- Email: [email protected]
A simplified and efficient vector-primer cDNA cloning system
79
Gene, 31 (1984) 79-89 Elsevier GENE
1095
A simplified and efficient vector-primer cDNA cloning system (Recombinant DNA; messenger RNA; reverse transcription; ribulose-1,5-bisphosphate subunit; Lycopersicon esculentum; tomato; polylinkers; globin; plasmid; 1 phage)
carboxylase small
Danny C. Alexander*, Thomas D. McKnight and Bill G. Williams ARC0
Plant Cell Research Institute, 6560 Trinity Ct, Dublin, CA 94568-2685 (U.S.A.)
(Received
June 15th, 1984)
(Accepted
June 20th, 1984)
Tel. (415) 833-3400
SUMMARY
A simplified, efficient, and versatile vector-primer cDNA cloning system is presented. The dimer-primer system is a modification of the method of Okayama and Berg (1982) with the following features: (i) the vector-primer molecules are more rapidly and reliably prepared by virtue of the elimination of an endonuclease digestion and the agarose gel purification step from the original method, and (ii) the final cDNA products contain polylinkers at both cDNA-vector junctions, simplifying the size analysis, subcloning, and sequencing of inserts. The system is highly efficient, yielding > lo5 transformants using 1 pg mRNA and 1 pmol of vector-primer ends, with 75 y0 or more of the transformants having inserts. The ability of the system to produce clones of full-length or near full-length is demonstrated by the analysis of 32 ribulose-1,Sbisphosphate carboxylase small subunit cDNA clones from tomato.
INTRODUCTION
The importance of complementary DNA (cDNA) copies of eukaryotic mRNAs in the study of gene structure and function is well established. Obtaining a cDNA clone for a particular mRNA is often very difficult and time consuming, but once isolated it * To whom all correspondence
and reprint
requests
should be
addressed. Abbreviations: dylate;
EtBr,
ria-Bertani
bp, base pairs; ethidium medium;
MeHgOH,
RuBPC,
ribulose-1,5-bisphosphate
dodecyl
sulfate;
EDTA;
dC, deoxycytidylate;
bromide;
TAE,
40mM
kb, kilobase methyl
dT, thymi-
pairs;
mercuric
carboxylase; Tris’acetate,
LB, Luhydroxide;
SDS, pH
sodium
7.5, 2 mM
TBE, 89 mM Tris, 89 mM boric acid, 2 mM EDTA.
0378-l 119/84/$03.00
0
1984 Elsevier
Science
Publishers
becomes a powerful tool for unlocking a large amount of information about the organization and expression of the parent gene. Traditional methods for obtaining cDNA clones have proven adequate for systems in which the mRNA of interest is relatively abundant or can be considerably enriched (Efstratiadis and Villa-Komaroff, 1979; Davies, 1982). However, the efficiency of obtaining clones with these methods is quite low, and the yield of cDNAs that represent a full-length, or nearly full-length, copy of the mRNA is also low. Recent improvements in cDNA cloning techniques have allowed an increased overall efficiency and, in some cases, a better yield of more complete reverse transcripts (Land et al., 198 1; Okayama and Berg, 1982; Gubler and Hoffman, 1983). As a result many
80
more systems should become accessible to the molecular analysis for which a cDNA clone is the key. These systems include those in which (i) the target mRNA comprises a very small fraction of the total messengers, (iq a relatively large number of mRNAs in a population are of interest, or (iii) the starting mRNA is very difficult to obtain in substantial amounts. Our laboratory is interested in obtaining cDNA clones of all the mRNAs of tomato that are induced during acquisition of thermal tolerance - a group of messengers comprising about 20 size classes of various abundances. In our search for the best method for cloning we were p~icul~ly attracted to the innovative vector-primer cDNA cloning system described by Okayama and Berg (1982). Its reported high efficiency, rapidity, and high yield of full-length copies seemed ideal. After encountering difliculties in prep~ng functions vector-p~mer we made modifications in the vector that simplified the preparation and eliminated steps that we suspected to be problematic. To make the system more versatile for cDNA insert analysis and sub-cloning we have designed the modified system in such a way that the cDNA clones have polylinkers at the cDNA-vector junctions, with several sites common to both ends as well as unique sites at the 5’ end. In this report we describe our modifications of the vector plasmid and the simplified preparation of the v~tor-primer system. The performance of the system is demonstrated with two mRNA preparations; rabbit reticulocyte mRNA, for comparison to the original method, and tomato leaf mRNA, to document its utility in our system. The system performs well with both the reticulocyte mRNA and the more complex mRNA from a plant, providing evidence of its general usefulness as a simple, versatile, and efficient cDNA cloning system.
Fred Blattner, University of Wisconsin. Oligo(dA)cellulose and oligo(dT)-cellulose were obtained from Collaborative Research, Inc. ; 32P-labeled nucleotides from Amersham; AMV reverse transcriptase from Life Sciences, Inc.; placental ribonuclease inhibitor (RNasin) from Promega Biotech Co.; methylmercuric hydroxide from Alfa Chemicals as a 1-M solution; terminal deoxynucleotidyl transferase from PL Biochemicals; endonuclease @I, Escherichia coli DNA iigase, and E. coli DNA polymerase I from New England Biolabs; T4 DNA ligase, T4 DNA polymerase, pBR322, synthetic BamHI linkers, rabbit reticulocyte mRNA, RNase H, endonucleases BumHI, SmaI, EcoRI, Suf I, PSI, and &?I were from Bethesda Research Laboratories. (b) Plasmid constructions Fo~uitously, the pSV 0.7 l-O.86 plasmid which we prepared from a randomly chosen single-colony isolate of E. coli K-12, strain HBlOl, was a 6.2-kb head-to-tail dimer. Using this plasmid, Xharon 34, and pBR322, we derived our linker plasmid pARC5, and the dimer-primer vector pARC7 (Fig. 1). Briefly, the Ssti-BamHI portion of the Xharon 34 polylinker was sub-cloned as an inverted repeat into the BumHI site of pBR322 to yield pARC5. pARC6 was generated by ligation of a synthetic BumHI linker into a flush-ended site made by partial digestion of the pSV 0.71-0.86 dimer by &@I followed by T4 polymerase treatment. This plasmid is the same as the pSV 0.71-0.86 dinner except that one of the KpnI sites has been replaced by a BamHI site. Next the portion of the pARC5 polylinker released by HindIII digestion was made hush-ended by T4 polymerase and was ligated into the flush-ended site created by complete digestion of pARC6 with KpnI and treatment with T4 polymerase. This plasmid was designated pARC7. (c) Vector-primer preparation
MATERIALS
AND METHODS
(a) Enzymes, plasmids, and reagents Plasmid pSV 0.71-0.86 was obtained from the laboratory of Dr. P. Berg, Stanford University (Okayama and Berg, 1982). Phage lCharon 34 (Loenen and Blattner, 1983) was provided by Dr.
pARC7 (250 pg) was digested with 500 units of XstI in a 1 ml reaction mixture for 2 h at 37’ C. Following purification of the DNA by phenol : CHCl, (1: 1) and two ethanol precipitations, homopol~er tails of dT residues were added to the 3’ singlestranded ends generated by SstI digestion. The 0.2 ml reaction contained 0.14 M sodium cacodyl-
81
ate-30 mM Tris. HCI, pH 6.8, 1 mM CoCl,, 0.25 mM TTP, 50 PCi [c+~‘P]TTP, 206 I-18(loopmol ends) of SstI-digested pARC7, and 240 units of terminal deoxynucleotidyl transferase. After 5.0 min at 37°C the reaction was stopped and the DNA recovered by phenol : CHCl, extraction and ethanol precipitation. The tailed vector-primer was then purified by two cycles of aflinity chromatography using oligo(dA)-cellulose (Okayama and Berg, 1982). To determine the homopolymeric tail length and distribution, a small portion of the vector primer which had been tailed with [ G(-~‘P]TTP, and a portion of &I-digested vector that had been endlabeled with [ a-32P]dideoxyATP before tailing, were digested with PstI (note the PstI sites in the polylinker, Fig. 1A). The products were then subjected to electrophoresis on an 8% polyacrylamide-urea gel (Sanger and Coulson, 1978) followed by autoradiography. The average dT-tail length for the preparation used in these studies was 45, but we see no differences using preparations containing 60-65 residues. (d) Linker preparation
pARC5 (200 pg) was digested with SstI as described above for pARC7. Following purification of the DNA, homopolymer tails averaging 13-15 dC residues were added to the 3’ single-stranded ends created by SstI digestion. The 100 ~1 reaction contained 0.14 M sodium cacodylate-30 mM Tris . HCl, pH 6.8, 1 mM CoCl,, 1 mM dCTP, 147 pg (lOO-pmol ends) SstI-digested pARC5 DNA, and 120 units terminal deoxynucleotidyl transferase. After 5.0 min at 37’ C the reaction was stopped and the DNA was purified. The homopolymer tail length was determined by end-labeling a portion of the plasmid, before and after tailing, with [r-32P]dideoxyATP followed by PstI digestion and electrophoresis as described above. The remaining dCtailed plasmid preparation was then digested with BamHI and the products subjected to electrophoresis in a 12% polyacrylamide gel containing TBE. The band appearing as a smear just above the 50-bp range was excised and recovered by electroelution. Note that pARC5 yields 2 mol of linker per mol of plasmid. Because of the difficulty in determining the amount of DNA recovered at this point, the optimum ratio of linker to cDNA-vector for the cycli-
zation reaction was determined below).
empirically (see
(e) mRNA preparation
Rabbit-reticulocyte mRNA was used as supplied for cloning or for synthesis of radioactive cDNA probe. Tomato-leaf mRNA was prepared from expanding leaves of greenhouse-grown Lycopersicon esculenturn, variety VFNT Cherry, plants. Plants were approx. 15-20 cm tall with 3-4 sets of leaves when the leaves were harvested into liquid nitrogen. Total RNA was prepared from 30 g of leaves by the SDSproteinase K method of Hall et al. (1978), with the following modifications. After the 2 M LiCl wash the pellet was redissolved in 10 ml of 10 mM HEPES, pH 7.4, followed by the addition of 0.2 ml of 2 M K. acetate, pH 5.5, and then 5 ml of cold ethanol. After 15 min on ice the mixture was centrifuged at 27 000 x g for 15 min at 4’ C. The supernatant was removed to a new tube and 0.3 ml of 2 M K . acetate, pH 5.5, was added, followed by 20 ml cold ethanol. The additional low-salt, low-ethanol step removed a sizable polysaccharide pellet while greater than 95% of the RNA remained in the supematant. Polyadenylated mRNA was selected by two rounds of affinity chromatography on oligo(dT)-cellulose as described by Maniatis et al. (1982) using LiCl in the loading buffer.
(f) cDNA cloning
The procedures used for cloning (Fig. 2) were essentially the same as those described by Okayama and Berg (1982) with the modifications described below. (i) For first-strand synthesis the mRNA (2 pg rabbit-reticulocyte mRNA or 1 pg tomato-leaf mRNA) was denatured by incubation in 10 mM MeHgOH in a volume of 11~1. After 10 min at room temperature 2 ~1 of 0.7 M 2-mercaptoethanol was added, followed by 2 ~1 (70 units) of placental ribonuclease inhibitor. dT-tailed vector-primer (2 pg) was added and the mix was adjusted to 0.1 M Tris * HCl, pH 8.3,135 mM KCl, 10 mM MgCl,, 4 mM sodium pyrophosphate, 2.5 mM of each deoxynucleotide triphosphate, and 2 units/p1 of AMV reverse transcrip-
82
broth (Miller, 1972) at 30” C and then chilled in ice water for 2 h. The cells (40 ml) were centrifuged and then suspended in 20 ml of ice-cold 100 mM CaCl,, 70 mM MnCl,, 40 mM Na. acetate, pH 5.5, and incubated on ice 40-45 min. They were centrifuged again and very gently resuspended in 2 ml of the same solution containing 15% (v/v) glycerol. Aliquots were frozen in liquid nitrogen and stored at - 70°C. Cells prepared in this manner yield 5 x lo7 to 1 x lo8 transformants per pg of supercoiled pBR322. A loo-p1 aliquot of the diluted cDNA ligation mixture was incubated for 30 min on ice with 200 1.11 of competent cells followed by a 5-min incubation at 37°C. Four ml of 2XL broth was added and the cells were grown at 37’ C for 70-90 min. The outgrowth was centrifuged (5000 x g, 5 min), resuspended in 50- 100 @2XL-broth, and spread on LBplates (Miller, 1972) containing 50 pg/ml ampicillin. Amounts for plating were chosen to yield approx. 500 colonies per 150~mm plate.
tase in a total volume of 30 ~1.The mix was incubated at 42°C for 90 min. (ii) Homopolymer tailing of the cDNA products was done with 1 mM dGTP and 10 units of terminal deoxynucleotidyl transferase in a 20-~1 volume for 30 min at 37’ C. (iii) The dG-tailed cDNA-vector products were digested with 20-25 units of BamHI in a volume of 25 ~1. (iv) The amount of dC-tailed linker needed for optimum cloning efficiency was determined by ligating serial dilutions of the linker with a fixed amount of cDNA-vector. The ligation and repair reactions were otherwise as described. Note that an extra piece of DNA, generated in the original method by Hind111 digestion, is not present after the BumHI digestion in our system. (v) Frozen competent MM294 cells were prepared by a modification (Dan Denney, personal communication) of the method of Hanahan (1983). Briefly, cells were grown to AGo0= 0.5 in 2X Luria (2XL)
Eco RI
11
SSt+
:?tRIZZ
Sma Xba Sal Pst
Sal
Xba Sma Sst
Sma Xba Sal
dC-tailing site
Hind Barn
c,b:I
Pst
Xba Sma
Pst
1 dT-tailing
Fig. 1. Plasmids 0.71-0.86
by insertion
for the addition
of a synthetic
of homopolymer
pARC5 was created
by inserting
SstI site is used for the addition is isolated plasmid.
site
used for vector-primer
and linker preparation.
BamHI
tails of thymidylate a portion
residues,
of the Eharon
of homopolymer
and used to effect closure
(A) The vector
plasmid
pARC7
linker at one of the KpnI sites and a polylinker thus creating
34 polylinker products
from a dimer of pSV
two primer ends on each molecule. (B) The linker plasmid
as an inverted repeat into the BumHI site of pBR322. The unique
tails of deoxycytidylate
of cDNA-vector
was derived
at the other. The unique SstI site is used
residues.
Following
digestion
with BamHI
this linker piece
(see Fig. 2). Note that pARC5 yields two moles of linker per mole of
83
(g) Screening
RESULTS
Transformants were screened for the presence of cDNA inserts by the in situ colony hybridization method of Taub and Thompson (1982) using either primary plates directly or by picking colonies into 96-well liquid-culture plates for subsequent plating with a 96-prong replicating device (Immusine Laboratories, Berkeley, CA).
(a) Vector-primer and linker Restriction maps of the vector plasmid (pARC7) and the linker plasmid (pARC5) are shown in Fig. 1. The linker plasmid pARC5 (Fig. 1B) was made simply by inserting the BarnHI-St1 portion of the Kharon 34 polylinker as a palindrome into the BamHI site of pBR322. Note that pARC7 (Fig. 1A) is a dimer of pSV 0.71-0.86 (Okayama and Berg, Barn
Barn
Barn
!
Al Al AT
AT AT
AT
AT
AT
AT
AT
AT
AT
AT
AT . _ A I
AT AT AT
T T
T Vector-
T
Primer
T T
jmRNA
:mRNA G
G
G
G G
G
G G
G
G
G G
J 5) Anneal
1
linker
Bammccccc Linker (5’ Polylinker)
,,~)n##~zc,:i%f 5’ Polyhnker
3’ Polyllnker
(DNA
Fig. 2. cDNA cloning with the dimer-primer transcription
yields cDNA
first strands
results in two independent
cDNA-vector
complementary
ends at the opposite
complementary
ends at the other,
repaired
by the actions
replaces
the RNA strand
transformed
of RNase
‘CC..
molecules
are annealed
dG-tails
are annealed
. . +,A
da-tailing,
at the ends representing
to the cDNA-vectors, strands
to the dT-tails of the vector-primer.
to the vector molecule.
The linker pieces, which contain
H, which nicks the mRNA
E. coli cells and transformants
. . . .
3’ Polyhker
causing
are selected
followed by BamHI
the 5’ portion of the mRNAs dC-tails
circularization
in the mRNA-cDNA
with DNA, and E. coli DNA ligase, which covalently
into competent
.
TTTti
mRNAs
attached
containing
ends of the vectors.
. .
Polyllnker
system. Polyadenylated
that are covalently
.
Ba;FGG‘
closes the remaining
on LB plates containing
and BamHI
at one of their ends and BumHI
of the complexes. hybrid,
Reverse digestion,
The molecules
E. coli DNA polymerase nicks. The repaired
ampicillin.
are
I, which
plasmids
are
84
those described by Okayama and Berg (1982). Our conditions for the first-strand synthesis differ in that they include a higher potassium concentration (Retzel et al., 1980), and the use of pyrophosphate (Murray et al., 1983). We have not done extensive optimization for first-strand synthesis since our main interest here is to describe the modified vector system as a general tool. The conditions for first-strand synthesis should be optimized according to a particular application. dG-tailing of the first strands was chosen so that the linker piece could receive dC-tails and thus regenerate a unique SstI site at the 5’ end of each cDNA insert. The BumHI digestion generates two independent cDNA clones bearing opposite orientations with respect to the remainder of the vector molecule (but not to the polylinkers). Both orientations clone with equal efficiency, as determined by restriction analysis of 48 individual clones (not shown). The tendency of BumHI to digest RNA-DNA hybrids was not investigated. However, cDNA clones lacking the 5’ polylinker piece, which might result from cleavage at a hybrid BumHI site, have not been observed. Table I shows the number of transformants that were obtained using the two mRNA preparations. The total number of transformants in the libraries were similar for the rabbit-reticulocyte mRNA and the tomato-leaf mRNA using our standard reaction, which contains I-pmol vector ends (2 pg plasmid). Note that 3-10 pmol of mRNA was used per pmol vector ends. Although we did not test this system with decreasing amounts of mRNA, Okayama and Berg (1982) obtained good results using only about 1.4 pmol(0.29 pg) of globin mRNA per pmol of vector ends. An important criterion to consider in
1982) except that one KpnI site has been replaced by a BarnHI linker and the other by a portion of the palindromic polylinker from pARC5. The portion of the vector plasmid from the Hind111 sites clockwise to the PvuII sites (sites underlined), with the exception of the synthetic linker pieces, are the portions in the original plasmid that were derived from SV40. The remainder of the sequence is from pBR322. This plasmid replicates well in the E. coli Ret A- host HBlOl. To prepare the dimer-primer molecule, pARC7 is digested with St1 and the resulting ends are dTtailed. The products are purified using oligo(dA)-cellulose chromatography (two passes). This eliminates two steps from the original Okayama and Berg procedure: (i) the HpaI digestion, and (ii) agarose-gel purification. The products are obtained in higher yield, in considerably less time, and free of the impurities inherent in isolations of nucleic acids from agarose gels. The two halves of the starting polylinker become the 3’ polylinkers for two different cDNAs that will be synthesized on the dimer-primer molecule (Fig. 2). The linker plasmid, pARC5, is likewise digested with St1 but is then dC-tailed and subsequently digested with BamHI. The small, dCtailed linker piece is isolated from a polyacrylamide gel. This piece forms the 5’ polylinker on all cDNAs. Note that the St1 site is regenerated by C-tailing (5’ end), but not by dT-tailing (3’ end), and that the 5’ polylinker contains a Hind111 site and a BumHI site that are absent in the shorter 3’ polylinker. (b) cDNA cloning
The procedures for generating cDNA clones using this vector system (Fig. 2) are essentially the same as TABLE
I
Efficiencies Standard
of cloning cDNA cloning reactions
were performed
using 1 pmol vector-primer
The host was E. coli K-12 strain MM294. Transformants mations
yielded 0.5-l
x lo8 transformants
per pg of supercoiled Transformants pmol vector
(1) Globin
mRNA
were selected
per ends
ends (2 pg plasmid)
on LB plates containing
pBR322. Transformants pg mRNA
(2 pg)
(a) Complete
192000
96000
(b) No linker
32 000
16000
(c) No ligase
14000
1000
184000
184 000
(2) Tomato-leaf
mRNA
(1 pg)
per
and the indicated 50 pgg/ml ampicillin.
amounts Control
of mRNA. transfor-
85
cDNA cloning is the number of transformants that have inserts. In vector-primer systems a large number of transformants are obtained even in the absence of mRNA; therefore care should be taken when comparing cloning efficiencies expressed as the number of transformants per pg mRNA. mRNA preparations vary considerably in average size and complexity, with most being larger and more complex than rabbit reticulocyte mRNA. Since the successful use of the vector-primer type of system requires an excess of mRNA over vector-primer, the optimum situation becomes one in which the amount of mRNA used is the minimum that still allows for a high percentage of cDNA inserts. This percentage can be determined by direct detection of inserts in a population of clones. Fig. 3 shows 360 randomly picked colonies from each of the two libraries. When probed with [32P]cDNA made from the same
mRNA preparation used for cloning we detect 78 y0 and 75% inserts in the rabbit reticulocyte and tomato leaf cDNA libraries, respectively. This is in good agreement with the 80 % inserts reported in the original method. It is probable that this represents a minimum number, since cDNAs of very rare mRNAs would not be detectable. Note in Table I that in the absence of linker there is an apparent background of about 16%. If ligase is omitted the background is still about 7-8 % . Some of these probably represent molecules that escaped tailing or restriction enzyme digestion and thus transform at a greater efficiency than the bulk of the molecules. It is also possible that some represent improper closures of molecules that would be driven into proper constructs in the presence of linker. In any case this background is higher than that observed by Okayama and Berg (1982). It is possible that their lower background is due to the removal of such “escaped” molecules in the agarose gel purification step. However, their reported percentage of transformants with inserts is quite similar to ours and, as a result, we do not consider this a problem. (c) mRNA-cDNA comparisons
Tomato
leaf cDNAs
%a*
Fig. 3. Detection Randomly
clones
&1&r
*
by colony
hybridization.
from each of two cDNA librar(see MATE-
section g) using [3ZP]cDNA
from the same mRNA
cloning.
* * *
by in situ colony hybridization
AND METHODS,
synthesized cDNA
of cDNA
chosen transformants
ies were screened RIALS
s b&,
preparations
probes
used for the
A rigorous test of a cDNA cloning system is a comparison of the cDNA inserts to the mRNA template from which it was made. Fig. 4A is an analysis of the mRNA templates used in this study. Rabbit-reticulocyte mRNA and tomato-leaf mRNA were separated on an agarose-MeHgOH gel and transferred to nitrocellulose. The bound RNAs were then hybridized with three different probes. Lanes 1 and 2 were probed with [32P]oligo(dT) to show the distribution of poly(A)-containing molecules. The reticulocyte message consists almost entirely of globin-size sequences, whereas the 1eafmRNA appears as a smear centered around approx. 1000 bases. This method displays what approximates a number average of the mRNA molecules, rather than a mass average as obtained by EtBr staining. It also eliminates interference from ribosomal RNA contaminants. To judge the integrity of specific mRNAs in the populations, the fnters were probed with 32Plabeled rabbit-reticulocyte cDNAs (lanes 3 and 4) or with a nick-translated EcoRI fragment from a soybean RuBPC small subunit gene (lanes 5 and 6). The band hybridizing to the small subunit probe is in the
86
A
12
345
13531078872,
310, 2812341 194”
Fig. 4. Comparison
of cDNAs
to mRNA templates.
MeHgOH
gel (Bailey and Davidson,
of tomato
leaf mRNA.
Lanes 1 and 2 were probed
[32P]cDNA.
Lanes 5 and 6 were probed
(Berry-Lowe
et al., 1982). (B) cDNA
of the vector-primer Following
separated
were released
the nucleic acids were transferred
of cDNA polylinker.
of rabbit-reticulocyte
plasmid
libraries
mRNA
(see RESULTS,
Lanes 1 and 2 are rabbit-reticulocyte
with Hue111 (right margin:
oligo(dT).
mRNA.
by PsrI digestion, and detected
small subunit
section c). Inserts
respectively.
were released
and tomato-leaf
from soybean in the dT-tail
directly by autoradiography.
by SmaI digestion,
cDNAs,
subclone
was located
which cuts near the dT-tail-vector
(C) EtBr-stained respectively.
resulting agarose
2 kg
with rabbit-reticulocyte
genomic
gel. The “‘P-label
is added. Lanes 2 and 3 are the first strands mRNA,
on 1.5% agarose
Lanes 2,4, and 6 contain
Lanes 3 and 4 were probed
pSRS 0.8, an RuBPC
to nitrocellulose
and tomato-leaf cDNAs
used for cDNA cloning, separated
1 pg of rabbit reticulocyte
on 1.5% agarose-MeHgOH
from the vector
the dT-tails alone, which result when no mRNA template using templates
blots of mRNAs
with ‘*P-end-labeled
with “‘P-nick-translated
first strands
and the products
electrophoresis
(A) Northern
1976). Lanes I, 3, and 5 contain
junctions.
Lane 1 contains
from reverse transcription gel (1.5 y0 agarose,
sites for which are located
Lane 3 contains
TAE) in each
$X174 DNA digested
sizes in bp).
range of 830-950 bases, a size similar to those for small subunit mRNAs from several species (Stiekema et al., 1983; Broglie et al., 1983; Smith and Ellis, 1983; Berry-Lowe et al., 1982). This is also a sufficient size to code for the small subunit protein precursor from tomato (our unpublished results). Neither of these preparations show any evidence of RNA degradation. Fig. 4B is an autoradiogram of the cDNA first
strands for the two libraries. The dT-tails alone (lane l), or the first strands (lanes 2 and 3) were released from the vector by PstI digestion (&I cuts in the 3’ polylinker), and the strands were electrophoresed on the same gel as the mRNAs in Fig. 4A. The cDNAs (including about 20 bases from the polylinker) were transferred to the nitrocellulose and exposed directly. The label was incorporated in the dT-tails of the vector-primer, thus allowing a direct
87
comparison to the mRNAs in lanes 1 and 2 of Fig. 4A. This also represents a number average of first strands, displaying both a significant number of long cDNA first strands, as well as the large number of truncated molecules. About 10 000 clones from each library were grown on LB-plates containing 50 pgg/ml ampicillin. The cells were scraped from the plates and plasmid was prepared. Following digestion with SmaI, which excises the cDNA inserts, the molecules were separated on a 1.5% agarose gel (Fig. 4C). Allowing for the fact that the staining represents the quantity of products as a mass average, it can be seen that the distribution of insert sizes approximates the sizes of cDNA first strands in Fig. 4B.
6 x
M-
x
7x
6-
x
5,vumi,r, "1~‘lunrz4 _
(d) RuBPC small subunit clones An example of cDNA size distribution for a particular mRNA, that encoding the small subunit of RuBPC, is presented as a more detailed analysis of the cDNA products (Fig. 5). While there are several inserts which approach the expected full-length size for this mRNA (8 of 32 are > 800 bp), there is also a grouping of clones around 550-650 bp (11 of 32). This may result from some property of the small subunit mRNA which causes preferential termination of reverse transcription at a specific site. Two of the longer clones were further analysed by partial sequence analysis of their 5’ ends (Fig. 6). The two clones probably represent two different members of the small subunit gene family, since their presumed 5’ untranslated regions are quite different. The translation start site shown is assumed to be correct for three reasons; (z) the first three codons (Met, Ala, Ser) are the same as for several RuBP carboxylase small subunit transit peptides (Stiekema et al., 1983), (ii) both contain a highly purine-rich segment just 5’ to the initiator methionine codon, a feature present in small subunit genes from soybean (Berry-Lowe et al., 1982), which is shown for comparison, pea (Cashmore, 1983), and Lemna gibba (Stiekema et al., 1983), and (iii) the large size of the cDNA inserts. Genomic clones for tomato small subunit genes have not been investigated to determine their origins of transcription, so we do not know if these two cDNAs are strictly full length.
x x
x
x
x
x
x
x
3
x
x
x
x
x
2
x
x
x
x
x
x
1
x
xxxxxxxx
DISCUSSION
The vector-primer method of cDNA cloning described by Okayama and Berg (1982) represents an important innovation in recombinant DNA tech-
i
IOMATO PTSS~~..C~I~~ACATATC~CCTTATCATTTCATTATAT~GGATAGTGGACATC~GGTT
Fig. 5. Size analysis clones. Approx. library
were
AND
by in situ METHODS,
small
screening
sub-clone
yielded
subunit
from the tomato colony
cDNA
leaf cDNA
hybridization
(see
section g) using a 3ZP-nick-
probe made from the insert of a soybean
subunit genomic phoresis
RuBPC
1000 transformants screened
MATERIALS translated
of tomato
RuBPC small
(see legend to Fig. 4). Two rounds
32 positive
colonies.
(A) Agarose-gel
of
electro-
of 16 small subunit cDNAs digested with SmaI. (B) Size
distribution
of all 32 small subunit
by agarose-gel
electrophoresis.
cDNA inserts as determined
ToblrroPTSSS........................................................C(17)6AAC SOY8ElN ssu.................................. (CAP SI~E)ATCTGGCAGCAGACAAGT CATATTGACCAAAGGGAGAGCAT ATG GCT TCC TC. .,. ... .. ... *.. . CAAAAAAAGAGAGAAGAAGCAAT ATG GCT TCC TCT GTC ATT TCT TCA GCA . . ACTTGAGMCTAAGAAGPAGAAAATG GCT TCC TCA ATG ATC TCC TCC CCA . .
Fig. 6. 5’ sequences RuBPC designated
small
ofRuBPC
subunit
pTSS5
and pTSS23,
the 5’ end by the method soybean
sequence
clone (Berry-Lowe
cDNAs.
cDNA
clones
Inserts from two tomato (see
were partially
of Maxam
Fig. S), arbitrarily sequenced
and Gilbert
from
(1980). The
is taken from a RuBPC small subunit genomic et al., 1982).
88
nology. Its high efficiency makes cDNA cloning of rare mRNA sequences possible, thus extending molecular analysis to many systems previously beyond the limits of existing technology. Analysis of our initial failures to prepare functional vectorprimers seemed to point to the agarose gel purification step as the source of our problems. When we fortuitously noticed that the starting plasmid was a dimer we decided to pursue the dimer-primer approach as a way to circumvent this step. This led to a vector-primer preparation that was easier and faster to make and, in our hands, much more active. Subsequently polylinkers were added to facilitate the excision of inserts for subcloning and size analysis. The overall performance of the modified system and the original method seems to be quite comparable. When cloning efficiencies are compared on the basis of clones per pmol of vector-primer ends, with the knowledge that we obtain a high percentage of transformants with inserts, our system gives somewhat higher yields. We ascribe this result to an improved transformation protocol rather than to any property of the modified vector itself. We see a significant number of cDNAs for the RuBPC mRNA that approach full length, as judged by agarose-gel electrophoresis. How well this mRNA represents the general population is unknown, but conditions were not optimized for cloning this mRNA specifically. It would be interesting to do the same analysis of a much larger mRNA in this population. This should be possible when probes for such clones are found in a tomato leaf heat-shock mRNA library which we are presently screening. The average sizes of the first-strand cDNAs are somewhat smaller than the mRNAs, although there are a significant number of large products detectable. It is probable that this step could be improved. It is interesting that the distribution of first strands seems to be preserved through the cloning process (Fig. 4B and 4C). We see no evidence, within the limits of these methods, for the prefered cloning of full length cDNAs due to the selective addition of dG-tails to flush-ended cDNAmRNA hybrids (Okayama and Berg, 1982). It is not clear what results should be expected using our conditions for the tailing reaction, since they are somewhat different from those used in more careful studies of homopolymer tailing with terminal deoxynucleotidyl transferase (Deng and Wu, 1981; Michelson and Orkin, 1982).
As with the original system there are a great many possibilities for variations of this method to tit specific needs. The linker piece can be chosen to contain promoter elements for expression in E. coli or, with further modifications, in eucaryotic cells, thus allowing for cDNA screening by immunological methods or by function (Okayama and Berg, 1983). The polylinkers can be chosen to allow sub-cloning into other vectors in chosen orientations or into varied restriction sites. There are simple strategies for obtaining end-labeled insert pieces for sequencing or for crossprobing clones in homologous vectors without the need to separate the labeled insert from the unlabeled vector piece (Ruther et al., 1981). It became apparent after construction of pARC7 that, in principle, analogous vectors can easily be made from any pair of plasmids that contain a polylinker in reverse orientations, e.g. pUC8 and pUC9 (Vieira and Messing, 1982). A desirable feature lacking in our system would be to have unique polylinker sites at either end of the cDNA insert. In conclusion, the dimer-primer approach is a significant improvement of the vector-primer cDNA cloning method of Okayama and Berg because of its ease of preparation and reliability, and because of the versatility afforded by polylinker sites at the cDNAvector junctions.
ACKNOWLEDGEMENTS
We thank Jack Erion for valuable discussions, and Kent McCue for computer graphics.
REFERENCES Bailey, J.M. and Davidson, denaturing Biochem. Berry-Lowe,
agent
for
N.: Methylmercury agarose
Anal.
70 (1976) 75-U. S.L., McKnight,
R.B.: The nucleotide
T.D., Shah, D.M. and Meagher,
sequence,
expression,
one member of a multigene
family encoding
of ribulose-1 $bisphosphate
carboxylase
and evolution
of
the small subunit in soybean.
J. Mol.
H.C. and Doly, .I.: A rapid alkaline extraction
proce-
Appl. Genet. Birnboim,
as a reversible
gel electrophoresis.
1 (1982) 483-498.
dure for screening
recombinant
Res. 7 (1979) 1513-1523.
plasmid
DNA. Nucl. Acids
89 Broglie, R., Coruzzi, G., Lamppa, G., Keith, B. and Chua, N-H.: Structural analysis of nuclear genes coding for the precursor to the small subunit of wheat ribulose-1,5-bisphosphate carboxylase. Bio/Technology 1 (March, 1983) 55-61. Cashmore, A.R.: Nuclear genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase, in Kosuge, T., Meredith, C.P. and Hollaender, A. (Eds.) Genetic Engineering of Plants, An Agricultural Perspective. Plenum, New York, 1983, pp. 29-38. Davies, K.E.: A comprehensive list of cloned eukaryotic genes, in Williamson, R. (Ed.), Genetic Engineering, Vol. 3. Academic Press, New York, 1982, pp. 143-173. Deng, G. and Wu, R.: An improved procedure for utilizing terminal transferase to add homopolymers to the 3’ termini of DNA. Nucl. Acids Res. 9 (1981) 4173-4188. Efstratiadis, A. and Villa-Komaroff, L.: Cloning of doublestranded cDNA, in Setlow, J.K. and Hollaender, A. (Eds.) Genetic Engineering, Vol. 1, Principles and Methods. Plenum, New York, 1979, pp. 15-36. Gubler, U. and Hoffman, B.J.: A simple and very efficient method for generating cDNA libraries. Gene 25 (1983) 263-269. Hall, T.C., Ma, Y., Buchbinder, B.U., Pyne, J.W., Sun, S.M. and Bliss, F.A.: Messenger RNA for Cl protein of French bean seeds: cell-free translation and product characterization. Proc. Natl. Acad. Sci. USA 75 (1978) 3196-3200. Hanahan, D.: Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166 (1983) 557-580. Land, H., Srez, M., Hauser, H., Lindenmaier, W. and Schutz, G.: 5’-Terminal sequences of eucaryotic mRNA can be cloned with high efficiency. Nucl. Acids Res. 9 (1981) 2251-2266. Loenen, W.A.M. and Blattner, F.R.: Lambda Charon vectors (Ch32, 33, 34 and 35) adapted for DNA cloning in recombination-deficient hosts. Gene 26 (1983) 171-179. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560.
Michelson, A.M. and Orkin, S.H.: Characterization of the homopolymer tailing reaction catalyzed by terminal deoxynucleotidyl transferase. J. Biol. Chem. 257 (1982) 14773-14782. Miller, J.H.: Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1972. Murray, M.G., Hoffman, L.M. and Jarvis, N.P.: Improved yield of full-length phaseolin cDNA clones by controlling premature anticomplementary DNA synthesis. Plant Mol. Biol. 2 (1983) 75-84. Okayama, H. and Berg, P.: High efficiency cloning of full-length cDNA. Mol. Cell. Biol. 2 (1982) 161-170. Okayama, H. and Berg, P.: A cDNA cloning vector that permits expression of cDNA inserts in mammalian cells. Mol. Cell. Biol. 3 (1983) 280-289. Retzel, E.F., Collett, M.S. and Faras, A.J.: Enzymatic Synthesis of deoxyribonucleic acid by the avian retrovirus reverse transcriptase in vitro: optimum conditions required for transcription oflarge ribonucleic acid templates. Biochemistry 19 (1980) 513-518. Ruther, U., Koenen, M., Otto, K. and Muller-Hill, B.: pUR222, a vector for cloning and rapid chemical sequencing of DNA. Nucl. Acids Res. 9 (1981) 4087-4098. Sanger, F. and Coulson, A.R.: The use of thin acrylamide gels for DNA sequencing. FEBS Lett. 87 (1978) 107-110. Smith, S.M. and Ellis, R.J.: Light-stimulated accumulation of transcripts of nuclear and chloroplast genes for ribulosebisphosphate carboxylase. J. Mol. Appl. Genet. 1 (1981) 127-137. Stiekema, W.J., Wimpee, C.F. and Tobin, E.M.: Nucleotide sequence encoding the precursor of the small subunit of ribulose- 1,5-bisphosphate carboxylase from Lemna git~baL. G-3. Nucl. Acids Res. 11 (1983) 8051-8061. Thomas, P.S.: Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77 (1980) 5201-5205. Vieira, J. and Messing, J.: The pUC plasmids, and Ml3mp7derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1982) 259-268. Communicated by R.L. Rodriguez.
Gene, 31 (1984) 79-89 Elsevier GENE
1095
A simplified and efficient vector-primer cDNA cloning system (Recombinant DNA; messenger RNA; reverse transcription; ribulose-1,5-bisphosphate subunit; Lycopersicon esculentum; tomato; polylinkers; globin; plasmid; 1 phage)
carboxylase small
Danny C. Alexander*, Thomas D. McKnight and Bill G. Williams ARC0
Plant Cell Research Institute, 6560 Trinity Ct, Dublin, CA 94568-2685 (U.S.A.)
(Received
June 15th, 1984)
(Accepted
June 20th, 1984)
Tel. (415) 833-3400
SUMMARY
A simplified, efficient, and versatile vector-primer cDNA cloning system is presented. The dimer-primer system is a modification of the method of Okayama and Berg (1982) with the following features: (i) the vector-primer molecules are more rapidly and reliably prepared by virtue of the elimination of an endonuclease digestion and the agarose gel purification step from the original method, and (ii) the final cDNA products contain polylinkers at both cDNA-vector junctions, simplifying the size analysis, subcloning, and sequencing of inserts. The system is highly efficient, yielding > lo5 transformants using 1 pg mRNA and 1 pmol of vector-primer ends, with 75 y0 or more of the transformants having inserts. The ability of the system to produce clones of full-length or near full-length is demonstrated by the analysis of 32 ribulose-1,Sbisphosphate carboxylase small subunit cDNA clones from tomato.
INTRODUCTION
The importance of complementary DNA (cDNA) copies of eukaryotic mRNAs in the study of gene structure and function is well established. Obtaining a cDNA clone for a particular mRNA is often very difficult and time consuming, but once isolated it * To whom all correspondence
and reprint
requests
should be
addressed. Abbreviations: dylate;
EtBr,
ria-Bertani
bp, base pairs; ethidium medium;
MeHgOH,
RuBPC,
ribulose-1,5-bisphosphate
dodecyl
sulfate;
EDTA;
dC, deoxycytidylate;
bromide;
TAE,
40mM
kb, kilobase methyl
dT, thymi-
pairs;
mercuric
carboxylase; Tris’acetate,
LB, Luhydroxide;
SDS, pH
sodium
7.5, 2 mM
TBE, 89 mM Tris, 89 mM boric acid, 2 mM EDTA.
0378-l 119/84/$03.00
0
1984 Elsevier
Science
Publishers
becomes a powerful tool for unlocking a large amount of information about the organization and expression of the parent gene. Traditional methods for obtaining cDNA clones have proven adequate for systems in which the mRNA of interest is relatively abundant or can be considerably enriched (Efstratiadis and Villa-Komaroff, 1979; Davies, 1982). However, the efficiency of obtaining clones with these methods is quite low, and the yield of cDNAs that represent a full-length, or nearly full-length, copy of the mRNA is also low. Recent improvements in cDNA cloning techniques have allowed an increased overall efficiency and, in some cases, a better yield of more complete reverse transcripts (Land et al., 198 1; Okayama and Berg, 1982; Gubler and Hoffman, 1983). As a result many
80
more systems should become accessible to the molecular analysis for which a cDNA clone is the key. These systems include those in which (i) the target mRNA comprises a very small fraction of the total messengers, (iq a relatively large number of mRNAs in a population are of interest, or (iii) the starting mRNA is very difficult to obtain in substantial amounts. Our laboratory is interested in obtaining cDNA clones of all the mRNAs of tomato that are induced during acquisition of thermal tolerance - a group of messengers comprising about 20 size classes of various abundances. In our search for the best method for cloning we were p~icul~ly attracted to the innovative vector-primer cDNA cloning system described by Okayama and Berg (1982). Its reported high efficiency, rapidity, and high yield of full-length copies seemed ideal. After encountering difliculties in prep~ng functions vector-p~mer we made modifications in the vector that simplified the preparation and eliminated steps that we suspected to be problematic. To make the system more versatile for cDNA insert analysis and sub-cloning we have designed the modified system in such a way that the cDNA clones have polylinkers at the cDNA-vector junctions, with several sites common to both ends as well as unique sites at the 5’ end. In this report we describe our modifications of the vector plasmid and the simplified preparation of the v~tor-primer system. The performance of the system is demonstrated with two mRNA preparations; rabbit reticulocyte mRNA, for comparison to the original method, and tomato leaf mRNA, to document its utility in our system. The system performs well with both the reticulocyte mRNA and the more complex mRNA from a plant, providing evidence of its general usefulness as a simple, versatile, and efficient cDNA cloning system.
Fred Blattner, University of Wisconsin. Oligo(dA)cellulose and oligo(dT)-cellulose were obtained from Collaborative Research, Inc. ; 32P-labeled nucleotides from Amersham; AMV reverse transcriptase from Life Sciences, Inc.; placental ribonuclease inhibitor (RNasin) from Promega Biotech Co.; methylmercuric hydroxide from Alfa Chemicals as a 1-M solution; terminal deoxynucleotidyl transferase from PL Biochemicals; endonuclease @I, Escherichia coli DNA iigase, and E. coli DNA polymerase I from New England Biolabs; T4 DNA ligase, T4 DNA polymerase, pBR322, synthetic BamHI linkers, rabbit reticulocyte mRNA, RNase H, endonucleases BumHI, SmaI, EcoRI, Suf I, PSI, and &?I were from Bethesda Research Laboratories. (b) Plasmid constructions Fo~uitously, the pSV 0.7 l-O.86 plasmid which we prepared from a randomly chosen single-colony isolate of E. coli K-12, strain HBlOl, was a 6.2-kb head-to-tail dimer. Using this plasmid, Xharon 34, and pBR322, we derived our linker plasmid pARC5, and the dimer-primer vector pARC7 (Fig. 1). Briefly, the Ssti-BamHI portion of the Xharon 34 polylinker was sub-cloned as an inverted repeat into the BumHI site of pBR322 to yield pARC5. pARC6 was generated by ligation of a synthetic BumHI linker into a flush-ended site made by partial digestion of the pSV 0.71-0.86 dimer by &@I followed by T4 polymerase treatment. This plasmid is the same as the pSV 0.71-0.86 dinner except that one of the KpnI sites has been replaced by a BamHI site. Next the portion of the pARC5 polylinker released by HindIII digestion was made hush-ended by T4 polymerase and was ligated into the flush-ended site created by complete digestion of pARC6 with KpnI and treatment with T4 polymerase. This plasmid was designated pARC7. (c) Vector-primer preparation
MATERIALS
AND METHODS
(a) Enzymes, plasmids, and reagents Plasmid pSV 0.71-0.86 was obtained from the laboratory of Dr. P. Berg, Stanford University (Okayama and Berg, 1982). Phage lCharon 34 (Loenen and Blattner, 1983) was provided by Dr.
pARC7 (250 pg) was digested with 500 units of XstI in a 1 ml reaction mixture for 2 h at 37’ C. Following purification of the DNA by phenol : CHCl, (1: 1) and two ethanol precipitations, homopol~er tails of dT residues were added to the 3’ singlestranded ends generated by SstI digestion. The 0.2 ml reaction contained 0.14 M sodium cacodyl-
81
ate-30 mM Tris. HCI, pH 6.8, 1 mM CoCl,, 0.25 mM TTP, 50 PCi [c+~‘P]TTP, 206 I-18(loopmol ends) of SstI-digested pARC7, and 240 units of terminal deoxynucleotidyl transferase. After 5.0 min at 37°C the reaction was stopped and the DNA recovered by phenol : CHCl, extraction and ethanol precipitation. The tailed vector-primer was then purified by two cycles of aflinity chromatography using oligo(dA)-cellulose (Okayama and Berg, 1982). To determine the homopolymeric tail length and distribution, a small portion of the vector primer which had been tailed with [ G(-~‘P]TTP, and a portion of &I-digested vector that had been endlabeled with [ a-32P]dideoxyATP before tailing, were digested with PstI (note the PstI sites in the polylinker, Fig. 1A). The products were then subjected to electrophoresis on an 8% polyacrylamide-urea gel (Sanger and Coulson, 1978) followed by autoradiography. The average dT-tail length for the preparation used in these studies was 45, but we see no differences using preparations containing 60-65 residues. (d) Linker preparation
pARC5 (200 pg) was digested with SstI as described above for pARC7. Following purification of the DNA, homopolymer tails averaging 13-15 dC residues were added to the 3’ single-stranded ends created by SstI digestion. The 100 ~1 reaction contained 0.14 M sodium cacodylate-30 mM Tris . HCl, pH 6.8, 1 mM CoCl,, 1 mM dCTP, 147 pg (lOO-pmol ends) SstI-digested pARC5 DNA, and 120 units terminal deoxynucleotidyl transferase. After 5.0 min at 37’ C the reaction was stopped and the DNA was purified. The homopolymer tail length was determined by end-labeling a portion of the plasmid, before and after tailing, with [r-32P]dideoxyATP followed by PstI digestion and electrophoresis as described above. The remaining dCtailed plasmid preparation was then digested with BamHI and the products subjected to electrophoresis in a 12% polyacrylamide gel containing TBE. The band appearing as a smear just above the 50-bp range was excised and recovered by electroelution. Note that pARC5 yields 2 mol of linker per mol of plasmid. Because of the difficulty in determining the amount of DNA recovered at this point, the optimum ratio of linker to cDNA-vector for the cycli-
zation reaction was determined below).
empirically (see
(e) mRNA preparation
Rabbit-reticulocyte mRNA was used as supplied for cloning or for synthesis of radioactive cDNA probe. Tomato-leaf mRNA was prepared from expanding leaves of greenhouse-grown Lycopersicon esculenturn, variety VFNT Cherry, plants. Plants were approx. 15-20 cm tall with 3-4 sets of leaves when the leaves were harvested into liquid nitrogen. Total RNA was prepared from 30 g of leaves by the SDSproteinase K method of Hall et al. (1978), with the following modifications. After the 2 M LiCl wash the pellet was redissolved in 10 ml of 10 mM HEPES, pH 7.4, followed by the addition of 0.2 ml of 2 M K. acetate, pH 5.5, and then 5 ml of cold ethanol. After 15 min on ice the mixture was centrifuged at 27 000 x g for 15 min at 4’ C. The supernatant was removed to a new tube and 0.3 ml of 2 M K . acetate, pH 5.5, was added, followed by 20 ml cold ethanol. The additional low-salt, low-ethanol step removed a sizable polysaccharide pellet while greater than 95% of the RNA remained in the supematant. Polyadenylated mRNA was selected by two rounds of affinity chromatography on oligo(dT)-cellulose as described by Maniatis et al. (1982) using LiCl in the loading buffer.
(f) cDNA cloning
The procedures used for cloning (Fig. 2) were essentially the same as those described by Okayama and Berg (1982) with the modifications described below. (i) For first-strand synthesis the mRNA (2 pg rabbit-reticulocyte mRNA or 1 pg tomato-leaf mRNA) was denatured by incubation in 10 mM MeHgOH in a volume of 11~1. After 10 min at room temperature 2 ~1 of 0.7 M 2-mercaptoethanol was added, followed by 2 ~1 (70 units) of placental ribonuclease inhibitor. dT-tailed vector-primer (2 pg) was added and the mix was adjusted to 0.1 M Tris * HCl, pH 8.3,135 mM KCl, 10 mM MgCl,, 4 mM sodium pyrophosphate, 2.5 mM of each deoxynucleotide triphosphate, and 2 units/p1 of AMV reverse transcrip-
82
broth (Miller, 1972) at 30” C and then chilled in ice water for 2 h. The cells (40 ml) were centrifuged and then suspended in 20 ml of ice-cold 100 mM CaCl,, 70 mM MnCl,, 40 mM Na. acetate, pH 5.5, and incubated on ice 40-45 min. They were centrifuged again and very gently resuspended in 2 ml of the same solution containing 15% (v/v) glycerol. Aliquots were frozen in liquid nitrogen and stored at - 70°C. Cells prepared in this manner yield 5 x lo7 to 1 x lo8 transformants per pg of supercoiled pBR322. A loo-p1 aliquot of the diluted cDNA ligation mixture was incubated for 30 min on ice with 200 1.11 of competent cells followed by a 5-min incubation at 37°C. Four ml of 2XL broth was added and the cells were grown at 37’ C for 70-90 min. The outgrowth was centrifuged (5000 x g, 5 min), resuspended in 50- 100 @2XL-broth, and spread on LBplates (Miller, 1972) containing 50 pg/ml ampicillin. Amounts for plating were chosen to yield approx. 500 colonies per 150~mm plate.
tase in a total volume of 30 ~1.The mix was incubated at 42°C for 90 min. (ii) Homopolymer tailing of the cDNA products was done with 1 mM dGTP and 10 units of terminal deoxynucleotidyl transferase in a 20-~1 volume for 30 min at 37’ C. (iii) The dG-tailed cDNA-vector products were digested with 20-25 units of BamHI in a volume of 25 ~1. (iv) The amount of dC-tailed linker needed for optimum cloning efficiency was determined by ligating serial dilutions of the linker with a fixed amount of cDNA-vector. The ligation and repair reactions were otherwise as described. Note that an extra piece of DNA, generated in the original method by Hind111 digestion, is not present after the BumHI digestion in our system. (v) Frozen competent MM294 cells were prepared by a modification (Dan Denney, personal communication) of the method of Hanahan (1983). Briefly, cells were grown to AGo0= 0.5 in 2X Luria (2XL)
Eco RI
11
SSt+
:?tRIZZ
Sma Xba Sal Pst
Sal
Xba Sma Sst
Sma Xba Sal
dC-tailing site
Hind Barn
c,b:I
Pst
Xba Sma
Pst
1 dT-tailing
Fig. 1. Plasmids 0.71-0.86
by insertion
for the addition
of a synthetic
of homopolymer
pARC5 was created
by inserting
SstI site is used for the addition is isolated plasmid.
site
used for vector-primer
and linker preparation.
BamHI
tails of thymidylate a portion
residues,
of the Eharon
of homopolymer
and used to effect closure
(A) The vector
plasmid
pARC7
linker at one of the KpnI sites and a polylinker thus creating
34 polylinker products
from a dimer of pSV
two primer ends on each molecule. (B) The linker plasmid
as an inverted repeat into the BumHI site of pBR322. The unique
tails of deoxycytidylate
of cDNA-vector
was derived
at the other. The unique SstI site is used
residues.
Following
digestion
with BamHI
this linker piece
(see Fig. 2). Note that pARC5 yields two moles of linker per mole of
83
(g) Screening
RESULTS
Transformants were screened for the presence of cDNA inserts by the in situ colony hybridization method of Taub and Thompson (1982) using either primary plates directly or by picking colonies into 96-well liquid-culture plates for subsequent plating with a 96-prong replicating device (Immusine Laboratories, Berkeley, CA).
(a) Vector-primer and linker Restriction maps of the vector plasmid (pARC7) and the linker plasmid (pARC5) are shown in Fig. 1. The linker plasmid pARC5 (Fig. 1B) was made simply by inserting the BarnHI-St1 portion of the Kharon 34 polylinker as a palindrome into the BamHI site of pBR322. Note that pARC7 (Fig. 1A) is a dimer of pSV 0.71-0.86 (Okayama and Berg, Barn
Barn
Barn
!
Al Al AT
AT AT
AT
AT
AT
AT
AT
AT
AT
AT
AT . _ A I
AT AT AT
T T
T Vector-
T
Primer
T T
jmRNA
:mRNA G
G
G
G G
G
G G
G
G
G G
J 5) Anneal
1
linker
Bammccccc Linker (5’ Polylinker)
,,~)n##~zc,:i%f 5’ Polyhnker
3’ Polyllnker
(DNA
Fig. 2. cDNA cloning with the dimer-primer transcription
yields cDNA
first strands
results in two independent
cDNA-vector
complementary
ends at the opposite
complementary
ends at the other,
repaired
by the actions
replaces
the RNA strand
transformed
of RNase
‘CC..
molecules
are annealed
dG-tails
are annealed
. . +,A
da-tailing,
at the ends representing
to the cDNA-vectors, strands
to the dT-tails of the vector-primer.
to the vector molecule.
The linker pieces, which contain
H, which nicks the mRNA
E. coli cells and transformants
. . . .
3’ Polyhker
causing
are selected
followed by BamHI
the 5’ portion of the mRNAs dC-tails
circularization
in the mRNA-cDNA
with DNA, and E. coli DNA ligase, which covalently
into competent
.
TTTti
mRNAs
attached
containing
ends of the vectors.
. .
Polyllnker
system. Polyadenylated
that are covalently
.
Ba;FGG‘
closes the remaining
on LB plates containing
and BamHI
at one of their ends and BumHI
of the complexes. hybrid,
Reverse digestion,
The molecules
E. coli DNA polymerase nicks. The repaired
ampicillin.
are
I, which
plasmids
are
84
those described by Okayama and Berg (1982). Our conditions for the first-strand synthesis differ in that they include a higher potassium concentration (Retzel et al., 1980), and the use of pyrophosphate (Murray et al., 1983). We have not done extensive optimization for first-strand synthesis since our main interest here is to describe the modified vector system as a general tool. The conditions for first-strand synthesis should be optimized according to a particular application. dG-tailing of the first strands was chosen so that the linker piece could receive dC-tails and thus regenerate a unique SstI site at the 5’ end of each cDNA insert. The BumHI digestion generates two independent cDNA clones bearing opposite orientations with respect to the remainder of the vector molecule (but not to the polylinkers). Both orientations clone with equal efficiency, as determined by restriction analysis of 48 individual clones (not shown). The tendency of BumHI to digest RNA-DNA hybrids was not investigated. However, cDNA clones lacking the 5’ polylinker piece, which might result from cleavage at a hybrid BumHI site, have not been observed. Table I shows the number of transformants that were obtained using the two mRNA preparations. The total number of transformants in the libraries were similar for the rabbit-reticulocyte mRNA and the tomato-leaf mRNA using our standard reaction, which contains I-pmol vector ends (2 pg plasmid). Note that 3-10 pmol of mRNA was used per pmol vector ends. Although we did not test this system with decreasing amounts of mRNA, Okayama and Berg (1982) obtained good results using only about 1.4 pmol(0.29 pg) of globin mRNA per pmol of vector ends. An important criterion to consider in
1982) except that one KpnI site has been replaced by a BarnHI linker and the other by a portion of the palindromic polylinker from pARC5. The portion of the vector plasmid from the Hind111 sites clockwise to the PvuII sites (sites underlined), with the exception of the synthetic linker pieces, are the portions in the original plasmid that were derived from SV40. The remainder of the sequence is from pBR322. This plasmid replicates well in the E. coli Ret A- host HBlOl. To prepare the dimer-primer molecule, pARC7 is digested with St1 and the resulting ends are dTtailed. The products are purified using oligo(dA)-cellulose chromatography (two passes). This eliminates two steps from the original Okayama and Berg procedure: (i) the HpaI digestion, and (ii) agarose-gel purification. The products are obtained in higher yield, in considerably less time, and free of the impurities inherent in isolations of nucleic acids from agarose gels. The two halves of the starting polylinker become the 3’ polylinkers for two different cDNAs that will be synthesized on the dimer-primer molecule (Fig. 2). The linker plasmid, pARC5, is likewise digested with St1 but is then dC-tailed and subsequently digested with BamHI. The small, dCtailed linker piece is isolated from a polyacrylamide gel. This piece forms the 5’ polylinker on all cDNAs. Note that the St1 site is regenerated by C-tailing (5’ end), but not by dT-tailing (3’ end), and that the 5’ polylinker contains a Hind111 site and a BumHI site that are absent in the shorter 3’ polylinker. (b) cDNA cloning
The procedures for generating cDNA clones using this vector system (Fig. 2) are essentially the same as TABLE
I
Efficiencies Standard
of cloning cDNA cloning reactions
were performed
using 1 pmol vector-primer
The host was E. coli K-12 strain MM294. Transformants mations
yielded 0.5-l
x lo8 transformants
per pg of supercoiled Transformants pmol vector
(1) Globin
mRNA
were selected
per ends
ends (2 pg plasmid)
on LB plates containing
pBR322. Transformants pg mRNA
(2 pg)
(a) Complete
192000
96000
(b) No linker
32 000
16000
(c) No ligase
14000
1000
184000
184 000
(2) Tomato-leaf
mRNA
(1 pg)
per
and the indicated 50 pgg/ml ampicillin.
amounts Control
of mRNA. transfor-
85
cDNA cloning is the number of transformants that have inserts. In vector-primer systems a large number of transformants are obtained even in the absence of mRNA; therefore care should be taken when comparing cloning efficiencies expressed as the number of transformants per pg mRNA. mRNA preparations vary considerably in average size and complexity, with most being larger and more complex than rabbit reticulocyte mRNA. Since the successful use of the vector-primer type of system requires an excess of mRNA over vector-primer, the optimum situation becomes one in which the amount of mRNA used is the minimum that still allows for a high percentage of cDNA inserts. This percentage can be determined by direct detection of inserts in a population of clones. Fig. 3 shows 360 randomly picked colonies from each of the two libraries. When probed with [32P]cDNA made from the same
mRNA preparation used for cloning we detect 78 y0 and 75% inserts in the rabbit reticulocyte and tomato leaf cDNA libraries, respectively. This is in good agreement with the 80 % inserts reported in the original method. It is probable that this represents a minimum number, since cDNAs of very rare mRNAs would not be detectable. Note in Table I that in the absence of linker there is an apparent background of about 16%. If ligase is omitted the background is still about 7-8 % . Some of these probably represent molecules that escaped tailing or restriction enzyme digestion and thus transform at a greater efficiency than the bulk of the molecules. It is also possible that some represent improper closures of molecules that would be driven into proper constructs in the presence of linker. In any case this background is higher than that observed by Okayama and Berg (1982). It is possible that their lower background is due to the removal of such “escaped” molecules in the agarose gel purification step. However, their reported percentage of transformants with inserts is quite similar to ours and, as a result, we do not consider this a problem. (c) mRNA-cDNA comparisons
Tomato
leaf cDNAs
%a*
Fig. 3. Detection Randomly
clones
&1&r
*
by colony
hybridization.
from each of two cDNA librar(see MATE-
section g) using [3ZP]cDNA
from the same mRNA
cloning.
* * *
by in situ colony hybridization
AND METHODS,
synthesized cDNA
of cDNA
chosen transformants
ies were screened RIALS
s b&,
preparations
probes
used for the
A rigorous test of a cDNA cloning system is a comparison of the cDNA inserts to the mRNA template from which it was made. Fig. 4A is an analysis of the mRNA templates used in this study. Rabbit-reticulocyte mRNA and tomato-leaf mRNA were separated on an agarose-MeHgOH gel and transferred to nitrocellulose. The bound RNAs were then hybridized with three different probes. Lanes 1 and 2 were probed with [32P]oligo(dT) to show the distribution of poly(A)-containing molecules. The reticulocyte message consists almost entirely of globin-size sequences, whereas the 1eafmRNA appears as a smear centered around approx. 1000 bases. This method displays what approximates a number average of the mRNA molecules, rather than a mass average as obtained by EtBr staining. It also eliminates interference from ribosomal RNA contaminants. To judge the integrity of specific mRNAs in the populations, the fnters were probed with 32Plabeled rabbit-reticulocyte cDNAs (lanes 3 and 4) or with a nick-translated EcoRI fragment from a soybean RuBPC small subunit gene (lanes 5 and 6). The band hybridizing to the small subunit probe is in the
86
A
12
345
13531078872,
310, 2812341 194”
Fig. 4. Comparison
of cDNAs
to mRNA templates.
MeHgOH
gel (Bailey and Davidson,
of tomato
leaf mRNA.
Lanes 1 and 2 were probed
[32P]cDNA.
Lanes 5 and 6 were probed
(Berry-Lowe
et al., 1982). (B) cDNA
of the vector-primer Following
separated
were released
the nucleic acids were transferred
of cDNA polylinker.
of rabbit-reticulocyte
plasmid
libraries
mRNA
(see RESULTS,
Lanes 1 and 2 are rabbit-reticulocyte
with Hue111 (right margin:
oligo(dT).
mRNA.
by PsrI digestion, and detected
small subunit
section c). Inserts
respectively.
were released
and tomato-leaf
from soybean in the dT-tail
directly by autoradiography.
by SmaI digestion,
cDNAs,
subclone
was located
which cuts near the dT-tail-vector
(C) EtBr-stained respectively.
resulting agarose
2 kg
with rabbit-reticulocyte
genomic
gel. The “‘P-label
is added. Lanes 2 and 3 are the first strands mRNA,
on 1.5% agarose
Lanes 2,4, and 6 contain
Lanes 3 and 4 were probed
pSRS 0.8, an RuBPC
to nitrocellulose
and tomato-leaf cDNAs
used for cDNA cloning, separated
1 pg of rabbit reticulocyte
on 1.5% agarose-MeHgOH
from the vector
the dT-tails alone, which result when no mRNA template using templates
blots of mRNAs
with ‘*P-end-labeled
with “‘P-nick-translated
first strands
and the products
electrophoresis
(A) Northern
1976). Lanes I, 3, and 5 contain
junctions.
Lane 1 contains
from reverse transcription gel (1.5 y0 agarose,
sites for which are located
Lane 3 contains
TAE) in each
$X174 DNA digested
sizes in bp).
range of 830-950 bases, a size similar to those for small subunit mRNAs from several species (Stiekema et al., 1983; Broglie et al., 1983; Smith and Ellis, 1983; Berry-Lowe et al., 1982). This is also a sufficient size to code for the small subunit protein precursor from tomato (our unpublished results). Neither of these preparations show any evidence of RNA degradation. Fig. 4B is an autoradiogram of the cDNA first
strands for the two libraries. The dT-tails alone (lane l), or the first strands (lanes 2 and 3) were released from the vector by PstI digestion (&I cuts in the 3’ polylinker), and the strands were electrophoresed on the same gel as the mRNAs in Fig. 4A. The cDNAs (including about 20 bases from the polylinker) were transferred to the nitrocellulose and exposed directly. The label was incorporated in the dT-tails of the vector-primer, thus allowing a direct
87
comparison to the mRNAs in lanes 1 and 2 of Fig. 4A. This also represents a number average of first strands, displaying both a significant number of long cDNA first strands, as well as the large number of truncated molecules. About 10 000 clones from each library were grown on LB-plates containing 50 pgg/ml ampicillin. The cells were scraped from the plates and plasmid was prepared. Following digestion with SmaI, which excises the cDNA inserts, the molecules were separated on a 1.5% agarose gel (Fig. 4C). Allowing for the fact that the staining represents the quantity of products as a mass average, it can be seen that the distribution of insert sizes approximates the sizes of cDNA first strands in Fig. 4B.
6 x
M-
x
7x
6-
x
5,vumi,r, "1~‘lunrz4 _
(d) RuBPC small subunit clones An example of cDNA size distribution for a particular mRNA, that encoding the small subunit of RuBPC, is presented as a more detailed analysis of the cDNA products (Fig. 5). While there are several inserts which approach the expected full-length size for this mRNA (8 of 32 are > 800 bp), there is also a grouping of clones around 550-650 bp (11 of 32). This may result from some property of the small subunit mRNA which causes preferential termination of reverse transcription at a specific site. Two of the longer clones were further analysed by partial sequence analysis of their 5’ ends (Fig. 6). The two clones probably represent two different members of the small subunit gene family, since their presumed 5’ untranslated regions are quite different. The translation start site shown is assumed to be correct for three reasons; (z) the first three codons (Met, Ala, Ser) are the same as for several RuBP carboxylase small subunit transit peptides (Stiekema et al., 1983), (ii) both contain a highly purine-rich segment just 5’ to the initiator methionine codon, a feature present in small subunit genes from soybean (Berry-Lowe et al., 1982), which is shown for comparison, pea (Cashmore, 1983), and Lemna gibba (Stiekema et al., 1983), and (iii) the large size of the cDNA inserts. Genomic clones for tomato small subunit genes have not been investigated to determine their origins of transcription, so we do not know if these two cDNAs are strictly full length.
x x
x
x
x
x
x
x
3
x
x
x
x
x
2
x
x
x
x
x
x
1
x
xxxxxxxx
DISCUSSION
The vector-primer method of cDNA cloning described by Okayama and Berg (1982) represents an important innovation in recombinant DNA tech-
i
IOMATO PTSS~~..C~I~~ACATATC~CCTTATCATTTCATTATAT~GGATAGTGGACATC~GGTT
Fig. 5. Size analysis clones. Approx. library
were
AND
by in situ METHODS,
small
screening
sub-clone
yielded
subunit
from the tomato colony
cDNA
leaf cDNA
hybridization
(see
section g) using a 3ZP-nick-
probe made from the insert of a soybean
subunit genomic phoresis
RuBPC
1000 transformants screened
MATERIALS translated
of tomato
RuBPC small
(see legend to Fig. 4). Two rounds
32 positive
colonies.
(A) Agarose-gel
of
electro-
of 16 small subunit cDNAs digested with SmaI. (B) Size
distribution
of all 32 small subunit
by agarose-gel
electrophoresis.
cDNA inserts as determined
ToblrroPTSSS........................................................C(17)6AAC SOY8ElN ssu.................................. (CAP SI~E)ATCTGGCAGCAGACAAGT CATATTGACCAAAGGGAGAGCAT ATG GCT TCC TC. .,. ... .. ... *.. . CAAAAAAAGAGAGAAGAAGCAAT ATG GCT TCC TCT GTC ATT TCT TCA GCA . . ACTTGAGMCTAAGAAGPAGAAAATG GCT TCC TCA ATG ATC TCC TCC CCA . .
Fig. 6. 5’ sequences RuBPC designated
small
ofRuBPC
subunit
pTSS5
and pTSS23,
the 5’ end by the method soybean
sequence
clone (Berry-Lowe
cDNAs.
cDNA
clones
Inserts from two tomato (see
were partially
of Maxam
Fig. S), arbitrarily sequenced
and Gilbert
from
(1980). The
is taken from a RuBPC small subunit genomic et al., 1982).
88
nology. Its high efficiency makes cDNA cloning of rare mRNA sequences possible, thus extending molecular analysis to many systems previously beyond the limits of existing technology. Analysis of our initial failures to prepare functional vectorprimers seemed to point to the agarose gel purification step as the source of our problems. When we fortuitously noticed that the starting plasmid was a dimer we decided to pursue the dimer-primer approach as a way to circumvent this step. This led to a vector-primer preparation that was easier and faster to make and, in our hands, much more active. Subsequently polylinkers were added to facilitate the excision of inserts for subcloning and size analysis. The overall performance of the modified system and the original method seems to be quite comparable. When cloning efficiencies are compared on the basis of clones per pmol of vector-primer ends, with the knowledge that we obtain a high percentage of transformants with inserts, our system gives somewhat higher yields. We ascribe this result to an improved transformation protocol rather than to any property of the modified vector itself. We see a significant number of cDNAs for the RuBPC mRNA that approach full length, as judged by agarose-gel electrophoresis. How well this mRNA represents the general population is unknown, but conditions were not optimized for cloning this mRNA specifically. It would be interesting to do the same analysis of a much larger mRNA in this population. This should be possible when probes for such clones are found in a tomato leaf heat-shock mRNA library which we are presently screening. The average sizes of the first-strand cDNAs are somewhat smaller than the mRNAs, although there are a significant number of large products detectable. It is probable that this step could be improved. It is interesting that the distribution of first strands seems to be preserved through the cloning process (Fig. 4B and 4C). We see no evidence, within the limits of these methods, for the prefered cloning of full length cDNAs due to the selective addition of dG-tails to flush-ended cDNAmRNA hybrids (Okayama and Berg, 1982). It is not clear what results should be expected using our conditions for the tailing reaction, since they are somewhat different from those used in more careful studies of homopolymer tailing with terminal deoxynucleotidyl transferase (Deng and Wu, 1981; Michelson and Orkin, 1982).
As with the original system there are a great many possibilities for variations of this method to tit specific needs. The linker piece can be chosen to contain promoter elements for expression in E. coli or, with further modifications, in eucaryotic cells, thus allowing for cDNA screening by immunological methods or by function (Okayama and Berg, 1983). The polylinkers can be chosen to allow sub-cloning into other vectors in chosen orientations or into varied restriction sites. There are simple strategies for obtaining end-labeled insert pieces for sequencing or for crossprobing clones in homologous vectors without the need to separate the labeled insert from the unlabeled vector piece (Ruther et al., 1981). It became apparent after construction of pARC7 that, in principle, analogous vectors can easily be made from any pair of plasmids that contain a polylinker in reverse orientations, e.g. pUC8 and pUC9 (Vieira and Messing, 1982). A desirable feature lacking in our system would be to have unique polylinker sites at either end of the cDNA insert. In conclusion, the dimer-primer approach is a significant improvement of the vector-primer cDNA cloning method of Okayama and Berg because of its ease of preparation and reliability, and because of the versatility afforded by polylinker sites at the cDNAvector junctions.
ACKNOWLEDGEMENTS
We thank Jack Erion for valuable discussions, and Kent McCue for computer graphics.
REFERENCES Bailey, J.M. and Davidson, denaturing Biochem. Berry-Lowe,
agent
for
N.: Methylmercury agarose
Anal.
70 (1976) 75-U. S.L., McKnight,
R.B.: The nucleotide
T.D., Shah, D.M. and Meagher,
sequence,
expression,
one member of a multigene
family encoding
of ribulose-1 $bisphosphate
carboxylase
and evolution
of
the small subunit in soybean.
J. Mol.
H.C. and Doly, .I.: A rapid alkaline extraction
proce-
Appl. Genet. Birnboim,
as a reversible
gel electrophoresis.
1 (1982) 483-498.
dure for screening
recombinant
Res. 7 (1979) 1513-1523.
plasmid
DNA. Nucl. Acids
89 Broglie, R., Coruzzi, G., Lamppa, G., Keith, B. and Chua, N-H.: Structural analysis of nuclear genes coding for the precursor to the small subunit of wheat ribulose-1,5-bisphosphate carboxylase. Bio/Technology 1 (March, 1983) 55-61. Cashmore, A.R.: Nuclear genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase, in Kosuge, T., Meredith, C.P. and Hollaender, A. (Eds.) Genetic Engineering of Plants, An Agricultural Perspective. Plenum, New York, 1983, pp. 29-38. Davies, K.E.: A comprehensive list of cloned eukaryotic genes, in Williamson, R. (Ed.), Genetic Engineering, Vol. 3. Academic Press, New York, 1982, pp. 143-173. Deng, G. and Wu, R.: An improved procedure for utilizing terminal transferase to add homopolymers to the 3’ termini of DNA. Nucl. Acids Res. 9 (1981) 4173-4188. Efstratiadis, A. and Villa-Komaroff, L.: Cloning of doublestranded cDNA, in Setlow, J.K. and Hollaender, A. (Eds.) Genetic Engineering, Vol. 1, Principles and Methods. Plenum, New York, 1979, pp. 15-36. Gubler, U. and Hoffman, B.J.: A simple and very efficient method for generating cDNA libraries. Gene 25 (1983) 263-269. Hall, T.C., Ma, Y., Buchbinder, B.U., Pyne, J.W., Sun, S.M. and Bliss, F.A.: Messenger RNA for Cl protein of French bean seeds: cell-free translation and product characterization. Proc. Natl. Acad. Sci. USA 75 (1978) 3196-3200. Hanahan, D.: Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166 (1983) 557-580. Land, H., Srez, M., Hauser, H., Lindenmaier, W. and Schutz, G.: 5’-Terminal sequences of eucaryotic mRNA can be cloned with high efficiency. Nucl. Acids Res. 9 (1981) 2251-2266. Loenen, W.A.M. and Blattner, F.R.: Lambda Charon vectors (Ch32, 33, 34 and 35) adapted for DNA cloning in recombination-deficient hosts. Gene 26 (1983) 171-179. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560.
Michelson, A.M. and Orkin, S.H.: Characterization of the homopolymer tailing reaction catalyzed by terminal deoxynucleotidyl transferase. J. Biol. Chem. 257 (1982) 14773-14782. Miller, J.H.: Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1972. Murray, M.G., Hoffman, L.M. and Jarvis, N.P.: Improved yield of full-length phaseolin cDNA clones by controlling premature anticomplementary DNA synthesis. Plant Mol. Biol. 2 (1983) 75-84. Okayama, H. and Berg, P.: High efficiency cloning of full-length cDNA. Mol. Cell. Biol. 2 (1982) 161-170. Okayama, H. and Berg, P.: A cDNA cloning vector that permits expression of cDNA inserts in mammalian cells. Mol. Cell. Biol. 3 (1983) 280-289. Retzel, E.F., Collett, M.S. and Faras, A.J.: Enzymatic Synthesis of deoxyribonucleic acid by the avian retrovirus reverse transcriptase in vitro: optimum conditions required for transcription oflarge ribonucleic acid templates. Biochemistry 19 (1980) 513-518. Ruther, U., Koenen, M., Otto, K. and Muller-Hill, B.: pUR222, a vector for cloning and rapid chemical sequencing of DNA. Nucl. Acids Res. 9 (1981) 4087-4098. Sanger, F. and Coulson, A.R.: The use of thin acrylamide gels for DNA sequencing. FEBS Lett. 87 (1978) 107-110. Smith, S.M. and Ellis, R.J.: Light-stimulated accumulation of transcripts of nuclear and chloroplast genes for ribulosebisphosphate carboxylase. J. Mol. Appl. Genet. 1 (1981) 127-137. Stiekema, W.J., Wimpee, C.F. and Tobin, E.M.: Nucleotide sequence encoding the precursor of the small subunit of ribulose- 1,5-bisphosphate carboxylase from Lemna git~baL. G-3. Nucl. Acids Res. 11 (1983) 8051-8061. Thomas, P.S.: Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77 (1980) 5201-5205. Vieira, J. and Messing, J.: The pUC plasmids, and Ml3mp7derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1982) 259-268. Communicated by R.L. Rodriguez.