- Email: [email protected]
A selective medium for the isolation of Corynebacterium species in oral cavities
Journal of Microbiological Methods 104 (2014) 67–71
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
A selective medium for the isolation of Corynebacterium species in oral cavities Osamu Tsuzukibashi a,⁎, Satoshi Uchibori b, Noriko Shinozaki-Kuwahara a, Taira Kobayashi b, Kazuko Takada a, Masatomo Hirasawa a a b
Department of Oral Microbiology, Nihon University, School of Dentistry at Matsudo, Chiba 271-8587, Japan Department of Crown Bridge Prosthodontics, Nihon University, School of Dentistry at Matsudo, Chiba 271-8587, Japan
a r t i c l e
i n f o
Article history: Received 29 March 2014 Received in revised form 4 June 2014 Accepted 4 June 2014 Available online 24 June 2014 Keywords: Genus Corynebacterium Selective medium Oral cavity
a b s t r a c t Corynebacterium matruchotii is a microbial inhabitant in the oral cavity of humans and is associated with the formation of dental calculi. C. matruchotii forms highly specific morphological units, which are referred to as corncobs. Although other Corynebacterium species have frequently been isolated from the oral cavity of humans, their distribution has not been reported as extensively. The aim of the present study was to develop a selective medium to isolate the genus Corynebacterium and examine the distribution Corynebacterium species in the oral cavity of humans. The growth recoveries of representative Corynebacterium species on the selective medium were sufficient. Moreover, the growth of other representative oral bacteria was markedly inhibited on the selective medium. The proportion of Corynebacterium species in saliva samples collected from 20 subjects was examined. PCR primers were designed for the oral Corynebacterium species. C. matruchotii and Corynebacterium durum accounted for 0.3% and 1.5% of the total cultivable bacteria number on the BHI medium from saliva samples, respectively. The selective medium could distinguish C. matruchotii from C. durum by each colony color using differences in acid production from galactose. The selective medium, designated OCM, was useful for isolating oral Corynebacterium species. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The genus Corynebacterium consists of 88 species and 11 subspecies. Of these, 53 species occasionally or very rarely infect humans or are transmitted to humans by zoonotic contact, with the remaining 35 species being recovered solely from animals, the environment, water, foodstuffs, or synthetic materials (Bernard, 2012). Among the genus Corynebacterium, Corynebacterium matruchotii is a microbial inhabitant in the oral cavity of humans and is associated with the formation of dental calculi (Takazoe and Itoyama, 1980; Takazoe and Nakamura, 1965). C. matruchotii forms highly specific morphological units, which are referred to as corn-cobs (Jones, 1972). Zhou et al. (2013) recently reported that the prevalence of C. matruchotii was significantly different between periodontally healthy and periodontitis samples taken from diabetes-negative and diabetes-positive groups, and was one of the predominant organisms in periodontally healthy samples from the diabetes-negative group. Although C. matruchotii was proposed to be the main Corynebacterium species, Haraszthy et al. (2007) reported that Corynebacterium durum, which was originally isolated from ⁎ Corresponding author at: Department of Oral Microbiology, Nihon University, School of Dentistry at Matsudo, Japan, 2-870-1, Sakaechou-nishi, Matsudo city, Chiba 271-8587, Japan. Tel.: +81 47 360 9342; fax: +81 47 361 2712. E-mail address: [email protected] (O. Tsuzukibashi).
http://dx.doi.org/10.1016/j.mimet.2014.06.005 0167-7012/© 2014 Elsevier B.V. All rights reserved.
human respiratory tract specimens (Riegel et al., 1997), was detected on the dorsal tongue surface. Corynebacterium diphtheriae has been isolated from the pharynx or skin lesions, while Corynebacterium xerosis and Corynebacterium pseudodiphtheriticum have been detected in the nasopharynx (Funke et al., 1997; Graevenitz et al., 1998). As the nasal and oral cavities are anatomically joined at the pharynx, these organisms may consistently pass through the mouth. Thus, other Corynebacterium species other than C. matruchotii and C. durum may also be detected in the oral cavity of humans; however, the distribution of the genus Corynebacterium in the human oral cavity has not been reported in detail. The aim of this study was to develop a selective medium for the isolation of Corynebacterium species and to examine the distribution of this species in the oral cavity. 2. Materials and methods 2.1. Bacterial strains and culture conditions All bacterial strains used in this study are listed in Tables 1 and 2. The strains were maintained by cultivating them on Bact™ Brain Heart Infusion (BHI, Becton, Dickinson and Co., Sparks, MD, USA) and 1.5% agar (BHI agar). The organisms were cultured overnight at 37 °C in an atmosphere of 5% CO2 in a CO2 incubator (NAPCO® Model 5400; Precision Scientific, Chicago, IL, USA).
68
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
Table 1 Recovery of representative Corynebacterium species and other bacteria on BHI blood and OCM media. Strain
C. matruchotii ATCC 14266 NUM-Cm 7503 C. durum ATCC 33449 NUM-Cd 8002 C. diphtheriae JCM 1310 C.pseudodiphtheriticum JCM 11665 C. xerosis JCM 1971 S. oralis ATCC 10557 S. salivarius HHT S. anginosus ATCC 11391 S. mutans NCTC 10449 A. viscosus ATCC 19246 A. naeslundii ATCC 12104 N. sicca ATCC 29256 R. dentocariosa JCM 3067 a b
BHI blood
OCM
CFU/ml × 108
CFU/ml × 108
Recovery, %
2.2 ± 0.3a 1.9 ± 0.5
2.1 ± 0.3 1.9 ± 0.2
96.2 93.9
1.2 ± 0.6 0.9 ± 0.3
1.1 ± 0.5 0.9 ± 0.7
98.3 96.3
0.7 ± 0.6
0.7 ± 0.3
92.1
0.8 ± 0.4
0.8 ± 0.5
98.1
0.7 ± 0.6
0.7 ± 0.7
95.5
1.3
0.000002
b0.0b
3.2
0.000003
b0.0
5.3
0.000002
b0.0
6.4
0.000003
b0.0
1.3
0.000009
b0.0
1.1
0.000002
b0.0
6.0
0
0
1.1
0
0
Ave ± SD. Less than 1 × 103 CFU/ml.
compared with those on HI or BHI blood agar for total cultivable bacteria. Bacteria were pre-incubated in BHI broth at 37 °C overnight in an atmosphere of 5% CO2 in a CO2 incubator. Tenfold dilutions of cultures were made in 0.9 ml of Tris–HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. Plates were cultured at 37 °C for 48 h in an atmosphere of 5% CO2 in a CO2 incubator and the number of CFU/ml was calculated. 2.4. Clinical samples Clinical specimens were collected from twenty volunteers (age 26–66, male 10, female 10). Paraffin-stimulated whole saliva samples were collected in a sterile microcentrifuge tube. Samples were dispersed by sonication for 30 s in an ice bath (50 W, 20 kHz, Astrason® System model XL 2020, NY., USA). Portions (100 μl) of appropriate dilutions of these samples were plated, in triplicate, on BHI blood agar and selective medium plates. BHI blood agar plates for total cultivable bacteria and selective medium plates were cultured at 37 °C for 72 h in an atmosphere of 5% CO2 in a CO2 incubator, and the number of CFU/ml was calculated for each. This study was approved by the Ethics Committee of Nihon University School of Dentistry at Matsudo, Japan (EC 11-020). 2.5. Identification of oral Corynebacterium species isolated from clinical samples Twenty-four of the approximately 50 colonies that grew on the selective medium plate per subject were randomly isolated, subcultured, and their identity was then confirmed by polymerase chain reaction (PCR) analysis using multiplex PCR methods. 2.6. Design of species-specific primers for oral Corynebacterium species
2.2. Development of the new selective medium 2.2.1. Evaluation of the base medium BHI supplemented with 5% blood agar (BHI blood), BHI blood supplemented with 1% Tween 80 agar (BHI blood Tween 80), and Heart Infusion (HI, Becton, Dickinson) agar were used to examine the base medium for the selective medium. Tenfold dilutions of cultures were made in 0.9 ml of Tris–HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. All plates were cultured at 37 °C for 48 h in an atmosphere of 5% CO2 in a CO2 incubator, and the number of colony-forming units (CFU)/ml was counted.
The design of species-specific primers for C. matruchotii and C. durum, which is presumed to be an oral Corynebacterium species, was performed as follows. Briefly, the 16S rRNA sequences of C. matruchotii (accession no. X82065) and C. durum (accession no. Z97069) were obtained from the DNA Data Bank of Japan (DDBJ; Mishima, Japan), and multiple sequence alignment analyses were carried out using the CLUSTAL W program; i.e., the 16S rRNA sequences of Corynebacterium species were aligned and analyzed. Homologies between the primers selected for C. matruchotii and C. durum were confirmed by a BLAST search. 2.7. Development of multiplex PCR method using designed primers
2.2.2. Susceptibility tests Preliminary studies of antibiotic selection were also performed using disk susceptibility tests (Sensi-Disk, Becton Dickinson Co., MD, USA). The microbroth dilution method was used for susceptibility testing (Hirasawa and Takada, 2002). 2.3. Recovery of representative Corynebacterium species isolated from the human oral cavity and other representative oral bacteria The recovery of representative Corynebacterium species reference strains, isolates from the human oral cavity, and other representative oral bacteria were calculated as CFU/ml on the selective medium
The development of a multiplex PCR method using the designed primers was performed as follows. Bacterial cells were cultured in BHI broth overnight, and 1 ml of the sample was then collected in a microcentrifuge tube and resuspended at a density of 1.0 McFarland standard (approximately 107 CFU in 1 ml of sterile distilled water). A total of 3.6 μl of the suspension was then used as a PCR template. The detection limit of PCR was determined by serially diluting known numbers of bacterial cells in sterile distilled water and then subjecting each suspension to PCR. The multiplex PCR mixture contained 0.5 μM each primer, 10 μl of 2 × MightyAmp Buffer Ver.2 (Takara Bio Inc., Shiga, Japan), 0.4 μl of MightyAmp DNA Polymerase (Takara), and 3.6 μl of the
Table 2 Locations and sequences of species-specific primers for the16S rDNA of C. matruchotii and C. durum. Species
Primer
Sequence
Product size (bp)
Position
Accession number
C.matruchotii C. durum
CMF CMR CDF CDR
TGGTGACGGTACCTTTGTTA CACCCTCACAGGTTAGCAGCGCTT CTGTGTGTTTGCAGTCTGTG TCACTTCACAGTGTCGCAACCCGT
798
447-467 1245-1221 805-825 1243-1219
X82065
438
Z97069
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
template in a final volume of 20 μl. PCR was carried out in a DNA thermal cycler (Applied Biosystems 2720 Thermal Cycler; Applied Biosystems, Carlsbad, CA). PCR conditions included an initial denaturation step at 98 °C for 2 min, followed by 25 cycles consisting of 98 °C for 10 s, 62 °C for 15 s, and 68 °C for 1 min. PCR products were analyzed by 2.0% agarose gel electrophoresis before being visualized by electrophoresis in 1 × Tris–borate–EDTA on a 2% agarose gel stained with ethidium bromide. A 100-bp DNA ladder (Takara Biomed, Shiga, Japan) was used as a molecular size marker.
3. Results 3.1. Development of selective medium 3.1.1. Selection of the base medium Base media for the growth of Corynebacterium species have been studied previously. Representative Corynebacterium species grew well and at similar ratios on BHI blood, BHI blood Tween 80, and HI agar media (data not shown). Oral streptococci (Streptococcus mutans, S. sobrinus, S. salivarius, S. oralis, S. sanguinis, S. gordonii, S. mitis, S. anginosus, S. constellatus, and S. intermedius) grew on HI agar medium in small or pin colonies (data not shown). HI agar medium was ultimately chosen because it inhibits the growth of oral streptococci and the colony size of representative Corynebacterium species on this medium was similar to that on BHI blood agar.
3.1.2. Susceptibility to antibiotics The representative Corynebacterium species used in this study were more resistant to fosfomycin than other oral bacteria. The minimal inhibitory concentrations (MICs) of fosfomycin for representative Corynebacterium species, oral streptococci, Actinomyces naeslundii, Actinomyces viscosus, Neisseria sicca, and Rothia dentocariosa were 50 mg/ml, 0.03 mg/ml, 0.06 mg/ml, 0.06 mg/ml, 0.03 mg/ml, and 0.06 mg/ml, respectively.
3.1.3. Composition of the new selective medium The new selective medium, designated oral Corynebacterium species medium (OCM), was composed of the following (per liter): 25 g of HI, 10 g of galactose, 17 mg of bromocresol purple, 100 mg of fosfomycin, 2 mg of amphotericin B, and 15 g of agar. The antibiotic was added after the base medium had been sterilized and cooled to 50 °C.
69
3.2. Multiplex PCR 3.2.1. Primer design Two specific primer sets covering the upstream regions of the 16S rDNA sequences of C. matruchotii and C. durum were designed in the present study (Table 2). The amplicon sizes of C. matruchotii and C. durum were 798 bp and 438 bp, respectively. 3.2.2. Detection limit The multiplex PCR method was used to identify C. matruchotii and C. durum amplified DNA fragments of the expected size for each species (Fig. 1). The detection limit was determined in the presence of titrated bacterial cells, and the sensitivity of the PCR assay was found to be between 3 × 103 and 3 × 104 CFU per PCR template (3.6 μl) for both the C. matruchotii-specific primer set with strain ATCC 14266 and C. durum-specific primer set with strain ATCC33449 (data not shown). 3.2.3. Assay of representative Corynebacterium species and representative oral bacteria The multiplex PCR method used to identify C. matruchotii and C. durum produced positive bands from the C. matruchotii and C. durum strains, and did not produce any amplicons from other Corynebacterium species. Some Streptococci, Actinomyces, Neisseria, and Corynebacterium, were subjected as representative oral bacteria to PCR using the designed primer sets. No amplicons were produced from any of the representative oral bacteria (Fig. 1). 3.3. Recovery of Corynebacterium strains and inhibition of other representative oral bacteria on the selective medium Table 1 shows the recovery of representative Corynebacterium species reference strains and isolates on OCM relative to BHI blood agar. The growth recoveries of representative Corynebacterium species reference strains and the isolates, which ranged from 91.4% to 96.2% (average 94.4%) on OCM relative to that on BHI blood agar, were sufficient. Table 1 also shows the inhibition of other representative oral bacteria on OCM relative to BHI blood agar. The growth of other representative oral bacteria was markedly inhibited on the selective medium. 3.4. Clinical examination The proportion of Corynebacteria species in saliva from twenty subjects on BHI blood agar and OCM is shown in Table 3. The mean number of total cultivable bacteria was 5.8 × 107 CFU/ml
Fig. 1. Specificity of multiplex PCR assays. Primers were a mixture of CMF, CMR, CDF, and CDR. Lanes: 1, C matruchotii ATCC 14266; 2, C. durum ATCC 33449; 3, C. diphtheriae JCM 1310; 4, C. coyleae JCM 10381; 5, C. pseudodiphtheriticum JCM11665; 6, C. xerosis JCM 1971; 7, C. macginleyi JCM 11684; 8, S. oralis ATC1C 10557; 9, S. salivarius JCM 5707; 10, S. anginosus ATCC 11391; 11, S. mutans NCTC 10449; 12, S. sobrinus ATCC 33478; 13, A. viscosus ATCC 19246; 14, A. naeslundii ATCC 12104; 15, A. odontolyticus NUM-Ao12; 16, R. dentocariosa JCM 3067; 17, N. sicca ATCC 29256. M, molecular size marker (100-bp DNA ladder).
70
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
Table 3 Proportion of Corynebacterium species in saliva samples from 20 subjects. Subject
A B C D E F G H I J K L M N O P Q R S T Average
Total bacteria
C. matruchotii
C. durum
BHI-Y blood
OCM
Detection ratio
OCM
Detection ratio
CFU/ml × 107
CFU/ml × 105
%
CFU/ml × 106
%
10.1 10.7 1.7 3.1 3.1 8.5 2.7 7.2 6.8 3.3 6.0 3.3 7.7 1.6 3.2 9.1 8.9 6.6 4.4 7.7 5.8
6.0 5.1 0.3 0.6 0.4 0.1 0.02 0.3 1.0 8.0 0.2 0,.2 0.6 0.2 0.7 0.1 1.8 2.1 0.3 0.5 1.4
0.6 0.5 0.2 0.2 0.1 0.01 0.01 0.04 0.2 2.4 0.03 0.06 0.08 0.1 0.2 0.01 0.2 0.3 0.07 0.06 0.3
3.7 12.3 0.6 0.4 0.04 0.3 0.2 0.05 0.5 1.2 0.07 0.05 0.6 0.1 0.3 0.05 0.7 0.4 0.06 0.5 1.1
3.7 11.5 3.5 1.2 0.1 0.3 0.8 0.1 0.7 3.6 0.1 0.2 0.8 0.8 0.8 0.05 0.8 0.6 0.1 0.6 1.5
(range: 1.6 × 107–10.7 × 107). Corynebacterium species other than C. matruchotii and C. durum were not detected from saliva samples in this study. The mean numbers of C. matruchotii and C. durum were 1.4 × 10 5 CFU/ml (range: 0.02 × 10 5–8.0 × 105 ) and 1.1 × 106 CFU/ml (range: 0.04 × 106 –12.3 × 10 6), respectively. C. matruchotii and C. durum accounted for 0.3% and 1.5% of all bacteria, respectively, and were detected in all twenty subjects.
In the primary isolation, the C. matruchotii and C. durum colonies on OCM commonly had a rough, dry, folded, and convex appearance (Fig. 2) and also adhered to the agar medium such that they could not be easily scraped off. The colony colors of C. matruchotii and C. durum on OCM were light purple and cream yellow, respectively. Therefore, OCM could distinguish C. matruchotii from C. durum by each colony color using differences in acid production from galactose, which was added to the medium. The average colony sizes of C. matruchotii and C. durum on OCM were 1.3 mm and 2.9 mm in diameter, respectively. 4. Discussion Corynebacterium species exhibit significant phenotypic diversity in colony appearance, requirements for growth factors, and biochemical activities. They also typically grow well under standard growth conditions; however, the growth of some lipophilic species was previously shown to be enhanced by incorporating 0.1 to 1% Tween 80 into blood agar (Bernard, 2012). The representative Corynebacterium species used in this study grew well and at similar recovery ratios on HI agar media as well as BHI blood agar and BHI blood tween 80 agar (data not shown). The colony sizes of the organisms on both culture media were almost equivalent. Therefore, the HI agar medium was chosen as the base material for the selective medium. The representative Corynebacterium species used in this study were more resistant to fosfomycin (MIC 50 mg/ml) than the other oral bacteria. The growth of oral bacteria other than Corynebacterium species could almost be inhibited by the addition of 100 mg/L fosfomycin to the HI agar medium. This concentration of fosfomycin was also the same as the selective medium, CBU agar, used to isolate Corynebacterium urealyticum, which causes urinary tract infections, previously described by Zapardiel et al. (1998). Amphotericin B was added to the selective media to inhibit oral fungus growth on the selective medium. The addition of galactose and bromocresol into the selective medium could distinguish C. matruchotii from C. durum by each colony color using differences
Fig. 2. Stereomicroscope image of C. durum and C. matruchotii colonies on OCM.
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
in acid production from galactose. C. durum was previously shown to be capable of producing acid from galactose, whereas C. matruchotii was not (Riegel et al., 1997). The recovery of representative Corynebacterium species reference strains and isolates on OCM relative to BHI blood agar was compared with those on CBU agar. All tested Corynebacterium species grew well on OCM agar (Table 1), however C. matruchotii and C. psedodiphtherificum among 5 tested species did not grow on CBU agar (data not shown). It was indicated that CBU is not useful for the isolation of oral Corynebacterium species. In the present study, we designed species-specific primers to identify C. matruchotii and C. durum using a multiplex PCR method. These primers were able to distinguish C. matruchotii and C. durum, and did not react with representative oral bacteria or other Corynebacterium species. Moreover, our multiplex PCR method could directly use bacterial cells using MightyAmp DNA Polymerase Ver.2 (Takara) and be completed in approximately 2 h. Saliva is an excellent sample that reflected the intraoral condition, and collecting samples is easy and rapid (Magar et al., 2003). Therefore, paraffin-stimulated whole saliva was used as the clinical specimen in the present study. The distributions of Corynebacterium species including C. matruchotii and C. durum in the oral cavity of humans have not yet been reported in detail. In the present study, C. matruchotii and C. durum were detected in all subjects, and accounted for 0.3% and 1.5% of total cultivable bacteria in saliva, respectively. Corynebacterium species other than C. matruchotii and C. durum were not detected on selective medium plates, on which approximately 50 colonies grew. These results indicated that, in addition to C. matruchotii, C. durum was also a part of the normal flora in the human oral cavity. Furthermore, C. durum was more predominant than C. matruchotii. C. durum was initially proposed by Riegel et al. (1997), and was isolated from human respiratory tract specimens, mainly bronchiole-washing specimens. Graevenitz et al. (1998) reported that C. durum accounted for 47% of coryneform bacteria isolated from 113 throat cultures from healthy individuals. Two C. matruchotii reference strains, ATCC 33449 and ATCC 33822, were recently reclassified into C. durum (Sara et al., 2001). Haraszthy et al. (2007) reported that C. durum was detected on
71
the dorsal tongue surface. The distribution of C. durum in various locations in humans will be examined in the future using the developed selective medium. We developed a selective medium, designated OCM, to isolate Corynebacterium species in the oral cavity of humans. Since OCM is highly selective for Corynebacterium species, it will be useful for determining the distribution and role of this organism in the human oral cavity. References Bernard, K., 2012. The Genus Corynebacterium and other medically relevant Coryneformlike bacteria. J. Clin. Microbiol. 50, 3152–3158. Funke, G., Graevenitz, A., Clarridge, J.E., Bernard, K.A., 1997. Clinical microbiology of coryneform bacteria. Clin. Microbiol. Rev. 10, 125–159. Graevenitz, A., Streit, V.A., Riegel, P., Funke, G., 1998. Coryneform bacteria in throat cultures of healthy individuals. J. Clin. Microbiol. 36, 2087–2088. Haraszthy, V.I., Zambon, J.J., Sreenivasan, P.K., Zambon, M.M., Gerber, D., Rego, R., Parker, C., 2007. Identification of oral bacterial species associated with halitosis. J. Am. Dent. Assoc. 138, 1113–1120. Hirasawa, M., Takada, K., 2002. Susceptibility of Streptococcus mutans and Streptococcus sobrinus to cell wall inhibitors and development of a novel selective medium for S. sobrinus. Caries Res. 36, 155–160. Jones, S.J., 1972. A special relationship between spherical and filamentous microorganisms in mature human dental plaque. Arch. Oral Biol. 17, 613–616. Magar, D.L., Ximenez-Fyvie, L.A., Haffajee, A.D., Socransky, S.S., 2003. Distribution of selected bacterial species on intraoral surfaces. J. Clin. Periodontol. 30, 644–654. Riegel, P., Heller, R., Prevost, G., Jehl, F., Monteil, H., 1997. Corynebacterium durum sp. Nov., from human clinical specimens. Int. J. Syst. Bacteriol. 47, 1107–1111. Sara, L., Rassoulian, B., Brad, T.C., Ladonna, C.C., Kathryn, A.B., Marie, B.C., 2001. Diversity within reference strains of Corynebacterium matruchotii includes Corynebacterium durum and a novel organism. J. Clin. Microbiol. 39, 943–948. Takazoe, I., Itoyama, T., 1980. Analytical electron microscopy of Bacterionema matruchotii calcification. J. Dent. Res. 59, 1090–1094. Takazoe, I., Nakamura, T., 1965. The reaction between metachromatic granules and intracellular calcification of Bacterionema matruchotii. Bull. Tokyo Dent. Coll. 6, 29–42. Zapardiel, J., Nieto, E., Soriano, F., 1998. Evaluation of a new selective medium for the isolation of Corynebacterium urealyticum. J. Med. Microbiol. 47, 79–83. Zhou, M., Rong, R., Munro, D., Zhu, C., Gao, X., Zhang, Q., Dong, Q., 2013. Investigation of the effect of type 2 diabetes mellitus on subgingival plaque microbiota by high-throughput 16S rDNA pyrosequencing. Plos One 8, 1–8.
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
A selective medium for the isolation of Corynebacterium species in oral cavities Osamu Tsuzukibashi a,⁎, Satoshi Uchibori b, Noriko Shinozaki-Kuwahara a, Taira Kobayashi b, Kazuko Takada a, Masatomo Hirasawa a a b
Department of Oral Microbiology, Nihon University, School of Dentistry at Matsudo, Chiba 271-8587, Japan Department of Crown Bridge Prosthodontics, Nihon University, School of Dentistry at Matsudo, Chiba 271-8587, Japan
a r t i c l e
i n f o
Article history: Received 29 March 2014 Received in revised form 4 June 2014 Accepted 4 June 2014 Available online 24 June 2014 Keywords: Genus Corynebacterium Selective medium Oral cavity
a b s t r a c t Corynebacterium matruchotii is a microbial inhabitant in the oral cavity of humans and is associated with the formation of dental calculi. C. matruchotii forms highly specific morphological units, which are referred to as corncobs. Although other Corynebacterium species have frequently been isolated from the oral cavity of humans, their distribution has not been reported as extensively. The aim of the present study was to develop a selective medium to isolate the genus Corynebacterium and examine the distribution Corynebacterium species in the oral cavity of humans. The growth recoveries of representative Corynebacterium species on the selective medium were sufficient. Moreover, the growth of other representative oral bacteria was markedly inhibited on the selective medium. The proportion of Corynebacterium species in saliva samples collected from 20 subjects was examined. PCR primers were designed for the oral Corynebacterium species. C. matruchotii and Corynebacterium durum accounted for 0.3% and 1.5% of the total cultivable bacteria number on the BHI medium from saliva samples, respectively. The selective medium could distinguish C. matruchotii from C. durum by each colony color using differences in acid production from galactose. The selective medium, designated OCM, was useful for isolating oral Corynebacterium species. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The genus Corynebacterium consists of 88 species and 11 subspecies. Of these, 53 species occasionally or very rarely infect humans or are transmitted to humans by zoonotic contact, with the remaining 35 species being recovered solely from animals, the environment, water, foodstuffs, or synthetic materials (Bernard, 2012). Among the genus Corynebacterium, Corynebacterium matruchotii is a microbial inhabitant in the oral cavity of humans and is associated with the formation of dental calculi (Takazoe and Itoyama, 1980; Takazoe and Nakamura, 1965). C. matruchotii forms highly specific morphological units, which are referred to as corn-cobs (Jones, 1972). Zhou et al. (2013) recently reported that the prevalence of C. matruchotii was significantly different between periodontally healthy and periodontitis samples taken from diabetes-negative and diabetes-positive groups, and was one of the predominant organisms in periodontally healthy samples from the diabetes-negative group. Although C. matruchotii was proposed to be the main Corynebacterium species, Haraszthy et al. (2007) reported that Corynebacterium durum, which was originally isolated from ⁎ Corresponding author at: Department of Oral Microbiology, Nihon University, School of Dentistry at Matsudo, Japan, 2-870-1, Sakaechou-nishi, Matsudo city, Chiba 271-8587, Japan. Tel.: +81 47 360 9342; fax: +81 47 361 2712. E-mail address: [email protected] (O. Tsuzukibashi).
http://dx.doi.org/10.1016/j.mimet.2014.06.005 0167-7012/© 2014 Elsevier B.V. All rights reserved.
human respiratory tract specimens (Riegel et al., 1997), was detected on the dorsal tongue surface. Corynebacterium diphtheriae has been isolated from the pharynx or skin lesions, while Corynebacterium xerosis and Corynebacterium pseudodiphtheriticum have been detected in the nasopharynx (Funke et al., 1997; Graevenitz et al., 1998). As the nasal and oral cavities are anatomically joined at the pharynx, these organisms may consistently pass through the mouth. Thus, other Corynebacterium species other than C. matruchotii and C. durum may also be detected in the oral cavity of humans; however, the distribution of the genus Corynebacterium in the human oral cavity has not been reported in detail. The aim of this study was to develop a selective medium for the isolation of Corynebacterium species and to examine the distribution of this species in the oral cavity. 2. Materials and methods 2.1. Bacterial strains and culture conditions All bacterial strains used in this study are listed in Tables 1 and 2. The strains were maintained by cultivating them on Bact™ Brain Heart Infusion (BHI, Becton, Dickinson and Co., Sparks, MD, USA) and 1.5% agar (BHI agar). The organisms were cultured overnight at 37 °C in an atmosphere of 5% CO2 in a CO2 incubator (NAPCO® Model 5400; Precision Scientific, Chicago, IL, USA).
68
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
Table 1 Recovery of representative Corynebacterium species and other bacteria on BHI blood and OCM media. Strain
C. matruchotii ATCC 14266 NUM-Cm 7503 C. durum ATCC 33449 NUM-Cd 8002 C. diphtheriae JCM 1310 C.pseudodiphtheriticum JCM 11665 C. xerosis JCM 1971 S. oralis ATCC 10557 S. salivarius HHT S. anginosus ATCC 11391 S. mutans NCTC 10449 A. viscosus ATCC 19246 A. naeslundii ATCC 12104 N. sicca ATCC 29256 R. dentocariosa JCM 3067 a b
BHI blood
OCM
CFU/ml × 108
CFU/ml × 108
Recovery, %
2.2 ± 0.3a 1.9 ± 0.5
2.1 ± 0.3 1.9 ± 0.2
96.2 93.9
1.2 ± 0.6 0.9 ± 0.3
1.1 ± 0.5 0.9 ± 0.7
98.3 96.3
0.7 ± 0.6
0.7 ± 0.3
92.1
0.8 ± 0.4
0.8 ± 0.5
98.1
0.7 ± 0.6
0.7 ± 0.7
95.5
1.3
0.000002
b0.0b
3.2
0.000003
b0.0
5.3
0.000002
b0.0
6.4
0.000003
b0.0
1.3
0.000009
b0.0
1.1
0.000002
b0.0
6.0
0
0
1.1
0
0
Ave ± SD. Less than 1 × 103 CFU/ml.
compared with those on HI or BHI blood agar for total cultivable bacteria. Bacteria were pre-incubated in BHI broth at 37 °C overnight in an atmosphere of 5% CO2 in a CO2 incubator. Tenfold dilutions of cultures were made in 0.9 ml of Tris–HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. Plates were cultured at 37 °C for 48 h in an atmosphere of 5% CO2 in a CO2 incubator and the number of CFU/ml was calculated. 2.4. Clinical samples Clinical specimens were collected from twenty volunteers (age 26–66, male 10, female 10). Paraffin-stimulated whole saliva samples were collected in a sterile microcentrifuge tube. Samples were dispersed by sonication for 30 s in an ice bath (50 W, 20 kHz, Astrason® System model XL 2020, NY., USA). Portions (100 μl) of appropriate dilutions of these samples were plated, in triplicate, on BHI blood agar and selective medium plates. BHI blood agar plates for total cultivable bacteria and selective medium plates were cultured at 37 °C for 72 h in an atmosphere of 5% CO2 in a CO2 incubator, and the number of CFU/ml was calculated for each. This study was approved by the Ethics Committee of Nihon University School of Dentistry at Matsudo, Japan (EC 11-020). 2.5. Identification of oral Corynebacterium species isolated from clinical samples Twenty-four of the approximately 50 colonies that grew on the selective medium plate per subject were randomly isolated, subcultured, and their identity was then confirmed by polymerase chain reaction (PCR) analysis using multiplex PCR methods. 2.6. Design of species-specific primers for oral Corynebacterium species
2.2. Development of the new selective medium 2.2.1. Evaluation of the base medium BHI supplemented with 5% blood agar (BHI blood), BHI blood supplemented with 1% Tween 80 agar (BHI blood Tween 80), and Heart Infusion (HI, Becton, Dickinson) agar were used to examine the base medium for the selective medium. Tenfold dilutions of cultures were made in 0.9 ml of Tris–HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. All plates were cultured at 37 °C for 48 h in an atmosphere of 5% CO2 in a CO2 incubator, and the number of colony-forming units (CFU)/ml was counted.
The design of species-specific primers for C. matruchotii and C. durum, which is presumed to be an oral Corynebacterium species, was performed as follows. Briefly, the 16S rRNA sequences of C. matruchotii (accession no. X82065) and C. durum (accession no. Z97069) were obtained from the DNA Data Bank of Japan (DDBJ; Mishima, Japan), and multiple sequence alignment analyses were carried out using the CLUSTAL W program; i.e., the 16S rRNA sequences of Corynebacterium species were aligned and analyzed. Homologies between the primers selected for C. matruchotii and C. durum were confirmed by a BLAST search. 2.7. Development of multiplex PCR method using designed primers
2.2.2. Susceptibility tests Preliminary studies of antibiotic selection were also performed using disk susceptibility tests (Sensi-Disk, Becton Dickinson Co., MD, USA). The microbroth dilution method was used for susceptibility testing (Hirasawa and Takada, 2002). 2.3. Recovery of representative Corynebacterium species isolated from the human oral cavity and other representative oral bacteria The recovery of representative Corynebacterium species reference strains, isolates from the human oral cavity, and other representative oral bacteria were calculated as CFU/ml on the selective medium
The development of a multiplex PCR method using the designed primers was performed as follows. Bacterial cells were cultured in BHI broth overnight, and 1 ml of the sample was then collected in a microcentrifuge tube and resuspended at a density of 1.0 McFarland standard (approximately 107 CFU in 1 ml of sterile distilled water). A total of 3.6 μl of the suspension was then used as a PCR template. The detection limit of PCR was determined by serially diluting known numbers of bacterial cells in sterile distilled water and then subjecting each suspension to PCR. The multiplex PCR mixture contained 0.5 μM each primer, 10 μl of 2 × MightyAmp Buffer Ver.2 (Takara Bio Inc., Shiga, Japan), 0.4 μl of MightyAmp DNA Polymerase (Takara), and 3.6 μl of the
Table 2 Locations and sequences of species-specific primers for the16S rDNA of C. matruchotii and C. durum. Species
Primer
Sequence
Product size (bp)
Position
Accession number
C.matruchotii C. durum
CMF CMR CDF CDR
TGGTGACGGTACCTTTGTTA CACCCTCACAGGTTAGCAGCGCTT CTGTGTGTTTGCAGTCTGTG TCACTTCACAGTGTCGCAACCCGT
798
447-467 1245-1221 805-825 1243-1219
X82065
438
Z97069
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
template in a final volume of 20 μl. PCR was carried out in a DNA thermal cycler (Applied Biosystems 2720 Thermal Cycler; Applied Biosystems, Carlsbad, CA). PCR conditions included an initial denaturation step at 98 °C for 2 min, followed by 25 cycles consisting of 98 °C for 10 s, 62 °C for 15 s, and 68 °C for 1 min. PCR products were analyzed by 2.0% agarose gel electrophoresis before being visualized by electrophoresis in 1 × Tris–borate–EDTA on a 2% agarose gel stained with ethidium bromide. A 100-bp DNA ladder (Takara Biomed, Shiga, Japan) was used as a molecular size marker.
3. Results 3.1. Development of selective medium 3.1.1. Selection of the base medium Base media for the growth of Corynebacterium species have been studied previously. Representative Corynebacterium species grew well and at similar ratios on BHI blood, BHI blood Tween 80, and HI agar media (data not shown). Oral streptococci (Streptococcus mutans, S. sobrinus, S. salivarius, S. oralis, S. sanguinis, S. gordonii, S. mitis, S. anginosus, S. constellatus, and S. intermedius) grew on HI agar medium in small or pin colonies (data not shown). HI agar medium was ultimately chosen because it inhibits the growth of oral streptococci and the colony size of representative Corynebacterium species on this medium was similar to that on BHI blood agar.
3.1.2. Susceptibility to antibiotics The representative Corynebacterium species used in this study were more resistant to fosfomycin than other oral bacteria. The minimal inhibitory concentrations (MICs) of fosfomycin for representative Corynebacterium species, oral streptococci, Actinomyces naeslundii, Actinomyces viscosus, Neisseria sicca, and Rothia dentocariosa were 50 mg/ml, 0.03 mg/ml, 0.06 mg/ml, 0.06 mg/ml, 0.03 mg/ml, and 0.06 mg/ml, respectively.
3.1.3. Composition of the new selective medium The new selective medium, designated oral Corynebacterium species medium (OCM), was composed of the following (per liter): 25 g of HI, 10 g of galactose, 17 mg of bromocresol purple, 100 mg of fosfomycin, 2 mg of amphotericin B, and 15 g of agar. The antibiotic was added after the base medium had been sterilized and cooled to 50 °C.
69
3.2. Multiplex PCR 3.2.1. Primer design Two specific primer sets covering the upstream regions of the 16S rDNA sequences of C. matruchotii and C. durum were designed in the present study (Table 2). The amplicon sizes of C. matruchotii and C. durum were 798 bp and 438 bp, respectively. 3.2.2. Detection limit The multiplex PCR method was used to identify C. matruchotii and C. durum amplified DNA fragments of the expected size for each species (Fig. 1). The detection limit was determined in the presence of titrated bacterial cells, and the sensitivity of the PCR assay was found to be between 3 × 103 and 3 × 104 CFU per PCR template (3.6 μl) for both the C. matruchotii-specific primer set with strain ATCC 14266 and C. durum-specific primer set with strain ATCC33449 (data not shown). 3.2.3. Assay of representative Corynebacterium species and representative oral bacteria The multiplex PCR method used to identify C. matruchotii and C. durum produced positive bands from the C. matruchotii and C. durum strains, and did not produce any amplicons from other Corynebacterium species. Some Streptococci, Actinomyces, Neisseria, and Corynebacterium, were subjected as representative oral bacteria to PCR using the designed primer sets. No amplicons were produced from any of the representative oral bacteria (Fig. 1). 3.3. Recovery of Corynebacterium strains and inhibition of other representative oral bacteria on the selective medium Table 1 shows the recovery of representative Corynebacterium species reference strains and isolates on OCM relative to BHI blood agar. The growth recoveries of representative Corynebacterium species reference strains and the isolates, which ranged from 91.4% to 96.2% (average 94.4%) on OCM relative to that on BHI blood agar, were sufficient. Table 1 also shows the inhibition of other representative oral bacteria on OCM relative to BHI blood agar. The growth of other representative oral bacteria was markedly inhibited on the selective medium. 3.4. Clinical examination The proportion of Corynebacteria species in saliva from twenty subjects on BHI blood agar and OCM is shown in Table 3. The mean number of total cultivable bacteria was 5.8 × 107 CFU/ml
Fig. 1. Specificity of multiplex PCR assays. Primers were a mixture of CMF, CMR, CDF, and CDR. Lanes: 1, C matruchotii ATCC 14266; 2, C. durum ATCC 33449; 3, C. diphtheriae JCM 1310; 4, C. coyleae JCM 10381; 5, C. pseudodiphtheriticum JCM11665; 6, C. xerosis JCM 1971; 7, C. macginleyi JCM 11684; 8, S. oralis ATC1C 10557; 9, S. salivarius JCM 5707; 10, S. anginosus ATCC 11391; 11, S. mutans NCTC 10449; 12, S. sobrinus ATCC 33478; 13, A. viscosus ATCC 19246; 14, A. naeslundii ATCC 12104; 15, A. odontolyticus NUM-Ao12; 16, R. dentocariosa JCM 3067; 17, N. sicca ATCC 29256. M, molecular size marker (100-bp DNA ladder).
70
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
Table 3 Proportion of Corynebacterium species in saliva samples from 20 subjects. Subject
A B C D E F G H I J K L M N O P Q R S T Average
Total bacteria
C. matruchotii
C. durum
BHI-Y blood
OCM
Detection ratio
OCM
Detection ratio
CFU/ml × 107
CFU/ml × 105
%
CFU/ml × 106
%
10.1 10.7 1.7 3.1 3.1 8.5 2.7 7.2 6.8 3.3 6.0 3.3 7.7 1.6 3.2 9.1 8.9 6.6 4.4 7.7 5.8
6.0 5.1 0.3 0.6 0.4 0.1 0.02 0.3 1.0 8.0 0.2 0,.2 0.6 0.2 0.7 0.1 1.8 2.1 0.3 0.5 1.4
0.6 0.5 0.2 0.2 0.1 0.01 0.01 0.04 0.2 2.4 0.03 0.06 0.08 0.1 0.2 0.01 0.2 0.3 0.07 0.06 0.3
3.7 12.3 0.6 0.4 0.04 0.3 0.2 0.05 0.5 1.2 0.07 0.05 0.6 0.1 0.3 0.05 0.7 0.4 0.06 0.5 1.1
3.7 11.5 3.5 1.2 0.1 0.3 0.8 0.1 0.7 3.6 0.1 0.2 0.8 0.8 0.8 0.05 0.8 0.6 0.1 0.6 1.5
(range: 1.6 × 107–10.7 × 107). Corynebacterium species other than C. matruchotii and C. durum were not detected from saliva samples in this study. The mean numbers of C. matruchotii and C. durum were 1.4 × 10 5 CFU/ml (range: 0.02 × 10 5–8.0 × 105 ) and 1.1 × 106 CFU/ml (range: 0.04 × 106 –12.3 × 10 6), respectively. C. matruchotii and C. durum accounted for 0.3% and 1.5% of all bacteria, respectively, and were detected in all twenty subjects.
In the primary isolation, the C. matruchotii and C. durum colonies on OCM commonly had a rough, dry, folded, and convex appearance (Fig. 2) and also adhered to the agar medium such that they could not be easily scraped off. The colony colors of C. matruchotii and C. durum on OCM were light purple and cream yellow, respectively. Therefore, OCM could distinguish C. matruchotii from C. durum by each colony color using differences in acid production from galactose, which was added to the medium. The average colony sizes of C. matruchotii and C. durum on OCM were 1.3 mm and 2.9 mm in diameter, respectively. 4. Discussion Corynebacterium species exhibit significant phenotypic diversity in colony appearance, requirements for growth factors, and biochemical activities. They also typically grow well under standard growth conditions; however, the growth of some lipophilic species was previously shown to be enhanced by incorporating 0.1 to 1% Tween 80 into blood agar (Bernard, 2012). The representative Corynebacterium species used in this study grew well and at similar recovery ratios on HI agar media as well as BHI blood agar and BHI blood tween 80 agar (data not shown). The colony sizes of the organisms on both culture media were almost equivalent. Therefore, the HI agar medium was chosen as the base material for the selective medium. The representative Corynebacterium species used in this study were more resistant to fosfomycin (MIC 50 mg/ml) than the other oral bacteria. The growth of oral bacteria other than Corynebacterium species could almost be inhibited by the addition of 100 mg/L fosfomycin to the HI agar medium. This concentration of fosfomycin was also the same as the selective medium, CBU agar, used to isolate Corynebacterium urealyticum, which causes urinary tract infections, previously described by Zapardiel et al. (1998). Amphotericin B was added to the selective media to inhibit oral fungus growth on the selective medium. The addition of galactose and bromocresol into the selective medium could distinguish C. matruchotii from C. durum by each colony color using differences
Fig. 2. Stereomicroscope image of C. durum and C. matruchotii colonies on OCM.
O. Tsuzukibashi et al. / Journal of Microbiological Methods 104 (2014) 67–71
in acid production from galactose. C. durum was previously shown to be capable of producing acid from galactose, whereas C. matruchotii was not (Riegel et al., 1997). The recovery of representative Corynebacterium species reference strains and isolates on OCM relative to BHI blood agar was compared with those on CBU agar. All tested Corynebacterium species grew well on OCM agar (Table 1), however C. matruchotii and C. psedodiphtherificum among 5 tested species did not grow on CBU agar (data not shown). It was indicated that CBU is not useful for the isolation of oral Corynebacterium species. In the present study, we designed species-specific primers to identify C. matruchotii and C. durum using a multiplex PCR method. These primers were able to distinguish C. matruchotii and C. durum, and did not react with representative oral bacteria or other Corynebacterium species. Moreover, our multiplex PCR method could directly use bacterial cells using MightyAmp DNA Polymerase Ver.2 (Takara) and be completed in approximately 2 h. Saliva is an excellent sample that reflected the intraoral condition, and collecting samples is easy and rapid (Magar et al., 2003). Therefore, paraffin-stimulated whole saliva was used as the clinical specimen in the present study. The distributions of Corynebacterium species including C. matruchotii and C. durum in the oral cavity of humans have not yet been reported in detail. In the present study, C. matruchotii and C. durum were detected in all subjects, and accounted for 0.3% and 1.5% of total cultivable bacteria in saliva, respectively. Corynebacterium species other than C. matruchotii and C. durum were not detected on selective medium plates, on which approximately 50 colonies grew. These results indicated that, in addition to C. matruchotii, C. durum was also a part of the normal flora in the human oral cavity. Furthermore, C. durum was more predominant than C. matruchotii. C. durum was initially proposed by Riegel et al. (1997), and was isolated from human respiratory tract specimens, mainly bronchiole-washing specimens. Graevenitz et al. (1998) reported that C. durum accounted for 47% of coryneform bacteria isolated from 113 throat cultures from healthy individuals. Two C. matruchotii reference strains, ATCC 33449 and ATCC 33822, were recently reclassified into C. durum (Sara et al., 2001). Haraszthy et al. (2007) reported that C. durum was detected on
71
the dorsal tongue surface. The distribution of C. durum in various locations in humans will be examined in the future using the developed selective medium. We developed a selective medium, designated OCM, to isolate Corynebacterium species in the oral cavity of humans. Since OCM is highly selective for Corynebacterium species, it will be useful for determining the distribution and role of this organism in the human oral cavity. References Bernard, K., 2012. The Genus Corynebacterium and other medically relevant Coryneformlike bacteria. J. Clin. Microbiol. 50, 3152–3158. Funke, G., Graevenitz, A., Clarridge, J.E., Bernard, K.A., 1997. Clinical microbiology of coryneform bacteria. Clin. Microbiol. Rev. 10, 125–159. Graevenitz, A., Streit, V.A., Riegel, P., Funke, G., 1998. Coryneform bacteria in throat cultures of healthy individuals. J. Clin. Microbiol. 36, 2087–2088. Haraszthy, V.I., Zambon, J.J., Sreenivasan, P.K., Zambon, M.M., Gerber, D., Rego, R., Parker, C., 2007. Identification of oral bacterial species associated with halitosis. J. Am. Dent. Assoc. 138, 1113–1120. Hirasawa, M., Takada, K., 2002. Susceptibility of Streptococcus mutans and Streptococcus sobrinus to cell wall inhibitors and development of a novel selective medium for S. sobrinus. Caries Res. 36, 155–160. Jones, S.J., 1972. A special relationship between spherical and filamentous microorganisms in mature human dental plaque. Arch. Oral Biol. 17, 613–616. Magar, D.L., Ximenez-Fyvie, L.A., Haffajee, A.D., Socransky, S.S., 2003. Distribution of selected bacterial species on intraoral surfaces. J. Clin. Periodontol. 30, 644–654. Riegel, P., Heller, R., Prevost, G., Jehl, F., Monteil, H., 1997. Corynebacterium durum sp. Nov., from human clinical specimens. Int. J. Syst. Bacteriol. 47, 1107–1111. Sara, L., Rassoulian, B., Brad, T.C., Ladonna, C.C., Kathryn, A.B., Marie, B.C., 2001. Diversity within reference strains of Corynebacterium matruchotii includes Corynebacterium durum and a novel organism. J. Clin. Microbiol. 39, 943–948. Takazoe, I., Itoyama, T., 1980. Analytical electron microscopy of Bacterionema matruchotii calcification. J. Dent. Res. 59, 1090–1094. Takazoe, I., Nakamura, T., 1965. The reaction between metachromatic granules and intracellular calcification of Bacterionema matruchotii. Bull. Tokyo Dent. Coll. 6, 29–42. Zapardiel, J., Nieto, E., Soriano, F., 1998. Evaluation of a new selective medium for the isolation of Corynebacterium urealyticum. J. Med. Microbiol. 47, 79–83. Zhou, M., Rong, R., Munro, D., Zhu, C., Gao, X., Zhang, Q., Dong, Q., 2013. Investigation of the effect of type 2 diabetes mellitus on subgingival plaque microbiota by high-throughput 16S rDNA pyrosequencing. Plos One 8, 1–8.