcriptional repressor of heme oxygenase-1. Hypertension 51:1570–1577; 2008.