A simple SCID mouse model for HIV research

~)

Pergamon

Transfus. Sci.,Vol. 17, No. 1, pp. 99-108, 1996 Copyright © 1996 Elsevier Science Ltd. All rights reserved Printed in Great Britain 0955-3886(95)00063-1 0955-3886/96 $1S.00 + .00

A Simple SCID Mouse Model for HIV Research A. Ramezani J. Noronha V. W. K. Tsoi

C. Zhang S. Asad S. E. Read B. Ngan S. Joshi* the peritoneal cavity in most mice, and development of lymphoid masses in some, reconstitution of lymphoid structures does not o c c u r . 9 The development of AIDS is associated with HIV-1 infection of CD4 ÷ T lymphocytes and macrophages, followed by a severe depletion of T lymphocytes. HIV-1 in hu-PBL-reconstituted SCID mice appears to spread rapidly and ablates T cells shortly after infection/° Human lymphoid MTa and promonocytic U937 cell lines are highly susceptible to HIV-1 infection in vitro. The rapid proliferation rate of these human lymphoid and myeloid cell lines could compensate for the rapid loss of CD4 + hu-PBLs in SCID mice and thereby maintain an infection long enough for various followup studies. In this paper, the ability of hu-PBLs and human cell lines (MTa and U937) to repopulate transplanted SCID recipients was evaluated. Retrovirally transformed cells were also transplanted. The effect of route of injection (i.v. vs i.p.) and dose of injected cells were also determined. Tissues of interest were examined by flow cytometry, polymerase chain reaction [PCRI, and/or immunohistology.

• The engraftment in SCID mice of human cells susceptible to HIV-1 infection was studied. Repopulation of various tissues by CD4 ÷ human cells in transplanted SCID recipients was monitored via FACS, PCR, and immunohistology. Injection into SCID mice resulted in extensive proliferation of CD4 + cells in the peritoneal cavity, secondary lymphoid organs and other organs. The SCIDCD4* mouse may provide a simple model system for in vivo research purposes such as HIV-1 infection, anti-HIV drug screening, and vaccine development. •

INTRODUCTION A simple, available, and relevant animal model for HIV-1 infection could improve our understanding of the pathology of AIDS and the evaluation of vaccines and drugs. Severe combined immuno-deficiency (SCID)mice capable of harboring HIV-1 infections after reconstitution with human peripheral blood leukocytes (hu-PBLs) or fetal liver/ bone marrow (BM) and thymus have been reported. 1-4Engraftment of hu-PBLs into SCID mice is variable, s,6 In addition, there may be exogenous graft-versus-host resistance, z,s More recent work indicates that although there is colonization of

MATERIALSANDMETHODS Mice

Department of Microbiology, Faculty of Medicine, University of Toronto, 150 College St., Toronto, Ontario, Canada MSS 1A8. *Author for correspondence.

SCID mice obtained from Taconic Farms {German Town, NY, U.S.A.) were 99

100

Transhas. Sci. Vol. 17, No. 1

maintained under pathogen-flee conditions (Animal Facility, Mount Sinai Hospital, Toronto, Canada}.

Cell Culture and Sources Hu-PBLs were received (2 days postcollection) from the Canadian Red Cross Blood Transfusion Service, purified by Ficoll-Hypaque centrifugation, and used immediately. The human CD4 ÷ lymphoid (MT4}, llA2 and myeloid (U937p a cell lines were obtained from the NIH. These cells were cultured in RPMI 1640 medium, containing L-glutamine (2 raM, GIBCO), antibiotics (penicillin, 100 U/mL; streptomycin, 100 I~g/mL; Fungizone, 0.25 ~g/mL; GIBCO}, and fetal calf serum {10%; GIBCO}, at 37°C in a humidified atmosphere with 5% COy MTdMoTN-t~ and U937/MoTN-~ cells were obtained as described previously. 14 Ceils were washed and resuspended in PBS before injections.

Transplantation of hu-PBLs and Cell Lines into SCID Mice Eight to ten week-old SCID mice were used in this study. After 300-400 rad whole body irradiation, the mice were either i.v.- or i.p.-injected with cells as indicated in the tables and figures. Control mice received a PBS injection.

Tissue Collection Transplanted mice were sacrificed and autopsied at the time points indicated in the tables and figures. The tissues of interest (spleen, liver, heart, lungs, BM, and/or blood) were divided into three samples. These were used to prepare viable cell suspensions for FACS analysis, to extract genomic DNA for PCR, or were fixed with 10% formalin in PBS for immunohistological observations. Cells from the peritoneal cavity were washed out with 2 mL sterile PBS and used for FACS analysis or PCR.

FACS Analysis Aliquots {1-5 × l0 s) of cell suspensions obtained from the liver, spleen, blood, and/or the peritoneum were washed twice in PBS, and then incubated for 20 min at 20°C with the appropriate rhodamine (RD} and/or FITC conjugated mAbs (Coulter Electronics), T4-RD1/T11FITC (specific for human CD4 ÷ lymphocytes), MY9-FITC (specific for human CD33 ÷ monocytes), MslgG1-RD1/ MslgG1-FITC (mouse isotypic control), or KC56-RD1/CD45-FITC (specific for human leukocytes). Samples from MT4 cells or hu-PBLs served as controls. Cells were washed twice with PBS, and then analyzed using an Epics Profile Analyzer (Coulter Electronics).

PCR Analysis Cell suspensions of tissues were prepared, lysed, and treated with proteinase K (Boeringher-Mannheim). Genomic DNA was isolated from these samples as described? 5 PCR (100 ~L) was performed in the presence of MgC12 (1.5 mM), oligonucleotide primers specific to the human muscular dystrophy gene (5'AATTCACAGAGCTTGCCATGCTG and 5'-CAGCATGGCAAGATTCTGT GA-ATT; 20 ~M each), l x amplification buffer (Promega), 100 ~M each dNTP, genomic DNA {1 ~g), and Taq polymerase (2.5 U; Promega). The reaction mixture was overlaid with 100 mL of mineral oil. PCR was done as follows: 1 min at 95°C; 1 min at 55°C; 1 min at 72°C; for a total of 35 cycles (DNA Thermal Cycler, Perkin-Elmer Cetus Instruments}. PCR products (20 ~L aliquots) were visualized by electrophoresis on a 3 % agarose gel.

Immunohistological Examination These procedures were performed as described by Ngan et aI.16 Tissue samples from transplanted SCID mice were fixed in buffered formalin, embedded in

SCID Mouse Model for HIV Research

h u m a n PBLs in SCID mice made this system unsuitable for use as a model for developing anti-HIV-1 therapies. An ideal system should allow CD4 ÷ cells to persist long enough for infection by HIV-1. Some of our previous in vitro work conferred HIV-1 resistance upon MT4 cells for up to 40 days. m7-~9 In vivo testing of these agents could require CD4 ÷ cells to persist over the entire course of HIV-1 infection. H u m a n CD4 + lymphocyte-derived MT4 cells were injected into SCID mice in an attempt to generate a longer lasting murine model system for the evaluation of anti-HIV-1 drugs and other therapies in vivo. The presence of CD4 ÷ cells was monitored by FACS, PCR, and immunological examination. Mice injected (i.v. or i.p.} with 0.5 x 107 MT4 cells were 82.4% {i.v.) and 81.4% (i.p.) CD4 ÷ in liver samples and 90.7% {i.v.} and 83.9% {i.p.} CD4 ÷ in peritoneal samples, 42 days after injection {Fig. 1, and Table 2, set A). Similarly, mice injected with five times more cells were 49.9% (i.v.) and 61.0% (i.p.} CD4 ÷ in peritoneal cell samples 21 days post-injection (Table 2, set B}. Amplification of a 230 bp DNA fragment of the h u m a n muscular dystrophy gene confirmed the presence of MT4 cells in genomic D N A extracted from untransplanted M T 4 cells. This h u m a n DNA marker was found in the livers of mice injected with 0.5 x 107 MT4 cells within 12 days and in the liver, lungs, spleen, heart, and peritoneal cavity after 36 days (Fig. 2 and Table 3, set A). However, no such band was observed using genomic DNA isolated from control mice injected with PBS alone. Samples from mice injected

paraffin, and stained with hematoxylin and eosin for histological examination. Sections were made for immunohistological study after deparafflnization and rehydration. Fixed specimens were then preincubated with PBS containing 1% H20~ before staining. Sections were incubated with an anti-CD43 mAb (specific for h u m a n T-lymphocytes; Becton-Dickinson, Mountain View, CA, U.S.A.} for 30 min. Following incubation, unbound Abs were washed off by rinsing with PBS. Sections were sequentially incubated with appropriate dilutions of goat anti-mouse Abs (Tago, Burlingame, CA, U.S.A.), normal swine serum {Cal Tag, San Francisco, CA, U.S.A.}, and horseradish peroxidase-conjugated swine anti-goat antiserum {Cal Tag, San Francisco, CA, U.S.A.). The sections were incubated in copper sulfate to darken the reaction product and then in methanol to fix the precipitate. The peroxidase reaction was developed by incubating sections in 3% H202. These sections were then counterstained with hematoxylin, dehydrated, and examined under the microscope.

RESULTS A N D D I S C U S S I O N

Fifteen days after SCID mice were injected with h u m a n PBLs, low numbers of CD4 + cells (7.45%} were found in the peritoneum {Table 1). No CD4 ÷ cells were found in blood samples. By day 40 post-injection, spleen, peritoneum and blood samples were CD4-, although large numbers of h u m a n (CD45 ÷) cells were found in the peritoneum {99.43%), blood (36.07%), and spleen (11.96%}. The lack of persistence of CD4 + Table 1. Day

15 40

FACSAnalysis Summary for SCID Mice Transplanted with hu-PBLs No. of cells injected

1.0 × 5.0 × 5.0 × 5.0 ×

ND, not determined. T$ 17:l-H

101

10z 107 107 107

Route

Ab

Blood

Peritoneum

Spleen

i.p. i.p. i.p. i.p.

T4 T4 CD45 T4

<0.1% <0.1% 36.07% <0.1%

8.45% 7.45% 99.43% <0.1%

ND ND 11.96% <0.1%

102

Transfus. Sci.

Vol. 17, No. 1

1

1

2

L

L f:: '.:.:..':

F

F "~i~;:~':'.:

•

L Z : : : : 4 , . ~ ~,. . . . . -:.:: ......

::.--

..........

:°..

"i!;ii~!.ii:3 i:'iiiiii ""

•

.........

41

:°..

LFL1

LFL1

A

-

B

I

1,

2

•! 2 : . .

L ~!:~!~!i:!'.'" -:~ ' ¥ ~ ~:~::,: .... • L ~.~.::..: 2

L ¥ L 2

i'i" i!iii~!iiii;3

4

4

!.i~...........

!:!i,:!',2:.i LFL1

LFL1

C

D

Figure 1. Flow cytometry analysis of CD4 + cells from SCID mice transplanted with 0.5 × 107 MT4 cells (set A} using FITC-T4 and RD-T11 mAbs. Two-color profiles of liver cells from PBSinjected control mice (A); peritoneal cells from i.p.-mjected mice (B); liver cells from i.p.injected mice (C}; and liver cells from i.v.-injected mice (D). Table 2.

FACS Analysis S u m m a r y for SCID Mice Transplanted with MT4 Cells

Set

Day

No. of cells injected

Route

Liver

Peritoneum

12

0.5 x 10 7

42

0.5 x 107

6

2.5 × 107 2.5 × 107

<0.1% <0.1% 82.4% 81.4% <0.1% <0.1% <0.1% <0.1%

ND ND 90.7% 83.9% ND ND

21

i.v. i.p. i.v. i.p. i.v. i.p. i.v. i.p.

A

B

ND, not determined.

49.9%

61.0%

SCID Mouse Model for HIV Research

with five times more MT 4 cells had h u m a n D N A in all tissues tested, 21 days after injection (Table 3, set B). Immunohistological examination of mice 30 days after i.v. or i.p. cell transfer

M 12345

demonstrated that h u m a n CD4 ÷ cells were present in the spleen, liver, lungs, heart, and BM (Fig. 3). However, the peritoneal cavity of SCID mice appears to be the preferred site for proliferation of these cells. Hematoxylin counter-staining of CD43-immunoperoxidase stained liver sections revealed proliferative clusters of MT4 cells within the hepatic sinusoids of both i.p.- and i.v.-injected mice (Fig. 3A). Liver sections from i.p.-injected mice also showed large clusters of MT 4 cells in the regions of the central veins (Fig. 3E). Similarly, both i.v.- and i.p.injected mice showed positively stained focal aggregates of MT 4 cells in the interstinum of BM tissue (Fig. 3D and H). Hematopoietic activity was still present in the uninvolved portions of the marrow (Fig. 3D and H). Small venules and capillaries of the pulmonary interstinum of lungs from i.v.- and i.p.-injected mice had occasional clusters of positively immunoperoxidase-stained cells (Fig. 3C and G). Clusters of CD43 + cells were also found in pulmonary lymphatics of i.p.-injected mice (Fig. 3G). Hematoxylin and eosin stained sections of periarteriolar areas of spleens from i.v.-injected mice showed massive infiltration by MT4 cells (Fig. 3B). Similar sections from i.p.-injected SCID mice showed proliferation of MT 4 cells in splenic sinusoids and clusters of megakaryocytes in close proximity with the MT 4 cells (Fig. 3F). Retrovirally transformed MT4 cells expressing an anti-sense R N A specific to the HIV-1 packaging (0) signal are

6789

1 8 , ~ Ill

608,810234-

-280

118-

72-

Figure 2.

Identification by PCR analysis of human DNA in various organs from transplanted SCID mice. Lanes 1-8, heart, liver, lungs, and spleen DNA from mice injected with 0.5 x 107 MT4 cells (set A), i.v. (odd lanes) and i.p. (even lanes); M, HaeIII digested ~bx174 RF DNA; lane 9, genomic DNA from in vitro cultured M T 4 cells. Table 3. Set

A

103

PCR Analysis Summary for Tissues from SCID Mice Transplanted with MT4 Cells

Day

No. of cells injected

12

0.5 x 107

36 42 6

0.5 x 10z 0.5 x 107 2.5 x 107

Route

Liver

Lungs

Spleen

Heart

Peritoneum

i.v. 1.p.

+ +

-

-

-

l'~w ND

1.V.

+

+

+

+

+

1.p.

+

+

+

+

+

1.V.

+

+

+

+

+

1.p.

+

+

+

+

q-

1.V.

1.V.

. . +

1.p.

+

1.p. 21 ND, not determined.

2.5 x 10z

. .

. .

. .

+

+

+

ND ND ND

+

+

+

+

104 Transfus. Sci. Vol. 17, No. 1

Figure 3. MT 4 cell distribution in the various organs of SCID mice 30 days post i.v. (A-D) or i.p. (E-H) injections. Liver (A) (60x), spleen (B} (60x), lung (C) (60x), and BM (D) (120x) from i.v.-injected mice; liver (E} (60x), spleen (F) (60x), lung (G) (60x), and BM (H) (120x) from i.p.-injected mice. resistant to HIV-I infection i n vXt-Fo° 14 FACS analysis after transplantation of these MT4/MoTN-O cells into SCID mice indicated that proliferation of these cells was not impaired by retroviral transformation (Table 4). This transplantation procedure was extended to

another cell line susceptible to HIV-1 infection, U937/MoTN-t~. This promonocytic cell line is CD4 ÷, CD33" and produces the anti-HIV-1 antisense RNA. SCID mouse liver tissue had 76.60% CD33 ÷ h u m a n cells, 42 days after injection with U937/MoTN-d~ [Table 4}.

SCID Mouse Model for HIV Research 105

Figure 3.

continued (C-D).

Table 4. FACS Analysis Summary for SCID Mice Transplanted With Retrovirally Transformed Cell Lines Day 42 42

Cell line

No. of cells injected

Route

Ab

Liver

Lung

Spleen

MT4/MoTN- ~ U937/MoTN-~

1.0 x 107 1.0 x 107

i.p. i.p.

T4 MY9

54.99% 76.60%

39.47% 34.68%

38.44% 5.50%

I06

Transfus. Sci. Vol. 17, No. 1

Figure 3. continued (E-F). Overall, the results presented here indicate that the transfer of h u m a n CD4* lymphoid and myeloid cells lines to SCID mice results in a rapid and high degree of CD4* cell engraftment in various organs of the recipient regardless of the route of injection. Furthermore, very small numbers of MT4 cells, as low as 0.5 x 10 7 cells, are sufficient for successful transplantation of SCID mice. On the

other hand, the CD4 + cells in hu-PBLreconstituted SCID mice tend to decline rapidly and remain at very low or undetectable levels. This relatively simple small animal system is potentially useful for studies of the acute pathogenic effects of HIV-! in vivo, for evaluation of candidate vaccines, and for testing therapeutic agents designed against HIV-1. Additional

SCID Mouse Model for HIV Research

Figure 3.

107

continued (G-H).

studies are in progress to determine the susceptibility of such SCID-MT 4 and SCID-U937 mice to HIV-1 infection. MT4 cells transformed with various anti-HIV-1 genes and found to confer resistance to HIV-1 in vitro will be tested for their ability to confer protection against HIV-1 infection in SCIDMT4 mice alone and in combination with anti-HIV-1 drugs. 14,17-19

Acknowledgements We thank G. Knowles at the Hospital for Sick Children for FACS analysis, and R. Kitching for critical proof-reading of the manuscript. Animal work was performed at the Mount Sinai Hospital animal facility. Hu-PBLs were received [rom the Canadian Red Cross Blood Transfusion Service. The human CD4 ÷lymphocyte-derived MT 4 cell line was obtained from D. Richman, and the promonocytic U937 cell line was obtained from P. Ralph, M.A.S. Moore, and K. Nilsson through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. This work was supported by grants from the National Health Research and Development Program (NHRDP) and the Medical Research Council of Canada. A. Ramezani is grateful to NHRDP for a National Health M.Sc. Fellowship (AIDS}.

108

Transfus. Sci. Vol. 17, No. 1 REFERENCES

1. McCune JM, Namikawa R, Kaneshms H: The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function. Science 1988; 241:1632-1639. 2. Mosier DE, Gulizia RJ, Baird SM, Spector S, Spector D, Kipps T], Fox RI, Carson DA, Cooper N, Richman DD: Studies of HIV infection and the development of Epstein-Barr virus-related B cell lymphomas following transfer of human lymphocytes to mice with severe combined immunodeficiency. Curt Top Micro Immun 1989; 152:155-159. 3. Peault B, Weissman IL, Baum C, McCune JM, Tsukamoto A: Lymphoid reconstitution of the human fetal thymus in SCID mice with CD4 ÷ precursor cells. I Exp Med 1991; 174:1283-1286. 4. Krowka JF, Satin S, Namikawa R, McCune JM: Human T-cells in SCIDhu mice are phenotypically normal and functionally competent. J Immunol 1991; 146:3751-3756. 5. Pfeffer K, Heeg K, Bubeck R, Conradt P, Wagner H: Adaptive transfer of human PBLs in SCID mice. Curt Top Microbiol Immunol 1989; 152:211-217. 6. Jicha DD, Yannelli JR, Custer M, Colandrea J, Taubenberger J, Mule JJ, Rosemberg SA: The persistence of human PBL tumor infiltrating lymphocytes, and colon adenocarcinomas in immunodeficient mice. J Immunother 1992; 11:19-29. 7. Murphy WJ, Bennett M, Anver MR, Baseler M, Longo DL: Human-mouse lymphoid chimeras: host-vs-graft and graft-vs-host reaction. Eur J Immunol 1992; 22:1421-1427. 8. Huppes W, De Geus B, Zurcher C, Van Bekkum DW: Acute human vs mouse graft vs host disease in normal immunodeficient mice. Eur J Immunol 1992; 22:197-206. 9. Martino G, Anastasi J, Feng J, Shan CM, DeGroot L, Quintans J, Grimaldi LME: The fate of human PBLs after transplantation into SCID mice. Eur J Immunol

1993; 23:1023-1028. 10. Letvin NL: Animal models for AIDS (Review). Immunol Today 1990; 11: 322-326. 11. Pauwels R, de Clerq E, Desmyter J, Balzrini J, Goubau P, Herdewijn P, Banderhaeghe H, Vandeputte M: Sensitive and rapid assay on MT 4 cells for detection of antiviral compounds against the AIDS virus. J Virol Meth 1987; 16:171-185. 12. Larder BA, Darby G, Richmond DD: HIV with reduced sensitivity to AZT isolated during prolonged therapy. Science 1989; 243:1731-1734. 13. Ralph P, Moore MAS, Nilsson K: Lysozyme synthesis by established human and murine histiocytic lymphoma cell lines. J Exp Med 1976; 143:1528-1533. 14. Cohli H, Fan B, Joshi RL, Ramezani A, Li X, Joshi S: Inhibition of HIV-1 multiplication in a human CD4 ÷ lymphocytic cell line expressing antisense and sense RNA molecules containing HIV-1 packaging signal and Rev response element. Antisense Res Dev 1994; 4:19-26. 15. Sambrook J, Fretsch EF, Maniatis T: Molecular Cloning: a Laboratory Manual, 2nd edn. New York, Cold Spring Harbor Laboratory Press, 1989. 16. Ngan BY, Picker LJ, Medeiros J, Wamke RA: Immunophenotypic diagnosis of nonHodgkin's lyrnphoma in paraffin sections. A m [ Clin Pathol 1989~ 91:579-583. 17. Joshi S, Brunschot AV, Asad S, Van Der Elst I, Read SE, Bemstein A: Inhibition of HIV-1 multiplication by antisense and sense RNA expression. J Virol 1991; 65:5524-5530. 18. Weerasinghe M, Liem SE, Asad S, Read SE, Joshi S: Resistance to HIV-1 infection in human CD4 ÷ lymphocytederived cell lines conferred by using retroviral vectors expressing an HIV-1 RNA-specific ribozyme. J Virol 1991; 65:5531-5534. 19. Liem SE, Ramezani A, Li X, Joshi S: The development and testing of retroviral vectors expressing trans-dominant mutants of HIV-1 proteins to confer anti-HIV-1 resistance. Hum Gene Ther 1993; 4:625-634.