A role for p21 (WAF1) in the cAMP-dependent differentiation of F9 teratocarcinoma cells into parietal endoderm

Experimental Cell Research 304 (2005) 293 – 304 www.elsevier.com/locate/yexcr

A role for p21 (WAF1) in the cAMP-dependent differentiation of F9 teratocarcinoma cells into parietal endoderm Blanka Drdova´, Jiri Vachtenheim* Laboratory of Molecular Biology, University Hospital, Clinic of Pneumology, 3rd Faculty of Medicine, Budinova 2, 180 00 Prague 8-Bulovka, Czech Republic Received 20 June 2004, revised version received 12 October 2004 Available online 24 November 2004

Abstract Combined treatment of teratocarcinoma F9 cells with retinoic acid and dibutyryl-cAMP induces the differentiation into cells with a phenotype resembling parietal endoderm. We show that the levels of cyclin-dependent kinase inhibitor p21/WAF1/Cip1 (p21) protein and mRNA are dramatically elevated at the end of this differentiation, concomitantly with the appearance of p21 in the immunoprecipitated CDK2–cyclin E complex. The induction of differentiation markers could not be achieved by expression of ectopic p21 alone and still required treatment with differentiation agents. Clones of F9 cells transfected with sense or antisense p21 cDNA constructs revealed, upon differentiation, upregulated levels of mRNA for thrombomodulin, a parietal endoderm-specific marker, or increased fraction of cells in subG1 phase of the cell cycle, respectively. Consistent with this observation, whereas p21 was strictly nuclear in undifferentiated cells, a large proportion of differentiated cells had p21 localized also in the cytoplasm, a site associated with the antiapoptotic function of p21. Furthermore, p21 activated the thrombomodulin promoter in transient reporter assays and the p21 mutant defective in binding to cyclin E was equally efficient in activation. The promoter activity in differentiated cells was reduced by cotransfection of p21-specific siRNA or antisense cDNA. Coexpression of p21 increased the activity of the GAL-p300(1–1303) fusion protein on the GAL sites-containing TM promoter. This implies that p21 might act through a derepression of the p300 N-terminal-residing repression domain, thereby enhancing the p300 coactivator function. As differentiation of F9 cells into parietal endoderm-like cells requires the cAMP signaling, the results together suggest that the cyclin-dependent kinase inhibitor p21 may promote specifically this pathway in F9 cells. D 2004 Elsevier Inc. All rights reserved. Keywords: F9; Teratocarcinoma; p21; WAF1; Cip1; Retinoid acid; Parietal endoderm; cAMP

Introduction Embryonal carcinoma cells resemble many features of the embryonic stem cells and are capable of differentiating in culture upon various chemical or hormonal stimuli. Murine teratocarcinoma F9 cells can be induced to differentiate into primitive endoderm-like cells in the presence of retinoic acid

Abbreviations: cdk, Cyclin-dependent kinase; dbcAMP, Dibutyryl cyclic adenosine monophosphate; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; PE, Parietal endoderm; RA, All-trans-retionic acid; TM, Thrombomodulin. * Corresponding author. Fax: +420 284840840. E-mail address: [email protected] (J. Vachtenheim). 0014-4827/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2004.10.027

(RA). While a prolonged treatment with RA induces visceral endoderm in F9 cells, simultaneous treatment with RA and agents that stimulate the cAMP pathway converts them into cells with a phenotype reminiscent of parietal endoderm (PE) [1]. Retinoic acid receptor family members RARs and RXRs are essential for RA signaling during differentiation of F9 cells and their function in differentiation and growth arrest are partially redundant [2,3]. RARa and RXRa were shown to be necessary for differentiation into PE [2–6]. In addition to the RA receptors, the transcriptional coactivator p300 protein, but not the closely related CREB-binding protein (CBP), was necessary for F9 cells to attain the RA-dependent differentiation state [7]. Consistent with this, p300/CBP proteins have been shown to enhance the RAR/RXR-mediated trans-

294

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

activation [8]. Differentiation of F9 cells into primitive or parietal endoderm is accompanied by a reduced proliferation rate, morphological changes, and transcriptional activation of several marker genes including laminin B1, collagen a-IV, and tissue plasminogen activator [1,9]. Thrombomodulin (TM), a cell surface anticoagulant protein that is expressed by endothelial cells, is yet another marker that is upregulated specifically if F9 cells differentiate into PE in the presence of RA and cAMP or its agonists; it is hardly detectable when F9 cells are cultured in the presence of RA alone [10]. Inhibitors of cyclin-dependent kinases (CDKs) are important regulators of both cell cycle progression and differentiation [11,12]. One group of CDK inhibitors includes p21(WAF1/Cip1), p27(KIP1) and p57(KIP2) [11,13], all of which are universal inhibitors and were found in various cyclin–CDK complexes including D-type cyclins and cyclin E/A complexes, with the cyclin E–CDK2 complex being the fundamental target for inhibition by this class of inhibitors when cells arrest in the G1 phase of the cell cycle. Emerging evidence suggests that, in addition to their regulatory function during the cell cycle, these inhibitors may participate in other fundamental cellular processes like senescence, apoptosis, and differentiation [13–15]. p21 and p27 have been reported to be elevated during differentiation of various cell types and their overexpression promoted, or their functional inactivation inhibited, the differentiation in several lineages such as leukemic cells, chondrocytes, oligodendrocytes and neuronal cells. These effects appeared to be independent of their function in cell cycle control or occurred concomitantly with cell cycle blockage [16–22]. Induction of p21 in fibrosarcoma cells resulted in a pleiotropic effect with down- and up-regulation of many genes: aside from a selective inhibition of a number of genes involved in mitosis and DNA replication, induction of p21 has been shown to stimulate expression of genes associated with senescence and specific diseases like atherosclerosis and amyloidosis [23]. F9 teratocarcinoma cells divide extremely rapidly and slow proliferation only after they are induced to differentiate with RA. RARa- and RXRa- null F9 cells were impaired in inhibition of proliferation after RA treatment [2]. The reported data indicate that the RARh2 also plays an important role in mediating the growth inhibitory action of RA [24]. Whereas in RA-differentiated F9 cells the p27 CDK inhibitor was found to be accumulated, correlating with an increased number of cells in the G1 phase of the cell cycle, these effects could not be achieved in RARh2-null cells, suggesting that the p27 directly mediated the RARh2dependent cell cycle arrest [25]. Here, we examined the changes in cell cycle-related proteins during the RA + dbcAMP-induced differentiation of F9 cells into PE. We found that the p21 protein increases during differentiation, reaching high levels at the end of a 6-day differentiation period. Using the sense and antisense p21 overexpressing F9 clones and transient transfections, we show that p21

transcriptionally upregulates the PE-specific marker TM, maintains the fraction of apoptotic cells low, and partially localizes to the cytoplasm in a subset of differentiated cells. The data together suggest its role in modulating the cAMPdependent differentiation pathway.

Materials and methods Cell culture F9 cells were obtained from American Type Culture Collection (Manassas, VA) and maintained on 0.1% gelatincoated dishes in DMEM containing high glucose, 4 mM glutamine, antibiotics, and 10% fetal bovine serum (Invitrogen, Carlsbad, CA). Differentiation into PE-like cells was induced with 0.5 AM RA and 1 mM dibutyryl-cAMP (dbcAMP) (Sigma, St. Louis, MO) in the same medium for the indicated time interval (6 days maximum). Reporter and expression plasmids Mouse thrombomodulin (TM) gene promoter (nucleotides 1268 to +35 relative to the transcription start) was cloned as a PCR fragment, amplified from genomic DNA, into the MluI–XhoI sites of pGL3basic (Promega). The internal PstI–PstI sequence was then cut off and the plasmid religated, yielding the pGL3-TMpr-DPst. This shortened promoter, leaving the CRE-like motif intact upstream of the deleted region, has been shown previously to retain high activity in F9 cells [26]. The G5TMpr-222 reporter contains only proximal TM promoter sequences (nt 222 to +35) linked to five upstream GAL4-binding sites. pGL3-5CRE-TATA reporter construct has five CRE motifs (TGACGTCA) located upstream of the TATA box linked to the luciferase gene in the background of the pGL3-basic (Promega). For expression of mouse p21, the cDNA was subcloned into the expression vector pCDNA3 (Invitrogen). The cyclin E non-binding mutant of p21 [27,28] was prepared by deleting amino acids 17–23. The N-terminal FLAGtagged p21 was prepared by in frame cloning of the p21 open reading frame in the plasmid pCMV-FLAG-6b (Sigma). To construct the p21 antisense expression vector, cDNA was amplified from a reverse transcribed RNA isolated from mouse C2C12 cells by using the primers 5V CTGCTCGAGAGGGCTGGCTGAACTCAACAC and 5V CTGAAGCTTAGTGAGGGCTAAGGCCGAAGA and subcloned into the HindIII–XhoI sites of pCDNA3. pCMV-GAL-p21 expression plasmid was created by in frame cloning of the p21 open reading frame sequence downstream of the GAL4 DNA-binding domain. pCMVGAL-p300(1–1303) encodes a GAL fusion of a strong Nterminal domain of the p300 protein together with its repressory domain [29]. All plasmid constructs were verified by DNA sequencing of both strands.

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

Cell transfections To obtain clones expressing either sense or antisense p21, the appropriate construct (2 Ag) together with the puromycin resistance plasmid (pBABEpuro, 0.1 Ag) were cotransfected into F9 cells, replated into puromycincontaining medium (0.4 Ag/ml) 36 h post-transfection, and clones were isolated and expanded 5 to 7 days later. Antisense (AS) or sense (overexpressing p21 protein) clones were chosen for further experiments based on a marked decrease of the p21 protein after a 6-day differentiation period when compared to vector-transfected cells or a high level of p21 in undifferentiated F9 cells, respectively. For the reporter assays, cells were transfected with the indicated plasmids as described in Figs. 5 and 6, and luciferase activity was determined 36 h post-transfection using the luciferase assay reagents (Promega). pCMV-h was included in transfections to normalize the luciferase activity. For testing the effects of p21 AS RNA or siRNA on reporter activities, RA-differentiated F9 cells (day 4) were transfected with AS cDNA construct or siRNA duplexes and analyzed as above. The sequence of mouse p21-specific siRNA was 5V CUUUGACUUCGUCACGGAG and its complement with the dTdT overhangs at the 3Vends. An unrelated siRNA duplex directed to the pigment cell-specific transcription factor microphthalmia was used as a negative control. siRNAs were purchased from Proligo (Boulder, CO). All transient transfections were carried out using Lipofectamine 2000 (Invitrogen) according to manufacturer’s recommendation in 24-well plates. Western blot analyses and immunostaining Cell extracts were prepared in RIPA buffer [50 mM TRIS (pH 8.0), 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, 1 mM DTT, containing 5 mM NaF, 0.5 mM Na3VO4, 1 mM AEBSF, aprotinin, leupetin and pepstatin], electrophoresed on SDS-PAGE gels, transferred onto the Immobilone P membrane (Millipore) and probed with the following primary antibodies obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA): anti-p21 (F-5), anti-p27 (C-19), anti-cyclin A (cyclin A2) (C-19), anti-cyclin B1 (GNS1), anti-cyclin D1 (72-13G), anti-cyclin D3 (C-16), anti-cyclin E (M-20), anti-cdk2 (M2-G), anticdk 4 (H-22), anti-cdc25A (144); anti h-actin antibody was from Sigma. The primary antibodies were diluted to final concentration 1–2 Ag/ml as recommended by the suppliers. Horseradish peroxidase-labeled secondary antibodies (Santa Cruz or Roche, Mannheim, Germany) were diluted to 0.2 Ag/ml. The bound antibodies were detected by enhanced chemiluminescence (Amersham Biosciences, Uppsala, Sweden). To localize p21 by indirect immunofluorescence, F9 or differentiated F9 (day 4) cells were transfected with FLAGp21 and analyzed 36 h later. After being fixed with 3% formaldehyde in 1 PBS for 10 min at room temperature,

295

the cells were permeabilized with 0.2% Triton X-100 in 1 PBS, blocked with 5% sheep serum and 2% bovine serum albumin in PBS containing 0.05% Nonidet P-40, followed by binding the first antibody (mouse anti-FLAG M2, Sigma). The cells were washed, followed by incubation with sheep anti-mouse immunoglobulin-FITC (Roche). Immunoprecipitation and in vitro kinase assay For the analysis of CDK activity in the cyclin E–CDK2 complex, cells were lysed in Nonidet P-40 lysis buffer (50 mM TRIS pH 7.5, 150 mM NaCl, 1.0% Nonidet P-40, 1 AM sodium pyrophosphate and protease inhibitors), and 300 Ag of protein was immunoprecipitated with anti-cyclin E antibody overnight at 48C, washed five times in lysis buffer and used in the kinase assays. Kinase activity with the histone H1 as a substrate was performed by washing the Protein A/G-Sepharose-bound immunocomplexes with the kinase buffer (50 mM Tris pH 7.5, 10 mM MgCl2 and 1 AM DTT) and incubation with 5 AM ATP, 0.1 Ag/Al histone H1 and 1 ACi [g-32P]-ATP (Amersham Biosciences) in the kinase buffer for 30 min at 308C. The extent of labeled H1 histone was analyzed by SDS-PAGE and autoradiography. Northern blotting and RT-PCR RNA was isolated with Trizol (Invitrogen), electrophoresed in agarose gels and transferred on Hybond N membranes (Amersham Biosciences), crosslinked by UV, and sequentially hybridized with 32P-labeled cDNA probes for p21, laminin B1, collagen a-IV, and glyceraldehyde-3phosphate dehydrogenase (GAPDH) as a control gene. All cDNA probes were labeled using the random-priming method and [a-32P]dCTP. Hybridization was done in the presence of PerfectHyb Plus Hybridization Buffer (Sigma) overnight. The membranes were then washed in a high stringency solution at 608C and autoradiographed. Quantitative RT-PCR for mouse thrombomodulin was performed with primers 5V GTGGAGCATGAGTGCTTCGC and 5V AACTTCTGCAGCGTCCGATC by a method described earlier [30]. Briefly, one amplification cycle consisted of denaturing the sample at 948C for 30 s, annealing at 588C for 30 s, and an extension at 728C for 30 s, by using the Taq DNA polymerase (Roche) according to manufacturer’s instructions. The PCR products (1640 bp) obtained in the exponential phase of amplification (12–16 cycles) were blotted and probed with the 32P-labeled internal thrombomodulin cDNA probe prepared by PCR with primers 5VGTGGAGCATGAGTGCTTCGC and 5V-GGTGTTGTAGGTACTAGAGA. Primers for the detection of the 36B4 ribosomal protein mRNA were as described [5]. Cell cycle distribution During differentiation with RA + dbcAMP, adherent control F9 cells or clones overexpressing exogenous sense

296

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

or antisense p21 cDNA were washed, harvested, and fixed in 75% ethanol. After subsequent washing, cells were incubated in PBS containing 50 Ag/ml RNAse A, 25 Ag/ml propidium iodide, and 10% fetal bovine serum for 30 min in the dark and DNA content was determined by fluorescence-activated cell analysis on a FACS Calibur flow cytometer (BD Biosciences). Analysis was done using CellQuest software. Apoptotic cells that contained less than a 2N DNA content were identified as a sub-G1 DNA peak.

Results p21 protein and mRNA are upregulated during F9 differentiation into parietal endoderm To determine changes in proteins related to the cell cycle during the differentiation of F9 cells into PE, cells were cultured in medium containing RA + dbcAMP over a 6-day period and cell extracts from each day were analyzed by Western blotting. The levels of most proteins involved in the cell cycle regulation like cyclin A, CDK2, CDK4 or protein phosphatase cdc25A remained unchanged, or revealed only a minor decrease (cyclin E) or a slight biphasic increase (p27) (Fig. 1A). The two faster migrating bands seen in anticyclin A signals may represent the N-truncated forms of cyclin A2 detected recently in mouse tissues (see Discussion) and their intensity diminished by day 4. A lower signal of cyclin B1 (days 4 to 6) is likely due to a diminished number of cells in the G2/M phases of the cell cycle in the gradually differentiating population ([31] and data not shown). The signal for cyclin D1 protein disappeared by day 4 but the level of cyclin D3 remained high during differentiation. The most striking finding was, however, a dramatically upregulated level of the p21 protein at the end of the differentiation period (Fig. 1A). It has been reported recently that the p21 protein did not reveal any changes during the differentiation of F9 cells for 4 days in RA alone [25]. Thus, the profound upregulation of p21 may be specific for PE differentiation, with prominent levels reached at the end of this process (days 5 and 6). The CDK2 activity was determined in immunocomplexes prepared with the anti-cyclin E antibody and was found to decline gradually, but much less markedly when compared with changes in p21 levels (Fig. 1B). A similar decrease of the CDK2 kinase activity was noted when cell extracts were immunoprecipitated with anti-CDK2 or anti-cyclin A antibodies (results not shown). To verify the amount of immunoprecipitated CDK2, its level in the complex was also determined and found to be comparable, despite somewhat lower or higher levels were seen in samples from days 0 or 1, respectively (Fig. 1B). We then probed the immunoblotted material with anti-p21 and anti-p27 antibodies. Importantly, we found a higher accumulation of p21 in the immunoprecipitated CDK2–cyclin E complex, which

Fig. 1. Expression of several cell cycle-related proteins and CDK2 activity in F9 cells differentiating into PE in the presence of 0.5 AM RA and 1 mM dbcAMP. (A) Aliquots of the lysate containing 20 Ag of protein were electrophoresed on SDS-PAGE gel followed by Western blot analysis. Two independent experiments gave similar results. Day 0 denotes undifferentiated F9 cells. (B) Kinase activities and CDK2, p21, and p27 proteins in anti-cyclin E immunoprecipitates. One of the three experiments in which similar results were obtained is shown. Comparable quantity of immunoprecipitated CDK2 was confirmed by Western blotting of the immunoprecipitates.

mirrored the gradual elevation of the total p21 level in these cells. An increase of the CDK2–cyclin E complex containing p27 was also noted, but it was present already in cycling cells at day 0 (Fig. 1B). Thus, the data suggest that p27, besides p21, could also contribute to the inhibition of the CDK2 kinase activity and cell cycle arrest which occurs in fully differentiated F9 cells. It has been reported previously that the human p21 gene is transcriptionally activated by RA during the differentiation of leukemic cell line U937 or its derivative [18,32]. We were therefore interested in determining if the p21 mRNA, like the protein, is upregulated during differentiation. Northern blot revealed that this was indeed the case (Fig. 2). Whereas a very low signal was seen in F9 cells before differentiation (Fig. 2A, day 0), the mRNA accumulated gradually and reached high levels by day 5. To confirm the expression of differentiation markers, laminin B1 and collagen type a-IV messages were also determined and showed no signals at day 0 and their gradual appearance during differentiation (Fig. 2A). Likewise, mRNA for a PEspecific marker TM strongly accumulated by day 5 (Fig. 2A, lower panel). Since it has been reported previously that the p21 protein is a subject of proteasomal degradation [33]

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

297

besides the robust accumulation of mRNA, the increase of protein stability can also contribute to the p21 protein upregulation. F9 cells overexpressing p21 still require RA + dbcAMP for differentiation into PE

Fig. 2. p21 mRNA accumulate at the end of differentiation into PE. (A) Expression of mRNA was evaluated by Northern blot analysis at 0–6 days of differentiation. Northern blot was performed using 32P-labeled cDNA probes for laminin B1, collagen a-IV, p21, TM, and GAPDH as a control. Representative Northern blots from two independent experiments are presented. (B) Levels of p21 protein are increased by inhibiting the proteasome with MG-132 (20 AM) for 3 h in undifferentiated F9 cells, RA + dbcAMP-differentiated cells (day 6) and a clone (no. 7) of undifferentiated cells overexpressing p21 ectopically. (C) p21 protein decay kinetics after the addition of 40 Ag/ml cycloheximide (CHX) showing a prolonged survival of p21 in differentiated F9 cells.

and is rapidly degraded in undifferentiated F9 cells [34], our results would imply that, in addition to increased mRNA levels, the stabilization of protein might also contribute to p21 accumulation. To test this, we added the proteasome inhibitor MG-132 to F9 cells and differentiated F9 cells (day 6) and analyzed p21 levels. As shown in Fig. 2B, p21 protein strongly accumulated in undifferentiated F9 cells (lanes 1 and 2), as has been also shown earlier [34], but the protein level increased, albeit less dramatically, also in differentiated F9 cells (lanes 3 and 4). A clone of F9 cells in which the p21 protein was expressed ectopically (see below) exhibited protein levels similar to those in differentiated F9 cells (lanes 5 and 6). To further clarify a possible difference in the fate of the p21 protein, de novo protein synthesis was inhibited by incubation of cells with cycloheximide. The PE-differentiated F9 cells (day 6) revealed a prolonged survival when compared with the undifferentiated p21overexpressing clone (Fig. 2C). It appears, therefore, that

Despite a high degradation rate of the p21 protein in undifferentiated F9 cells, we selected several clones stably expressing this protein ectopically. All these clones grew as rapidly as the parental cells and had the same morphology (data not shown). To investigate whether the elevated p21 protein could influence the differentiation process when present already before the addition of RA and dbcAMP, one p21-overexpressing clone (no. 7) was analyzed further. Undifferentiated clone 7 exhibited p21 protein levels similar to those present in differentiated F9 cells (Fig. 2B, lanes 3 to 6). Upon differentiation, p21 protein level was rapidly and transiently elevated on day 1 (Fig. 3), then declined and remained stable from day 2 onwards. The transient increase evidently reflected the elevation of the RNA transcript derived from the transfected plasmid (Fig. 3, day 1) and a somewhat reduced p21 protein degradation after a 24-h treatment with RA + dbcAMP might be also involved (data not shown). The endogenous message for p21 increased gradually as in parental, untransfected F9 cells (Figs. 2A and 3). Two differentiation markers, laminin B1 and collagen type a-IV, also showed a similar induction pattern as in the native F9 cells but laminin B1 RNA was induced slightly earlier since the signal intensity did not change appreciably already from day 3 onwards (Fig. 3). The kinetics of appearance of mRNA for TM was also unchanged (data not shown). Together, these data indicate that the features of differentiation cannot be induced per se in clones overexpressing

Fig. 3. Differentiation of p21-overexpressing clone (no. 7) shows a similar appearance of markers as in parental F9 cells. Northern blot was probed using cDNA probes as indicated in Fig. 2. One representative Northern blot from two independent experiments is presented. Exo- and endo- denotes plasmid-derived or endogenous mRNA for p21, respectively. A weak signal of high molecular weight mRNA appearing only at day 1 represents a transcript which terminated far downstream of the designed polyA sequence).

298

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

p21, and RA + dbcAMP signaling is equally important in these cells as in parental F9 cells. Intriguingly, the p21overexpressing clone did not significantly increase the number of G1 phase cells when compared with cells transfected with an empty plasmid, indicating that undifferentiated F9 cells overexpressing p21 are refractory to the cell cycle arrest in G1, and a more prominent G2/M phase was seen in these cells (see below and Fig. 4).

Clone overexpressing antisense p21 contains more apoptotic cells and p21 localizes in part to the cytoplasm upon the RA + dbcAMP-induced differentiation We then asked whether the cells expressing lower amounts of p21 are able to differentiate normally into PE. For this purpose, we made use of a F9 clone stably transfected with the p21 antisense (AS) expression plasmid.

Fig. 4. (A) DNA content in control, p21 sense- and p21 antisense-expressing cells. The X axis indicates the intensity of staining with propidium iodide and the Y axis the cell number. Only undifferentiated (day 0) and differentiated (day 6) cells are shown. At least 30,000 events are represented in each histogram. The percentages of cells in the region showing the sub-2N size indicate the bapoptotic cells.Q The percentages of cells in G1 phase of the cell cycle are: control cells, 23.1% and 40.6%, for days 0 and 6, respectively; p21-overexpressing cells (F9-p21 cells), 33.7% and 39.0%, for days 0 and 6, respectively; F9-p21 AS cells, 27.3% and 17.4%, for days 0 and 6, respectively. Cells in G2/M phase: control cells, 32.1% (day 0), 37.7% (day 6); F9-p21, 44.6% (day 0), 31.7% (day 6); F9p21 AS cells, 30.4% (day 0), 54.4% (day 6). (B) Western blot showing p21 levels (at day 5) in the three examined cell clones. (C) Subcellular localization of FLAG-p21 in undifferentiated (left), RA-treated (middle), and differentiated (right) F9 cells. RA-treated cells were incubated in RA-containing medium for 24 h before analysis and differentiated cells were analyzed on day 6. Upper panels indicate the fluorescence of transfected cells due to the anti-Flag antibody, while the lower panels indicate the DAPI staining of the nuclei.

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

We noticed that a higher proportion of cells in this clone, but not in control cells or a clone expressing sense p21, detached during the second half of the differentiation period (days 4 to 6); this was even more pronounced when cells were maintained in the differentiation medium for several additional days (data not shown). Therefore, analysis by DNA flow cytometry was carried out to examine whether the p21-AS cells were altered in the cell cycle control or had fragmented DNA. As shown in Fig. 4A, F9 p21-AS clone had a profile similar to control on day 0 but contained a higher proportion of cells in the G2 phase by day 6. The percentage of these cells increased to 54.4% upon differentiation (day 6), whereas control cells revealed much lower values and were similar to the p21-overexpressing clone (for percentages of cells in the cell cycle phases see Legend to Fig. 4). Consequently, decreased number of cells remained in G1 phase in the p21-AS clone when compared with the control. These data are in agreement with the function of the p21 protein in G1 phase arrest and indicate that lower levels of p21 may in part compromise the negative cell cycle regulation in G1 phase in differentiating F9 cells. This is consistent with the previous data showing that p21 readily enters the CDK2–cyclin E complex in the course of differentiation (Fig. 1B). In addition, examination of subG1 phase showed an increased percentage of cells in the p21-AS clone (Fig. 4A), suggesting that apoptosis was induced in these cells. Western blot of cellular extracts showed increased and decreased p21 levels in the p21overexpressing and p21-AS clone, respectively (Fig. 4B). Together, our data demonstrate that a critical level of p21 protein is required for maintaining the number of apoptotic cells low and increasing the proportion of cells in the G1 phase during the differentiation of F9 cells into PE. p21 protein was shown previously to form a complex with and inhibit the cleavage of procaspase 3 on mitochondria, thereby interfering with the Fas-dependent apoptosis [14,35–37], a function associated with the phosphorylation of p21 and its relocation from nucleus to the cytoplasm [38,39]. We therefore asked whether the subcellular localization of p21 would change upon differentiation into PE. To test this, FLAG-p21 construct was transfected into F9 cells and distribution of this tagged protein was determined. In undifferentiated cells and cells treated with RA for 24 h, the FLAG-p21 was strictly nuclear. Contrary to this, a subset of differentiated cells (about one third) had a prominent cytoplasmic staining, besides the retained nuclear localization (Fig. 4C). Together, these data support the notion that p21 may decrease the extent of apoptosis after being partly relocated to the cytoplasm, at least in a subset of differentiating F9 cells. Thrombomodulin gene promoter is activated by ectopic and endogenous p21 Thrombomodulin (TM) is a specific marker for the differentiation into parietal rather than primitive endoderm

299

[10], while laminin B1 and collagen type a-IV are expressed also in primitive endoderm. To investigate a potential role of p21 protein in regulation of the TM gene transcription, we have generated the promoter-reporter construct pGL3TMpr-DPst and tested whether its activity is influenced by cotransfection of the p21 expression vector. Also tested in this assay was the mutant of p21 with deleted amino acids 17 to 23, which does not bind to cyclin E and is unable to arrest cells in the G1 phase of the cell cycle [27,28]. Both p21 expression constructs activated the promoter-reporter by 2- to 2.5-fold in undifferentiated F9 cells and by about 3fold in cells differentiated in 0.5 AM RA for 4 days prior to transfection (Fig. 5A). We used only RA-treated cells in this assay because the presence of dbcAMP activated TM promoter already without p21 and only weak additive increase could be observed by simultaneous expression of ectopic p21 (data not shown). If p21 protein accelerates transcription from the TM promoter, reduced expression of p21 should decrease the promoter activity. To test this, we used the p21-ASexpressing construct in transient assays with the TM promoter in F9 cells which were differentiated in RA for 4 days. These cells express the endogenous p21 protein at levels slightly lower than cells differentiated in the presence of RA + dbcAMP (data not shown). As shown in Fig. 5B (left panel), p21-AS construct markedly reduced the reporter activity, by about 50%, both in the absence and presence of dbcAMP. The decrease was evident also when the p21specific siRNA was cotransfected (Fig. 5B right panel). In this case, however, only a mild but reproducible reduction was seen when transfected cells were cultured in the presence of dbcAMP. The effect was highly specific because an unrelated siRNA duplex had no effect on reporter activities (Fig. 5B, right panel). Together, the reporter analyses are suggestive of a positive regulation of the TM gene promoter by the p21 protein. We further asked whether the increase of p21 in F9 cells may affect the expression of endogenous TM. We confirmed that the TM mRNA was strongly elevated 24 h post-addition of dbcAMP on F9 cells maintained for 4 days in RA (primitive endoderm) and thus can be used as a reliable marker for parietal endoderm when determined by RT-PCR (data not shown). We then assessed the expression of the p21 protein and TM messenger RNA, along with the control message encoding ribosomal protein 36B4, in stable F9 clones transfected with an empty plasmid or expressing p21 forcibly. Although no apparent difference in the TM signal between the two clones was observed on days 2 to 4 (data not shown), a period in which cells had only transited to the fully differentiated state, a prominent upregulation of the TM mRNA was clearly evident in samples taken at days 5 and 6 (Fig. 5C). At these days, TM is expressed in native F9 cells (Fig. 2A), and a weak signal in control lanes (Fig. 5C) is due to the use of low cycle-PCR products and low exposure time to detect the sharp increase of the TM mRNA level in a p21-overexpressing clone. We have seen similar

300

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

TM message upregulation in three independent experiments with different clones and with different probes used for hybridization of PCR products (data not shown). Thus, profound change in TM expression accompanies a relatively low (though supraphysiological) increase of the p21 level in overexpressing clones. The data together suggest a positive modulation of endogenous TM transcription by ectopic p21 protein in F9 cells that complete differentiation into PE. p21 activates synthetic CRE-dependent, forskolin-stimulated promoter in 293 cells To ascertain if p21 stimulates transcription from a different cAMP-responsive promoter and in a different cell type, we tested the minimal synthetic promoter comprising of the five CRE sites located upstream of a TATA-like

sequence linked to the luciferase gene in human embryonal kidney 293 cells. This promoter was activated by about 3fold in the presence of forskolin, an adenylate cyclase activator, and the effect was further increased nearly 2-fold by cotransfecting human p21 expression vector, while no activation was seen with p21 alone (Fig. 5D). These data indicate that the p21 CDK inhibitor might have a more general effect in modulating the cAMP transcriptional response. TM promoter is susceptible to p21-mediated activation by derepressing the p300 CRD1 Transcriptional coactivators, p300 and CBP, have been reported to harbor an intrinsic repression domain that counteracts their transactivation function [29,40]. This short

Fig. 5. (A) Transfection of the p21 expression vector stimulates the TM promoter-reporter activity in F9 cells. 40 ng of pGL3-TMpr-DPst was transiently transfected along with 0.8 Ag of vector DNA or the pCMV-p21 expression vector, or its deleted version pCMV-p21(del17–23) (p21D). Both undifferentiated cells (left panel) and cells differentiated in RA for 4 days prior to transfection (right panel) were analyzed. (B) F9 cells which were cultured in medium containing 0.5 AM RA for 4 days were transfected with 40 ng of pGL3-TMpr-DPst and the p21 AS plasmid construct (0.8 Ag) or siRNA duplexes (0.8 Ag). Medium containing dbcAMP (1 mM final concentration) was added to indicated samples 15 h before harvesting. Unrelated siRNA directed to melanocytespecific microphthalmia-associated transcription factor, which is not expressed in F9 cells, was used as a control. (C) Upregulated levels of p21 protein in the F9 clone expressing p21 ectopically are accompanied with elevated thrombomodulin mRNA. Quantitative RT-PCR was performed by low cycle PCR and aliquots of samples were electrophoresed and hybridized to the specific probes as described in Materials and methods. Equal signals for the 36B4 housekeeping gene confirmed the specificity of increase of the TM mRNA. Days 5 and 6 of the full differentiation into PE are shown. (D) Minimal promoter containing TATA-like sequence and five CRE sites is synergistically stimulated by forskolin and human p21. Transfected 293 cells were treated with vehicle (DMSO) or 20 AM forskolin 15 h before harvesting. Luciferase activity was determined as in A and B. For experiments in A, B, and D, at least four independent transfections with different clones of expression plasmids gave similar results and one experiment is presented. Values are means of duplicates F SE. RLU, relative luciferase units.

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

domain, named CRD1 (residues 1017 to 1029 in p300), contains sites which can be modified by binding the ubiquitin-like proteins SUMO 1–3. Consequently, recruitment of histone deacetylase 6 to the SUMO-modified CRD1 mediates transcriptional repression [41]. Importantly, the CRD1 is sensitive to overexpression of p21, which is capable of counterbalancing its repressory effect in the p300 protein context resulting in a strong enhancement of the p300-mediated coactivation [29]. Relevant to our findings, we asked whether the TM promoter could be stimulated by p21 through this mechanism in F9 cells. Similarly as reported, we exploited the GAL-p300(1–1303) expression vector comprising a strong N-terminal activation domain and CRD1 to challenge the reporter activity by directly recruiting p300 to the promoter [29,40]. Because short proximal promoters with sequences around the TATA box are sufficient to be p21-responsive when the p300 protein is tethered to the promoter through the GAL sites [40], we constructed the truncated reporter plasmid pG5-TMpr + 222 and determined its sensitivity to activation by p21. As shown in Fig. 6, the reporter activity increased only marginally by expression of GAL-p300(1–1303) in undifferentiated F9 cells (lanes 1,2, left panel), but about 3-fold activation could be achieved by cotransfecting the pCMVp21 expression plasmid (lane 3). RA-differentiated F9 cells revealed more than 2-fold increase by GAL-p300(1–1303) and an additional 2.5-fold activation in the presence of p21 (middle panel). In U2-OS cells, GAL-p300(1–1303) alone activated about 6-fold and p21 caused a 3-fold super-

Fig. 6. Ectopic p21 can potentiate the activity of the thrombomodulin promoter-recruited p300(1–1303) protein. Zero point 1 Ag of the promoter construct G5-TMpr-222 was transfected along with 0.1 Ag pf GAL-p300(1– 1303) (or an empty GAL vector) and 0.5 Ag pf pCMV-p21 or vector DNA. 0.6 Ag of pCMV-GAL-p21 was transfected to verify that the tethered p21 does not activate transcription (lane 4). Three independent transfections revealed similar results and one experiment is presented. Values are means of duplicates F SE. RLU, relative luciferase units. Undifferentiated F9 cells, F9 cells differentiated for 4 days in 0.5 AM RA, and U2-OS cells were transfected.

301

activation (right panel, lanes 1–3). Lastly, we confirmed that the GAL-p21 fusion construct was unable to activate transcription when tethered to the promoter in all cell lines (Fig. 6, lanes 4). These results thus support the possibility that p21 stimulates transcription from the TM promoter by increasing the coactivator activity of the p300/CBP proteins.

Discussion Block of proliferation is a characteristic feature of cells that are induced to differentiate but molecular connections between these two processes are generally poorly understood. We have employed here F9 teratocarcinoma cell line to examine the changes in cell cycle-related proteins during the induced differentiation into parietal endoderm. We have found that both p21 protein and mRNA are dramatically accumulated at days 5 and 6 in the differentiation medium containing RA + dbcAMP. We also observed a diminution of the cyclin D1 protein level; a decrease has been shown earlier for its mRNA during the F9 PE differentiation [31]. Downregulation of cyclin D3 mRNA has been reported previously [31,42]. We observed, however, that the cyclin D3 protein did not change appreciably (Fig. 1A). It might be, therefore, that cyclin D3 protein stability is increased during the differentiation to PE, however, we did not study this further. An N-terminally truncated isoform of cyclin A2 which also binds CDK2 but localizes to the cytoplasm was identified [43] and its level increased during differentiation of mouse embryonic stem cells [44]. While we did not see any changes in levels of full-length cyclin A2 in F9 cells undergoing differentiation into PE, the truncated form decreased from day 4 onwards (Fig. 1A). A second fast migrating form, presumably also truncated cyclin A2, slightly attenuated by day 4 as well. We showed that a decrease of the kinase activity associated with the cyclinE–CDK2 complex was much less dramatic than the p21 upregulation. Because the cyclin partners of CDK2, cyclins A and E, as well as the CDK2 itself exhibited unchanged levels (Fig. 1A), and were present in similar amounts in immunoprecipitates formed with anti-CDK2 or anti-cyclin E/A antibodies (Fig. 1B and data not shown), the activity of the cyclin E–CDK2 complex in cell extracts from differentiated cells might be inhibited by the elevated level of p21 and by a presumed higher availability of p27 after its liberation from the cyclin D1– CDK4 complex, the concentration of which is likely diminished due to the decline of cyclin D1. We suggest that mainly p21 participates in inhibiting the activity of the CDK2–cyclin E complex, since its presence in the complex during differentiation increased more prominently than that of p27 (Fig. 1B). Of note, the p21 levels were recently reported to decrease following RA treatment [45]. The authors used high-speed supernatants from lysed cells as samples for Western blots. We repeatedly observed a sharp increase of p21 protein in samples from days 5 and 6 in cell

302

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

extracts prepared in RIPA or sodium dodecyl sulphate electrophoresis buffers. Also recently, no marked changes in p21 levels were observed during a 4-day differentiation with RA [25]. It therefore appears that the augmentation of p21 is specific for the final stages of parietal endodermal type of differentiation. Previous studies utilizing specific ribozymes to functionally knockout p300 or CBP established a requirement of the p300 coactivator for RA-mediated differentiation and induction of p21, whereas the CBP was necessary for p27(Kip1) induction [7]. Our data showing an increased level of p21 in PE-directed differentiation are consistent with these findings. Human p21 gene was shown to be RA-responsive with the RARE element in its promoter being necessary for this induction [32]. RARa receptor mediated the RA-induced differentiation of acute promyelocytic leukemia cells and activated the p21 transcription, which was required for this differentiation independently of its function in the G1-S cell cycle phase transition [18]. Consistent with this is the finding that RARa, as a heterodimer with RXRa, is important for the PE differentiation of F9 cells [3,6]. We demonstrated here that the p21 mRNA substantially increased during the latest stages of parietal differentiation, indicating that increased transcription and/or mRNA stability (which is less likely) underlie the profound protein accumulation. A reduction of proteasomal turnover by RA has been recently observed for the p27(Kip1) CDK inhibitor when the embryonal carcinoma cells NT2 were induced to differentiate along the neuronal pathway [46]. We have noted here a reduced degradation of p21 protein upon differentiation, which might also contribute to the final p21 increase. We further demonstrated that the TM promoter-reporter is activated upon p21 cotransfection, both in undifferentiated and RA-differentiated F9 cells. Importantly as well, the endogenous level of TM message was increased in the clone expressing an exogenously elevated amount of p21. TM is a PE-specific marker with its promoter being cAMP-inducible [10,47,48]. As shown here, the TM promoter also appears to be p21-activable. Paralogous proteins, p300 and CBP, are cofactors for the cAMP pathway-elicited transcriptional response. They bind the serine 133-phosphorylated CREB transcription factor by the KIX domain at the N-terminus and utilize the intrinsic histone acetyltransferase activity for coactivation [49–51]. Therefore, the cAMP-responsive genes might be considered as potentially upregulatable by p21, which was shown to augment the p300/CBP coactivation function through counteracting the repressive activity of the CRD1 domain. The mechanism of CRD1 derepression by p21 is still unclear, however. It does not involve a direct binding and occurs independently of cell cycle inhibition, as evidenced by a full activity of mutants lacking the binding sites for cyclins or CDK2 [40]. In this work, we have also observed that the cyclin E bindingdeficient mutant of p21 was capable of activating the TM promoter as efficiently as wild type (Fig. 5A). We also

tested if the CRE-like site-mutated promoter could be activated by p21 and found that its activity diminished, but was not completely lost. However, the response to dbcAMP was also not completely abolished, suggesting a possibility that other nonconsensus sites might mediate both the cAMP signaling and p21-responsiveness (data not shown). Previous studies have documented a high level of p300 protein in undifferentiated F9 cells and its dramatic decrease during F9 differentiation due to enhanced degradation [52,53]. As suggested, this high concentration of p300 could underlie the inactivity of the SV40 enhancer ascribed to the E1A-like activity in these cells [52]. Hypothetically, the repressive activity of CRD1 might overbalance the p300s coactivation function at high cellular concentration. This might also explain why the GAL-p300(1–1303) protein only negligibly activated the pG5-TM-222 promoter construct in undifferentiated F9 cells while approximately 2fold increase was observed in F9 cells differentiated in the presence of RA (Fig. 6, lanes 1, 2). Although our data suggest, but does not directly implicate the p21 protein as being a possible activator of the cAMP/PKA/CREB/CBP signaling pathway at the transcriptional level, it remains to be determined whether its role in gene transcription in response to cAMP signaling is more general or cell context-restricted. In support of the former possibility, we have shown here that the activity of a simple artificial promoter whose activity depends on the five CRE sites is costimulated by forskolin and p21 in human cells whilst p21 alone cannot activate the promoter (Fig. 5D). Secondly, we observed a synergistic activation of the cAMP-responsive melanocyte-specific promoter in melanoma cells upon ectopic p21 expression and stimulation of the cAMP pathway (data not shown). Thirdly, a promotion of CREB signaling by p21 was reported in Rat-1 cells [54]. Taken together, that p21 positively modulates transcriptional outcome of the cAMP signaling pathway is compatible with its known role in enhancing the p300 coactivator activity and it remains to be established which known cAMP pathway-dependent promoters respond to changes of cellular p21 levels. p21 has been shown to protect against apoptosis in many cell types, predominantly by inhibiting the procaspase-3 activation after relocalization to the cytoplasm [14,15,55,56]. In this work, the observed effect of p21 decrease on the number of apoptotic cells in the differentiating p21-AS-expressing clone (Fig. 4A) is in accordance with the known role of p21 as an inhibitor of apoptosis, and is further supported by its cytoplasmic localization in a subset of differentiated cells while p21 is exclusively nuclear in all undifferentiated F9 cells (Fig. 4C). We have further seen a marked shift of cell cycle profile towards a larger percentage of cells in the G2 phase in this clone (Fig. 4A). Although siRNA or AS cDNA inhibited the transiently transfected TM promoter-reporter, the lower level of p21 in the AS clone did not have any

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

significant influence on the expression of endogenous TM (data not shown). It might be therefore inferred that apoptosis and G1 phase regulation are more sensitive to diminishing the p21 protein level than the transcription of the endogenous TM gene, which could be nevertheless activated by a supraphysiologically elevated p21 (Fig. 5C). In summary, we have provided evidence supporting a role for p21 in the differentiation of F9 teratocarcinoma cells into PE and suggested a possible function of this cyclin dependent kinase inhibitor in modulating the cAMP pathway-mediated activation of transcription. Elucidation of the precise mechanisms through which p21 might activate the cAMP-responsive promoters independently of the cell cycle regulation in other cell models will be the subject of future investigations.

Acknowledgments This work was supported by an institutional research project (No. MZ00000064211) from Ministry of Health, Czech Rep. We thank Dr. Vlcˇek for automatic sequencing of plasmids. We acknowledge the excellent technical assistance of H. Novotna´.

References [1] S. Strickland, K.K. Smith, K.R. Marotti, Hormonal induction of differentiation in teratocarcinoma stem cells: generation of parietal endoderm by retinoic acid and dibutyryl cAMP, Cell 21 (1980) 347 – 355. [2] H. Chiba, J. Clifford, D. Metzger, P. Chambon, Specific and redundant functions of retinoid X Receptor/Retinoic acid receptor heterodimers in differentiation, proliferation, and apoptosis of F9 embryonal carcinoma cells, J. Cell Biol. 139 (1997) 735 – 747. [3] C. Rochette-Egly, P. Chambon, F9 embryocarcinoma cells: a cell autonomous model to study the functional selectivity of RARs and RXRs in retinoid signaling, Histol. Histopathol. 16 (2001) 909 – 922. [4] J. Clifford, H. Chiba, D. Sobieszczuk, D. Metzger, P. Chambon, RXRalpha-null F9 embryonal carcinoma cells are resistant to the differentiation, anti-proliferative and apoptotic effects of retinoids, EMBO J. 15 (1996) 4142 – 4155. [5] C. Rochette-Egly, J.L. Plassat, R. Taneja, P. Chambon, The AF-1 and AF-2 activating domains of retinoic acid receptor-alpha (RARalpha) and their phosphorylation are differentially involved in parietal endodermal differentiation of F9 cells and retinoid-induced expression of target genes, Mol. Endocrinol. 14 (2000) 1398 – 1410. [6] R. Taneja, C. Rochette-Egly, J.L. Plassat, L. Penna, M.P. Gaub, P. Chambon, Phosphorylation of activation functions AF-1 and AF-2 of RAR alpha and RAR gamma is indispensable for differentiation of F9 cells upon retinoic acid and cAMP treatment, EMBO J. 16 (1997) 6452 – 6465. [7] H. Kawasaki, R. Eckner, T.P. Yao, K. Taira, R. Chiu, D.M. Livingston, K.K. Yokoyama, Distinct roles of the co-activators p300 and CBP in retinoic-acid-induced F9-cell differentiation, Nature 393 (1998) 284 – 289. [8] D. Chakravarti, V.J. LaMorte, M.C. Nelson, T. Nakajima, I.G. Schulman, H. Juguilon, M. Montminy, R.M. Evans, Role of CBP/ P300 in nuclear receptor signalling, Nature 383 (1996) 99 – 103.

303

[9] A.S. Espeseth, S.P. Murphy, E. Linney, Retinoic acid receptor expression vector inhibits differentiation of F9 embryonal carcinoma cells, Genes Dev. 3 (1989) 1647 – 1656. [10] H. Weiler-Guettler, K. Yu, G. Soff, L.J. Gudas, R.D. Rosenberg, Thrombomodulin gene regulation by cAMP and retinoic acid in F9 embryonal carcinoma cells, Proc. Natl. Acad. Sci. U. S. A. 89 (1992) 2155 – 2159. [11] C.J. Sherr, J.M. Roberts, CDK inhibitors: positive and negative regulators of G1-phase progression, Genes Dev. 13 (1999) 1501 – 1512. [12] A. Vidal, A. Koff, Cell-cycle inhibitors: three families united by a common cause, Gene 247 (2000) 1 – 15. [13] G.P. Dotto, p21(WAF1/Cip1): more than a break to the cell cycle? Biochim. Biophys. Acta 1471 (2000) M43 – M56. [14] A.L. Gartel, A.L. Tyner, The role of the cyclin-dependent kinase inhibitor p21 in apoptosis, Mol. Cancer Ther. 1 (2002) 639 – 649. [15] O. Coqueret, New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment? Trends Cell Biol. 13 (2003) 65 – 70. [16] J.A. Erhardt, R.N. Pittman, Ectopic p21(WAF1) expression induces differentiation-specific cell cycle changes in PC12 cells characteristic of nerve growth factor treatment, J. Biol. Chem. 273 (1998) 23517 – 23523. [17] J.A. Erhardt, R.N. Pittman, p21WAF1 induces permanent growth arrest and enhances differentiation, but does not alter apoptosis in PC12 cells, Oncogene 16 (1998) 443 – 451. [18] T. Casini, P.G. Pelicci, A function of p21 during promyelocytic leukemia cell differentiation independent of CDK inhibition and cell cycle arrest, Oncogene 18 (1999) 3235 – 3243. [19] G. Baldassarre, M.V. Barone, B. Belletti, C. Sandomenico, P. Bruni, S. Spiezia, A. Boccia, M.T. Vento, A. Romano, S. Pepe, A. Fusco, G. Viglietto, Key role of the cyclin-dependent kinase inhibitor p27kip1 for embryonal carcinoma cell survival and differentiation, Oncogene 18 (1999) 6241 – 6251. [20] J. Zezula, P. Casaccia-Bonnefil, S.A. Ezhevsky, D.J. Osterhout, J.M. Levine, S.F. Dowdy, M.V. Chao, A. Koff, p21cip1 is required for the differentiation of oligodendrocytes independently of cell cycle withdrawal, EMBO Rep. 2 (2001) 27 – 34. [21] Y. Negishi, N. Ui, M. Nakajima, K. Kawashima, K. Maruyama, T. Takizawa, H. Endo, p21Cip-1/SDI-1/WAF-1 gene is involved in chondrogenic differentiation of ATDC5 cells in vitro, J. Biol. Chem. 276 (2001) 33249 – 33256. [22] G. Redeuilh, A. Attia, J. Mester, M. Sabbah, Transcriptional activation by the oestrogen receptor alpha is modulated through inhibition of cyclin-dependent kinases, Oncogene 21 (2002) 5773 – 5782. [23] B.D. Chang, K. Watanabe, E.V. Broude, J. Fang, J.C. Poole, T.V. Kalinichenko, I.B. Roninson, Effects of p21Waf1/Cip1/Sdi1 on cellular gene expression: implications for carcinogenesis, senescence, and age-related diseases, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 4291 – 4296. [24] T.N. Faria, C. Mendelsohn, P. Chambon, L.J. Gudas, The targeted disruption of both alleles of RARbeta(2) in F9 cells results in the loss of retinoic acid-associated growth arrest, J. Biol. Chem. 274 (1999) 26783 – 26788. [25] R. Li, T.N. Faria, M. Boehm, E.G. Nabel, L.J. Gudas, Retinoic acid causes cell growth arrest and an increase in p27 in F9 wild type but not in F9 retinoic acid receptor beta2 knockout cells, Exp. Cell Res. 294 (2004) 290 – 300. [26] Y. Shirayoshi, S. Imada, S. Katayanagi, M. Uyeno, M. Imada, Cyclic AMP-mediated augmentation of thrombomodulin gene expression: cell type-dependent usage of control regions, Exp. Cell Res. 208 (1993) 75 – 83. [27] J. Chen, P. Saha, S. Kornbluth, B.D. Dynlacht, A. Dutta, Cyclinbinding motifs are essential for the function of p21CIP1, Mol. Cell. Biol. 16 (1996) 4673 – 4682. [28] J.A. Wohlschlegel, B.T. Dwyer, D.Y. Takeda, A. Dutta, Mutational analysis of the Cy motif from p21 reveals sequence degeneracy and specificity for different cyclin-dependent kinases, Mol. Cell. Biol. 21 (2001) 4868 – 4874.

304

B. Drdova´, J. Vachtenheim / Experimental Cell Research 304 (2005) 293–304

[29] A.W. Snowden, L.A. Anderson, G.A. Webster, N.D. Perkins, A novel transcriptional repression domain mediates p21(WAF1/CIP1) induction of p300 transactivation, Mol. Cell. Biol. 20 (2000) 2676 – 2686. [30] J. Vachtenheim, H. Novotna, Expression of the aromatic L-amino acid decarboxylase mRNA in human tumour cell lines of neuroendocrine and neuroectodermal origin, Eur. J. Cancer 33 (1997) 2411 – 2417. [31] Y. Li, M.A. Glozak, S.M. Smith, M.B. Rogers, The expression and activity of D-type cyclins in F9 embryonal carcinoma cells: modulation of growth by RXR-selective retinoids, Exp. Cell Res. 253 (1999) 372 – 384. [32] M. Liu, A. Iavarone, L.P. Freedman, Transcriptional activation of the human p21(WAF1/CIP1) gene by retinoic acid receptor. Correlation with retinoid induction of U937 cell differentiation, J. Biol. Chem. 271 (1996) 31723 – 31728. [33] R.J. Sheaff, J.D. Singer, J. Swanger, M. Smitherman, J.M. Roberts, B.E. Clurman, Proteasomal turnover of p21Cip1 does not require p21Cip1 ubiquitination, Mol. Cell 5 (2000) 403 – 410. [34] A.B. Malashicheva, T.V. Kislyakova, N.D. Aksenov, K.A. Osipov, V.A. Pospelov, F9 embryonal carcinoma cells fail to stop at G1/S boundary of the cell cycle after gamma-irradiation due to p21WAF1/ CIP1 degradation, Oncogene 19 (2000) 3858 – 3865. [35] A. Suzuki, Y. Tsutomi, M. Miura, K. Akahane, Caspase 3 inactivation to suppress Fas-mediated apoptosis: identification of binding domain with p21 and ILP and inactivation machinery by p21, Oncogene 18 (1999) 1239 – 1244. [36] A. Suzuki, Y. Tsutomi, K. Akahane, T. Araki, M. Miura, Resistance to Fas-mediated apoptosis: activation of caspase 3 is regulated by cell cycle regulator p21WAF1 and IAP gene family ILP, Oncogene 17 (1998) 931 – 939. [37] S.Q. Xu, W.S. El-Deiry, p21(WAF1/CIP1) inhibits initiator caspase cleavage by TRAIL death receptor DR4, Biochem. Biophys. Res. Commun. 269 (2000) 179 – 190. [38] B.P. Zhou, Y. Liao, W. Xia, B. Spohn, M.H. Lee, M.C. Hung, Cytoplasmic localization of p21Cip1/WAF1 by Akt-induced phosphorylation in HER-2/neu-overexpressing cells, Nat. Cell Biol. 3 (2001) 245 – 252. [39] A. Suzuki, H. Kawano, M. Hayashida, Y. Hayasaki, Y. Tsutomi, K. Akahane, Procaspase 3/p21 complex formation to resist fas-mediated cell death is initiated as a result of the phosphorylation of p21 by protein kinase A, Cell Death Differ. 7 (2000) 721 – 728. [40] D.J. Gregory, E. Garcia-Wilson, J.C. Poole, A.W. Snowden, I.B. Roninson, N.D. Perkins, Induction of transcription through the p300 CRD1 motif by p21WAF1/CIP1 is core promoter specific and cyclin dependent kinase independent, Cell Cycle 1 (2002) 343 – 350. [41] D. Girdwood, D. Bumpass, O.A. Vaughan, A. Thain, L.A. Anderson, A.W. Snowden, E. Garcia-Wilson, N.D. Perkins, R.T. Hay, P300 transcriptional repression is mediated by SUMO modification, Mol. Cell 11 (2003) 1043 – 1054. [42] T.N. Faria, G.J. LaRosa, E. Wilen, J. Liao, L.J. Gudas, Characterization of genes which exhibit reduced expression during the retinoic acid-induced differentiation of F9 teratocarcinoma cells: involvement

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50] [51]

[52]

[53]

[54]

[55] [56]

of cyclin D3 in RA-mediated growth arrest, Mol. Cell. Endocrinol. 143 (1998) 155 – 166. H. Kaufmann, R. Marone, M.A. Olayioye, J.E. Bailey, M. Fussenegger, Characterization of an N-terminally truncated cyclin A isoform in mammalian cells, J. Biol. Chem. 276 (2001) 29987 – 29993. M. Anger, V. Bryja, L. Jirmanova, A. Hampl, M. Carrington, J. Motlik, P. Dvorak, M. Kubelka, The appearance of truncated cyclin A2 correlates with differentiation of mouse embryonic stem cells, Biochem. Biophys. Res. Commun. 302 (2003) 825 – 830. J. Bastien, S. Adam-Stitah, J.L. Plassat, P. Chambon, C. RochetteEgly, The phosphorylation site located in the A region of retinoic X receptor alpha is required for the antiproliferative effect of retinoic acid (RA) and the activation of RA target genes in F9 cells, J. Biol. Chem. 277 (2002) 28683 – 28689. G. Baldassarre, A. Boccia, P. Bruni, C. Sandomenico, M.V. Barone, S. Pepe, T. Angrisano, B. Belletti, M.L. Motti, A. Fusco, G. Viglietto, Retinoic acid induces neuronal differentiation of embryonal carcinoma cells by reducing proteasome-dependent proteolysis of the cyclin- dependent inhibitor p27, Cell Growth Differ. 11 (2000) 517 – 526. P. Niforas, G.M. Sanderson, C.H. Bird, P. Bird, Characterization of the mouse thrombomodulin gene and functional analysis of the 5Vflanking region in F9 teratocarcinoma cells, Biochim. Biophys. Acta 1173 (1993) 179 – 187. P. Niforas, M.D. Chu, P. Bird, A retinoic acid/cAMP-responsive enhancer containing a cAMP responsive element is required for the activation of the mouse thrombomodulin-encoding gene in differentiating F9 cells, Gene 176 (1996) 139 – 147. E. Korzus, J. Torchia, D.W. Rose, L. Xu, R. Kurokawa, E.M. McInerney, T.M. Mullen, C.K. Glass, M.G. Rosenfeld, Transcription factor-specific requirements for coactivators and their acetyltransferase functions, Science 279 (1998) 703 – 707. N. Vo, R.H. Goodman, CREB-binding protein and p300 in transcriptional regulation, J. Biol. Chem. 276 (2001) 13505 – 13508. B. Mayr, M. Montminy, Transcriptional regulation by the phosphorylation-dependent factor CREB, Nat. Rev., Mol. Cell Biol. 2 (2001) 599 – 609. M. Ota, K. Eto, Y. Ninomiya, M. Ikeda, Accumulation of p300 mediates transcriptional repression of simian virus 40 enhancer in undifferentiated F9 embryonal carcinoma cells, Cell Growth Differ. 9 (1998) 989 – 997. F. Brouillard, C.E. Cremisi, Concomitant increase of histone acetyltransferase activity and degradation of p300 during retinoic acid-induced differentiation of F9 cells, J. Biol. Chem. 278 (2003) 39509 – 39516. S. Kawata, Y. Ariumi, K. Shimotohno, p21(Waf1/Cip1/Sdi1) prevents apoptosis as well as stimulates growth in cells transformed or immortalized by human T-cell leukemia virus type 1-encoded tax, J. Virol. 77 (2003) 7291 – 7299. M.V. Blagosklonny, Are p27 and p21 cytoplasmic oncoproteins? Cell Cycle 1 (2002) 391 – 393. R.H. Weiss, p21Waf1/Cip1 as a therapeutic target in breast and other cancers, Cancer Cell 4 (2003) 425 – 429.