A thermophilic β-mannanase from Neosartorya fischeri P1 with broad pH stability and significant hydrolysis ability of various mannan polymers

Food Chemistry 173 (2015) 283–289

Contents lists available at ScienceDirect

Food Chemistry journal homepage: www.elsevier.com/locate/foodchem

A thermophilic b-mannanase from Neosartorya fischeri P1 with broad pH stability and significant hydrolysis ability of various mannan polymers Hong Yang 1, Pengjun Shi 1,⇑, Haiqiang Lu, Huimin Wang, Huiying Luo, Huoqing Huang, Peilong Yang, Bin Yao ⇑ Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

a r t i c l e

i n f o

Article history: Received 12 May 2014 Received in revised form 2 October 2014 Accepted 5 October 2014 Available online 12 October 2014 Keywords: Neosartorya fischeri Pichia pastoris b-Mannanase Thermophilic Broad pH stability

a b s t r a c t A new b-mannanase gene, man5P1, was cloned from the thermophilic fungus Neosartorya fischeri P1, and successfully expressed in Pichia pastoris. The predicted amino acid sequence of man5P1 consists of a putative 19-residue signal peptide at the N-terminus and a catalytic domain of glycoside hydrolase family 5. The purified recombinant Man5P1 (rMan5P1) was optimally active at pH 4.0 and 80 °C, and was acid and alkali tolerant, exhibiting >20% of the maximal activity at pH 2.0 and 9.0. rMan5P1 had better stability over a broad pH range of 2.0–12.0, and was highly thermostable at 60 °C and below. The enzyme was highly active towards galactomannan and glucomannan, and exhibited classic endo-activity producing a mixture of mannooligosaccharides (MOS). Moreover, it had strong resistance to SDS and Ag+ and proteases. The superior properties make Man5P1 a potential candidate for use in various industrial applications. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction In plant cell walls, hemicelluloses are polymeric carbohydrates which contain a b-linked sugar backbone (Pérez, Munoz-Dorado, de la Rubia, & Martinez, 2002). Mannans are a major group of hemicellulose in nature and are classified into four types based on composition (Moreira & Filho, 2008). Linear mannans consist of a backbone of b-1,4-mannose, glucomannans consist of randomly dispersed b-1,4-galactose and b-1,4-mannose, and the backbones of galactomannans and galactoglucomannans are decorated with side chains of a-1,6-linked galactose residues (Chauhan, Puri, Sharma, & Gupta, 2012; Petkowicz et al., 2001). The complete breakdown of mannan requires a variety of enzymes, including b-mannanase, b-mannosidase, b-glucosidase, a-galactosidase and esterase. b-Mannanase (EC3.2.1.78) is an endo-type enzyme that randomly cleaves the b-1,4 glycosidic linkages in the backbone of mannans, releasing oligomannosides of different lengths (Dhawan & Kaur, 2007; Moreira & Filho, 2008). The main-chain cleaving capacity of b-mannanase is greatly affected by the extent and pattern of substitution of the mannan

⇑ Corresponding authors at: Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing 100081, PR China. Tel.: +86 10 82106053; fax: +86 10 82106054. E-mail addresses: [email protected] (P. Shi), [email protected] (B. Yao). 1 H. Yang and P. Shi contributed equally to this paper. http://dx.doi.org/10.1016/j.foodchem.2014.10.022 0308-8146/Ó 2014 Elsevier Ltd. All rights reserved.

backbone. Based on the primary structures of their catalytic domains, b-mannanases have been classified as members of the glycoside hydrolase (GH) families 5, 26, and 113 (http://www. cazy.org; Henrissat & Davies, 1997). The bacterial b-mannanases are grouped into GH 5 and GH 113, and the majority of fungal b-mannanases belong to GH 5 and GH 26. In comparison with bacterial b-mannanases, fungal b-mannanases exhibit better activity and stability at acidic conditions and higher catalytic efficiency. And b-mannanases are being applied in various industries, including animal feed, baking, coffee extraction, textile, and paper and pulp (Chauhan et al., 2012; Moreira & Filho, 2008). Thermophilic and thermostable b-mannanases from thermophilic fungi have great advantages, such as reducing the risk of contamination, increasing the substrate solubility, and improving the mass transfer rate (Maijala, Kango, Szijarto, & Viikari, 2012), thus attracting considerable research interest in recent years. Until now, the thermophilic fungi Talaromyces leycettanus JCM12802 (Wang et al., 2014a), Aspergillus fumigatus IMI 385708 (Duruksu, Ozturk, Biely, Bakir, & Ogel, 2009), Aspergillus nidulans XZ3 (Lu et al., 2014), Humicola insolens Y1 (Luo et al., 2012), Thielavia arenaria XZ7 (Lu et al., 2013), and Rhizomucor miehei (Katrolia et al., 2013) have been reported be the ideal microbial sources of excellent b-mannanases. The present study aims to obtain a new thermophilic and acidic b-mannanase for potential use in the food and feed industry. The thermophilic fungus Neosartorya fischeri P1 is an excellent CAZyme producer (Wang et al., 2014b) and has the ability to utilise mannan

284

H. Yang et al. / Food Chemistry 173 (2015) 283–289

as the carbon source. Therefore, cloning the mannanase gene and achieving high-level expression of the gene expression will provide a new acidic thermophilic b-mannanase. In combination with the enzymatic properties, its application potential will also be discussed. 2. Materials and methods 2.1. Strains, media, vectors and chemicals

transcription initiation sites were predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). Alignment of multiple protein sequences was accomplished using ClustalW software. The signal peptide was predicted by the SignalP 4.0 server (http://www.cbs.dtu.dk/services/SignalP/). The potential N-glycolyzation and O-glycolyzation sites were predicted online (http://www.cbs.dtu.dk/services/NetNGlyc/; http://www. cbs.dtu.dk/services/NetOGlyc/). 2.4. Heterologous expression in P. pastoris

N. fischeri P1 was deposited in the China General Microbiological Culture Collection Center (Beijing, China) under the registration number CGMCC 3.15369 (Wang et al., 2014b). It was grown at 45 °C in enzyme producing medium as described previously (Cao et al., 2007). The plasmid pGEM-T Easy (Promega, Madison, WI) and Escherichia coli Trans1-T1 (TransGen, Beijing, China) were used for DNA manipulation. The heterologous protein expression system of pPIC9 and Pichia pastoris GS115 was purchased from Invitrogen (Carlsbad, CA). The DNA purification kit, restriction endo-nucleases and LA Taq DNA polymerase were purchased from TaKaRa (Otsu, Japan). The Fungal DNA Mini kit was obtained from Omega Biotek (Doraville, GA). T4 DNA ligase and the total RNA isolation system kit were purchased from Promega. Locust bean gum (LBG), guar gum, konjac flour, p-nitrophenyl-b-D-mannopyranoside (pNPM), beechwood xylan, and carboxymethyl cellulose sodium salt (CMC-Na) were purchased from Sigma–Aldrich (St. Louis, MO). High viscosity guar galactomannans containing 21, 28 and 38% of galactose, respectively, were purchased from Megazyme (Wicklow, Ireland). All other chemicals were of analytical grade. 2.2. Cloning of the cDNA of man5P1 To obtain the core region of the b-mannanase gene, the purified genomic DNA of strain P1 as the template and a degenerate primer set specific for fungal GH 5 mannanases (GH5F and GH5R, Table 1) (Luo et al., 2009) were used for touchdown PCR amplification. The resulting PCR products were gel purified, ligated with pGEM-T Easy vector and then transformed into E. coli Trans1-T1 for sequencing. Total RNA was extracted using the SV Total RNA Isolation System (Promega). cDNA was obtained by using RT-PCR according to the protocol of Ace-a-TM kit (TOYOBO, Osaka, Japan). The fulllength cDNA of man5P1 was amplified using the specific primers (man5P1-F and man5P1-R, Table 1) with an annealing temperature of 60 °C. The specific PCR products were ligated into the pGEM-T Easy vector for sequencing.

The cDNA fragment of man5P1 without the signal peptide-coding sequence was amplified with specific expression primers (man5P1-PF and man5P1-PR, Table 1). After enzyme digest with EcoRI and NotI, the gene fragment was cloned into the pPIC9 vector in-frame fusion of the a-factor signal peptide to construct the recombinant plasmid pPIC9-man5P1. The recombinant plasmid was linearised using BglII and transformed into P. pastoris GS115 competent cells by electroporation. The transformants were screened on minimal dextrose medium (MD) plates at 30 °C for 48 h. The positive colonies were transferred to buffered glycerol complex medium (BMGY; 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4  105% biotin, and 1% glycerol) and grown at 30 °C for 2 days. The cells were collected by centrifugation and resuspended in buffered methanol complex medium (BMMY; 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4  105% biotin, and 0.5% methanol) for induction. The culture supernatants were collected for the b-mannanase activity assay. The transformant that exhibited the highest b-mannanase activity was selected for fermentation in 1-L Erlenmayer flasks as described by Luo et al. (2012) for the subsequent experiment analysis. 2.5. Enzyme activity assay b-Mannanase activity was determined by using the 3,5-dinitrosalicylic acid (DNS) method with mannose as the standard (Miller, 1959). The standard reaction was carried out at 50 °C for 10 min with 0.1 mL of appropriately diluted enzyme and 0.9 mL of 0.5% (w/v) LBG in 100 mM citric acid-Na2HPO4 (pH 4.0). The reaction was terminated by addition of 1.5 mL DNS reagent and boiled in water for 5 min. After cooling to room temperature, the absorbance at 540 nm was measured. For the control sample, the recombinant enzyme was added after DNS reagent. All experiments were run in triplicate. One unit (U) of b-mannanase activity was defined as the amount of enzyme that released 1 lmol of reducing sugar per min under standard assay conditions.

2.3. Sequence analysis 2.6. Purification of the recombinant enzyme (rMan5P1) DNA and protein sequence were aligned using the BLASTn and BLASTp programs (http://www.ncbi.nlm.nih.gov/BLAST/), respectively. The nucleotide sequence was analysed using the NCBI ORF Finder tool (http://www.ncbi.him.nih.gov/gorf/gorf/gorf.html). The sequence assembly was performed using the Vector NTI Advance 10.0 software (Invitrogen). Genes, introns, exons and Table 1 Primers used in this study.

a

a

Primers

Sequences (50 ? 30 )

GH5F GH5R man5P1-F man5P1-R man5P1-PF

AAYAAYTGGGAYGAYTWYGGNGG GGYTCTYYNSCNATYTCCCANGC ATGAAGTTCTCCTTCCTCACCG CTAAACCCACCCCTGCTTCGC GGACTAGTGCCCTCAGCGCAAAGAAATTCGC

23 23 20 21 31

man5P1-PR

GAATGCGGCCGCCTAAACCCACCCCTGCTTCGC

33

Restriction sites incorporated into primers are underlined.

Size (bp)

The induced culture of rMan5P1 was centrifuged at 12,000g for 10 min at 4 °C to remove cell debris and undissolved materials. The cell-free supernatants were concentrated by ultrafiltration with Vivaflow 200 membrane of 5-kDa molecular weight cut-off (Vivascience, Göttingen, Germany), and loaded onto a HiTrap Q Sepharose XL 5 mL FPLC column (GE Healthcare, Uppsala, Sweden) which was equilibrated with 20 mM Tris–HCl (pH 7.0). Proteins were eluted using a linear gradient of NaCl (0–1.0 M) at a flow rate of 3.0 mL/min. Fractions showing the enzyme activity were pooled for characterisation. The purified enzyme was analysed by sodium dodecyl sulphate (SDS)–polyacrylamide gel electrophoresis (PAGE) (Laemmli, 1970). The protein concentration was measured by a Protein Assay Kit (Bio-Rad, Hercules, CA). The recombinant enzymes (1 lg) were deglycosylated by 500 U of endo-b-N-acetylglucosaminidase H (Endo H) at 37 °C for 2 h according to the manufacturer’s instruc-

H. Yang et al. / Food Chemistry 173 (2015) 283–289

tions (New England Biolabs, Ipswich, MA). The deglycosylated and untreated enzyme were analysed by SDS–PAGE. 2.7. Biochemical characterisation The glycosylated and deglycosylated rMan5P1 were subjected to enzyme characterisation. The optimal pH for the purified enzymes was determined at 50 °C for 10 min in the following buffers: 200 mM of glycine–HCl (pH 2.0–3.0), McIlvaine buffer (pH 3.0– 8.0), Tris–HCl (pH 8.0–9.0), and glycine-NaOH (pH 9.0–12.0). To estimate pH stability, the enzyme was pre-incubated in the buffers described above without substrate at 37 °C for 1 h or 6 h, and the residual activities were measured at 50 °C and optimal pH for 10 min. The temperature optimum was determined for 10 min at the optimal pH and 40, 50, 60, 70, 75, 80, 85, and 90 °C. The temperature stability was investigated after preincubation of the enzyme at optimal pH and 60 or 70 °C without substrate for various periods. The samples were collected at 0, 2, 5, 10, 20, 30, 60, 120, 180, 240, 300, and 360 min, respectively. The residual enzyme activities were determined under the standard conditions. The effects of various metal ions and chemical reagents on the enzymes of rMan5P1 were determined by incubating the enzyme in 0.5% (w/v) LBG solution containing 1 or 5 mM of various metal ions and chemical reagents (Na+, K+, Ca2+, Li+, Co2+, Cr3+, Ni2+, Cu2+, Mg2+, Fe3+, Mn2+, Pb2+, Ag+, EDTA, SDS or b-mercaptoethanol). The reaction system without any additive was treated as the blank control. The residual enzyme activity was determined as described above.

285

Man5F and Man5R. Sequence analysis indicated that the complete DNA sequence of Man5P1 consists of 1187 bp. One intron (683– 747 bp) interrupted the coding sequence. The cDNA sequence of man5P1 was 1122 bp in length. The predicted amino acid sequence of Man5P1 exhibited the highest identity of 100% with a putative GH 5 endo-1,4-b-mannosidase from N. fischeri NRRL 181 (GenBank: XP_001262744). Sequence alignment with other fungal b-mannanases revealed that Man5P1 represents a typical of GH 5 b-mannanases (Fig. 1). SignalP analysis indicated the presence of a putative signal peptide at residues 1–19 in Man5P1. The mature protein contains 373 residues with a pI value of 5.93 and a calculated molecular mass of 39.5 kDa. Further sequence analysis indicated that Man5P1 has two putative N-glycosylation sites and no Oglycosylation site. The two conserved catalytic residues, Glu192 and Glu299, are located at the C-terminal ends of b-strands 4 (acid/base) and 7 (nucleophile) of Man5P1, respectively (Henrissat & Davies, 1997). Corresponding to the known structures of GH 5 b-mannanases, five other conserved amino acid residues, Arg76, Asn191, His265, Tyr267, and Trp330, located in close proximity to the active site, were also identified in Man5P1(Hilge et al., 1998). 3.2. Expression and purification of recombinant Man5P1

The substrate specificity of rMan5P1 was determined by measuring the enzyme activity in McIlvaine buffer containing 0.5% of LBG, guar gum, konjac flour, pNPM, beechwood xylan, barely b-glucan or CMC-Na at pH 4.0 and 80 °C for 10 min. Km and Vmax values of rMan5P1 were determined in McIlvaine buffer (pH 4.0) containing 0.1–10 mg/mL LBG at 80 °C for 5 min. The experiments were carried out three times, and each experiment included triplicates. The data were calculated using the non-linear regression computer program GraFit (Biosoft, Cambridge, UK).

The cDNA fragment coding for mature Man5P1 without the signal peptide sequence was subcloned into the pPIC9 vector to construct the recombinant plasmid pPIC9-man5P1, which was transformed into P. pastoris GS115. A total of 100 transformants were selected for methanol induction at 30 °C for 72 h, and 48 positive transformants showed b-mannanase activities in the culture supernatants of shake tubes. Thansformant #36 with the highest activity of 101.5 U/mL in 1 L shaker flasks was selected for further purification and characterisation. The rMan5P1 in the culture supernatants was purified to electrophoretic homogeneity by a one-step anion exchange chromatography. The purified protein migrated one single band of 43.0 kDa, which was higher than its calculated molecular mass (Fig. 2). After deglycosylation with Endo H, rMan5P1 was about 40.0 kDa, which was in agreement with the calculated value. Nglycosylation occurs commonly in P. pastoris expression system (Skropeta, 2009), which may explain the weight gain of rMan5P1.

2.9. Analysis of hydrolysis products

3.3. Biochemical characterisation

The reaction containing 1 U of purified rMan5P1 and 0.5% (w/v) of LBG, konjac flour, or galactomannan of different Gal contents was incubated at pH 4.0 and 37 °C for 12 h. The reaction mixtures were centrifuged (10,000g, 4 °C, 10 min) through a 3-kDa Amicon Ultra centrifugal filter (Millipore, Billerica, MA) to remove the enzymes and substrates. The filtrates were then diluted 100 folds in ddH2O, and 25 lL of each sample was analysed using high-performance anion exchange chromatography (HPAEC; Thermo Fisher Scientific, Sunnyvale, CA) equipped with a Carbo-Pac PA200 column (3 lm  250 mm). NaOH (100 mM) was used to elute the oligosaccharides at the flow rate of 0.3 mL/min. Mannose, mannobiose, mannotriose, mannotetraose, mannopentaose, and mannohexaose were purchased from Megazyme as the standards.

Most fungal b-mannanases have a pH optimum of 1.5–6.0 (Moreira & Filho, 2008). The optimal pH of rMan5P1 was pH 4.0, and the recombinant enzyme retained more than 45.0% of the maximal activity in the pH range of 3.0–7.0 (Fig. 3A). This pH property was similar to that of other b-mannanases from thermophilic fungi, including T. arenaria (pH 4.5–5.5; Araujo & Ward, 1990), Phanerochaete chrysosporium (pH 4.0–6.0; Benech et al., 2007), Aspergillus niger BK01 (pH 4.5; Do et al., 2009), T. arenaria XZ7 (pH 5.0; Lu et al., 2013), and A. nidulans XZ3 (pH 5.0; Lu et al., 2014), but higher than that of acidic b-mannanases from Trichoderma reesei (pH 3.5; Stålbrand, Siika-aho, Tenkanen, & Viikari, 1993), Aspergillus sulphureus (pH 2.4; Chen, Cao, Ding, Lu, & Li, 2007), Bispora sp. MEY-1 (pH 1.5; Luo et al., 2009), and Phialophora sp. P13 (pH 1.5; Zhao et al., 2010). On the other hand, most fungal b-mannanases are inactive and unstable at pHs lower than 3.0 or higher than pH 8.0, but rMan5P1 displayed >20% activity at pH 2.0 or 9.0 (Fig. 3A). These results showed that rMan5P1 had adaptability over a broader pH range. Intriguingly, rMan5P1 displayed excellent pH stability (Fig. 3B). After 1-h incubation, rMan5P1 remained >65% of the initial activity at pH 2.0–12.0. When the incubation period was increased to 6 h, it was still stable in the pH range of 4.0–9.0. In addition, rMan5P1 also showed strong

2.8. Substrate specificity and kinetic parameters

3. Results and discussion 3.1. Gene cloning and sequence analysis N. fischeri P1 is a mannanase producer with the total b-mannanase activity of 15.6 ± 0.4 U/mL in the culture supernatants after 4-day growth in shake flasks. A 179-bp fragment was amplified from the genomic DNA of strain P1 using degenerate primers

286

H. Yang et al. / Food Chemistry 173 (2015) 283–289

Fig. 1. Amino acid sequence alignment of Man5P1 with four characterised GH 5 endo-b-1,4-b-mannanases using the ClustalW program. Sequences are as follows: MANN from Aspergillus sulphureus (ABC59553.1), Man5XZ7 from Thielavia arenaria (AGG69667.1), Man5C1 from Penicillium sp. C1 HC-2011 (AEV40667.1), and Auman5A from Aspergillus usamii (ADZ99027.1). Identical and similar residues are shaded in black and grey, respectively. The putative catalytic residues, N-glycosylation sites, and conserved amino acid residues are indicated by asterisks, number signs and ampersands, respectively.

Fig. 2. SDS–PAGE analysis of the purified recombinant Man5P1. Lanes: M, the standard protein molecular weight markers; 1, crude rMan5P1; 2 and 3, the purified rMan5P1; 4, the purified rManP1 after deglycosylation with Endo H.

resistance to pepsin and trypsin (data not shown). These favourable properties make rMan5P1 a good candidate for potential applications in the animal feed industry.

Most mesophilic b-mannanases have temperature optima of 40–75 °C, and only a few b-mannanases have optimal temperature of P80 °C, such as Man5XZ3 from A. nidulans XZ3 (80 °C, Lu et al., 2014), b-mannosidase from A. niger BK01 (80 °C, Do et al., 2009), and b-mannanase from Aspergillus aculeatus VN (80 °C, Pham, Berrin, Record, To, & Sigoillot, 2010). rMan5P1 showed similar thermophilic properties. It had an optimal temperature of 80 °C (Fig. 3C); even at 85 °C, it remained 80.9% of the activity. However, like most thermophilic b-mannanases, rMan5P1 was also only stable at temperatures of 60 °C and below after incubation for 6 h (Fig. 3D). At higher temperatures, rMan5P1 lost half of the activity at 70 °C for 10 min and completely inactivated at 80 °C for 10 min. This discrepancy between optimal temperature and thermostability has been found in many other thermophilic fungal b-mannanases and xylanses (Du et al., 2013). The reason might be that the presence of substrate could stabilise the enzyme conformation during optimal temperature assay; for the thermostability assay without substrate, the conformation of enzyme might be damaged or denatured, and consequently lose activity. The deglycosylated version of rMan5P1 had similar pH and temperature optima, pH stability, and thermostability as the wild-type glycosylated rMan5P1 (Fig. 3), but its activity was a little higher than that of rMan5P1 (24.5%data not shown). Various metal ions and chemical reagents were also investigated on their effects on the activity of rMan5P1 (Table 2). The presence of Fe3+, Cu2+, SDS, and EDTA partially inhibited the

287

120 100

rMan5P1

d-rMan5P1

80 60 40 20

B

120

Relative activity (%)

A Relative activity (%)

H. Yang et al. / Food Chemistry 173 (2015) 283–289

100

0

80 rMan5 P1 1 h

60

rMan5P1 6 h

40

d-rMan5P1 1 h

20 0

2

3

4

5

6

7

8

9

10

2

3

4

5

6

120 100

rMan5P1

7

8

9

10

11

12

pH

D 120

d-rMan5P1

Relative activity (%)

C Relative activity (%)

pH

80 60 40 20

100 80

rMan5P1 60 °C

60

rMan5P1 70 °C

40

d-rMan5P1 60°C

20

d-rMan5P1 70°C

0

0 40

50

60

70

80

90

0

1

2

3

4

5

6

Time (h)

Temperature (°C)

Fig. 3. Characterisation of the purified rMan5P1 and the deglycosylated rMan5P1 (d-rMan5P1). (A) Effect of pH on enzyme activity. (B) pH stability of enzymes. (C) Effect of temperature on enzyme activity. (D) Thermostability assay of enzymes. Each value in the panel represents the means ± SD (n = 3).

enzyme activities, but Ni2+, Mn2+, and b-mercaptoethanol enhanced the enzyme activities, respectively. b-Mercaptoethanol enhanced the enzymatic activities of most fungal b-mannanases, which could counteract the oxidation effects of the S–S linkage between cysteine residues. Ag+ has been reported to be a very strong inhibitor of most fungal b-mannanases (Chen et al., 2007; Lu et al., 2014), but the activity of rMan5P1 was only partially inhibited by Ag+ with almost half of the activity remaining at 5 mM. Furthermore, the addition of SDS could lead to the complete activity loss of most fungal b-mannanases but not rMan5P1. In the presence of 5 mM of SDS, 49.0% of the activity of rMan5P1 was

Table 2 Effects of metal ions and chemical reagents on the activity of purified recombinant rMan5P1. The activities of control reactions without any metal ions or chemical reagents are defined as 100%. Metal ions and chemicals

Control Li+ Na+ K+ Ag+ Ca2+ Cu2+ Co2+ Mn2+ Ni2+ Zn2+ Mg2+ Fe3+ EDTA SDS b-Mercaptoethanol

Relative activity (%)

a

1 mM

5 mM

100.0 ± 2.4 97.8 ± 3.8 98.2 ± 3.0 105.4 ± 3.4 101.8 ± 7.4 99.4 ± 1.8 79.0 ± 2.8 89.2 ± 2.4 112.6 ± 2.2 104.7 ± 5.8 91.8 ± 1.7 89.3 ± 1.3 79.9 ± 1.9 71.0 ± 0.4 57.8 ± 7.3 116.5 ± 8.6

100.0 ± 3.7 75.8 ± 2.5 96.5 ± 5.8 90.3 ± 7.6 46.2 ± 3.4 97.9 ± 7.9 72.9 ± 4.5 87.9 ± 3.7 103.6 ± 4.5 54.7 ± 2.7 87.9 ± 5.7 88.4 ± 1.2 89.9 ± 5.7 68.8 ± 4.8 49.0 ± 2.7 126.8 ± 1.8

a Values represent the means of triplicates relative to the untreated control samples.

retained. Thus, the high alkali and SDS tolerance could make rMan5P1 valuable in the detergent industries (Puchart et al., 2004). 3.4. Substrate specificity and kinetic parameters rMan5P1 exhibited the highest activity towards LBG (defined as 100%) and lower activities for konjac flour (61.5%) and guar gum (41.1%). No activity against pNPM, beechwood xylan, barely b-glucan, and CMC-Na was detected. These results showed rMan5P1 was highly active towards galactomannans (LBG, mannose: galactose 4:1; guar gum, mannose: galactose 2:1) and glucomannans (konjac flour, glucose: mannose 0.66:1) from different sources. Therefore, cellulase-free rMan5P1 with high activity and stability under neutral to alkaline conditions, good thermostability, and strong resistance to most metal ions may represent a good candidate in the pulp and paper bleaching process to replace toxic chlorine and hyperchlorite without decreasing the pulp viscosity (Chauhan et al., 2012). The kinetic parameters were also determined using LBG as the substrate. The Km and Vmax values were 0.83 ± 0.2 mg/mL and 1937.2 ± 28.7 lmol/min/mg. The specific activity of rMan5P1 was 1703.1 ± 101.2 U/mg, which is lower than that of MAN5A from Bispora sp. MEY-1 (3373 U/mg; Luo et al., 2009), and b-mannosidase from A. niger BK01 (2570 U/mg; Do et al., 2009), but significantly higher than that of Man5XZ7 from T. arenaria XZ7 (704.5 U/mg; Lu et al., 2013), MANN from A. sulphureus (366 U/mg; Chen et al., 2007), PpMan from A. fumigatus (350 U/mg; Duruksu et al., 2009), and Man5XZ3 from A. nidulans XZ3 (184.8 U/mg; Lu et al., 2014). 3.5. Analysis of hydrolysis products rMan5P1 showed activities on mannotriose, mannotetraose, mannopentaose, and mannohexaose, but not on mannobiose (data not shown). It suggested that rMan5P1 had no exo-activity and was a typical endo-acting b-mannanase.

288

H. Yang et al. / Food Chemistry 173 (2015) 283–289

Table 3 The hydrolysis products of various mannan polymers by purified recombinant Man5P1. Substrates (mannose/galactose ratio)

Hydrolysis products (%) Mannose

Mannobiose

Mannotriose

Mannotetraose

Galactose linkedmannotetraose

Galactomannan LBG (4:1) Guar gum (2:1) Galactomannan (21:79) Galactomannan (28:72) Galactomannan (38:62)

1.9 ± 0.2 2.1 ± 0.2 1.0 ± 0.1 1.7 ± 0.2 1.7 ± 0.2

44.8 ± 4.3 41.0 ± 2.1 46.6 ± 5.1 41.6 ± 3.1 27.5 ± 2.1

16.3 ± 1.4 16.5 ± 2.1 16.9 ± 1.5 16.1 ± 2.1 11.3 ± 1.1

0.3 ± 0.03 0.1 ± 0.01 0.2 ± 0.01 1.5 ± 0.1 0.2 ± 0.01

23.6 ± 1.6 22.4 ± 2.8 25.2 ± 3.3 29.2 ± 2.1 46.6 ± 6.5

Glucomannan Konjac flour (100:0)

0.6 ± 0.1

37.0 ± 3.5

6.0 ± 0.6

1.2 ± 0.1

NA

Mannopentose

Mannohexose

5.9 6.6 7.0 6.6 9.6

1.2 0.8 0.9 2.0 3.1

37.1

NA

NA: not detected.

The products formed upon hydrolysis of LBG and konjac flour were analysed, and rMan5P1 showed different cleavage patterns (Table 3). rMan5P1 had significant variations in the degradation ability to diverse mannans of different sources. Based on the amounts of hydrolysis products of different substrates, the hydrolysis degrees of rMan5P1 against various substrates are in the order of galactomannan (21% galactose) > galactomannan (28% galactose) > guar gum (33.3% galactose) > LBG (20% galactose) > konjac flour (0 galactose) > galactomannan (38% galactose). The results showed that rMan5P1 is more active to degrade galactomannan with a lower mannose/galactose ratio. The hydrolysis products of galactomannans (guar) and glucomannan (konjac flour) by rMan5P1 were different. Besides the main products mannobiose and mannotriose, rMan5P1 released galacto-mannotetraose (22.3–44.6%) from galactomannans and mannopentaose from glucomannan (37.1%), respectively. These results suggested that rMan5P1 could release linear and branched manno-oligosaccharides (MOS) of various lengths. It has been reported that the MOS has the ability to increase the populations of probiotic Bifidobacterium and Lactobacillus and to suppress or flush out the pathogenic bacteria (Dhawan & Kaur, 2007; Wu, Bryant, Voitle, & Roland, 2005). MOS as a prebiotic has positive effects on the growth performance, energy utilisation, nutrient digestibility and the intestinal microflora of chickens (Yamabhai, Sak-Ubol, Srila, & Haltrich, 2014; Yang et al., 2008). Thus, the high degree of production of MOS makes rMan5P1 a good candidate for its potential applications in the feed industry. 4. Conclusions In the present study, we identified a novel thermophilic b-mannanase in N. fischeri P1 and successfully expressed the gene product in P. pastoris. Overall, rMan5P1 exhibited optimum activity at pH 4.0 and 80 °C, and was highly active over a broad pH range from acidic to basic (2.0–9.0). It also had excellent stability over a wide pH range and good thermostability at 60 °C. All these favourable characters make rMan5P1 cost-effective for commercialisation and valuable in various biotechnological processes, especially in the feed and food industries. Acknowledgements This research was supported by the National High Technology Research and Development Program of China (2012AA022208) and the National Science Foundation for Distinguished Young Scholars of China (31225026) and the National Science and Technology Support Program (2013BAD10B01-2) and China Modern Agriculture Research System (CARS-42).

References Araujo, A., & Ward, O. P. (1990). Extracellular mannanases and galactanases from selected fungi. Journal of Industrial Microbiology, 6, 171–178. Benech, R. O., Li, X., Patton, D., Powlowski, J., Storms, R., Bourbonnais, R., Paice, M., & Tsang, A. (2007). Recombinant expression, characterization, and pulp prebleaching property of a Phanerochaete chrysosporium endo-b-1,4mannanase. Enzyme and Microbial Technology, 41, 740–747. Cao, Y., Yang, P., Shi, P., Wang, Y., Luo, H., Meng, K., Zhang, Z., Wu, N., Yao, B., & Fan, Y. (2007). Purification and characterization of a novel protease-resistant agalactosidase from Rhizopus sp. F78 ACCC30795. Enzyme and Microbial Technology, 41, 835–841. Chauhan, P. S., Puri, N., Sharma, P., & Gupta, N. (2012). Mannanases: Microbial sources, production, properties and potential biotechnological applications. Applied Microbiology and Biotechnology, 93, 1817–1830. Chen, X., Cao, Y., Ding, Y., Lu, W., & Li, D. (2007). Cloning, functional expression and characterization of Aspergillus sulphureus b-mannanase in Pichia pastoris. Journal of Biotechnology, 128, 452–461. Dhawan, S., & Kaur, J. (2007). Microbial mannanases: An overview of production and applications. Critical Reviews in Biotechnology, 27, 197–216. Do, B. C., Dang, T. T., Berrin, J. G., Haltrich, D., To, K. A., Sigoillot, J. C., & Yamabhai, M. (2009). Cloning, expression in Pichia pastoris, and characterization of a thermostable GH5 mannan endo-1,4-b-mannosidase from Aspergillus niger BK01. Microbial Cell Factories, 8, 59. Du, Y., Shi, P., Huang, H., Zhang, X., Luo, H., Wang, Y., & Yao, B. (2013). Characterization of three novel thermophilic xylanases from Humicola insolens Y1 with application potentials in the brewing industry. Bioresource Technology, 130, 161–167. Duruksu, G., Ozturk, B., Biely, P., Bakir, U., & Ogel, Z. B. (2009). Cloning, expression and characterization of endo-b-1,4-mannanase from Aspergillus fumigatus in Aspergillus sojae and Pichia pastoris. Biotechnology Progress, 25, 271–276. Henrissat, B., & Davies, G. (1997). Structural and sequence-based classification of glycoside hydrolases. Current Opinions in Structural Biology, 7, 637–644. Hilge, M., Gloor, S. M., Rypniewski, W., Sauer, O., Heightman, T. D., Zimmermann, W., Winterhalter, K., & Piontek, K. (1998). High-resolution native and complex structures of thermostable b-mannanase from Thermomonospora fusca – Substrate specificity in glycosyl hydrolase family 5. Structure, 6, 1433–1444. Katrolia, P., Yan, Q., Zhang, P., Zhou, P., Yang, S., & Jiang, Z. (2013). Gene cloning and enzymatic characterization of an alkali-tolerant endo-1,4-b-mannanase from Rhizomucor miehei. Journal of Agricultural and Food Chemistry, 61, 394–401. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685. Lu, H., Luo, H., Shi, P., Huang, H., Meng, K., Yang, P., & Yao, B. (2014). A novel thermophilic endo-b-1,4-mannanase from XZ3: Functional roles of carbohydrate-binding module and Thr/Ser-rich linker region. Applied Microbiology and Biotechnology, 98, 2155–2163. Lu, H., Zhang, H., Shi, P., Luo, H., Wang, Y., Yang, P., & Yao, B. (2013). A family 5 bmannanase from the thermophilic fungus Thielavia arenaria XZ7 with typical thermophilic enzyme features. Applied Microbiology and Biotechnology, 97, 8121–8128. Luo, H., Wang, K., Huang, H., Shi, P., Yang, P., & Yao, B. (2012). Gene cloning, expression, and biochemical characterization of an alkali-tolerant b-mannanase from Humicola insolens Y1. Journal of Industrial Microbiology and Biotechnology, 39, 547–555. Luo, H., Wang, Y., Wang, H., Yang, J., Yang, Y., Huang, H., Yang, P., Bai, Y., Shi, P., & Fan, Y. (2009). A novel highly acidic b-mannanase from the acidophilic fungus Bispora sp. MEY-1: Gene cloning and overexpression in Pichia pastoris. Applied Microbiology and Biotechnology, 82, 453–461. Maijala, P., Kango, N., Szijarto, N., & Viikari, L. (2012). Characterization of hemicellulases from thermophilic fungi. Antonie van Leeuwenhoek, 101, 905–917. Miller, G. L. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry, 31, 426–428.

H. Yang et al. / Food Chemistry 173 (2015) 283–289 Moreira, L., & Filho, E. (2008). An overview of mannan structure and mannandegrading enzyme systems. Applied Microbiology and Biotechnology, 79, 165–178. Pérez, J., Munoz-Dorado, J., de la Rubia, T., & Martinez, J. (2002). Biodegradation and biological treatments of cellulose, hemicellulose and lignin: An overview. International Microbiology, 5, 53–63. de O. Petkowicz, C. L., Reicher, F., Chanzy, H., Taravel, F., & Vuong, R. (2001). Linear mannan in the endosperm of Schizolobium amazonicum. Carbohydrate Polymers, 44, 107–112. Pham, T. A., Berrin, J. G., Record, E., To, K. A., & Sigoillot, J. C. (2010). Hydrolysis of softwood by Aspergillus mannanase: Role of a carbohydrate-binding module. Journal of Biotechnology, 148, 163–170. Puchart, V., Vršanská, M., Svoboda, P., Pohl, J., Ögel, Z. B., & Biely, P. (2004). Purification and characterization of two forms of endo-â-1,4-mannanase from a thermotolerant fungus, Aspergillus fumigatus IMI 385708 (formerly Thermomyces lanuginosus IMI 158749). Biochimica et Biophysica Acta (BBA)General Subjects, 1674, 239–250. Skropeta, D. (2009). The effect of individual N-glycans on enzyme activity. Bioorganic and Medicinal Chemistry, 17, 2645–2653. Stålbrand, H., Siika-aho, M., Tenkanen, M., & Viikari, L. (1993). Purification and characterization of two b-mannanases from Trichoderma reesei. Journal of Biotechnology, 29, 229–242.

289

Wang, C., Luo, H., Niu, C., Shi, P., Huang, H., Meng, K., Bai, Y., Wang, K., Hua, H., & Yao, B. (2014a). Biochemical characterization of a thermophilic b-mannanase from Talaromyces leycettanus JCM12802 with high specific activity. Applied Microbiology and Biotechnology. http://dx.doi.org/10.1007/s00253-014-5979-x. Wang, H., Shi, P., Luo, H., Huang, H., Yang, P., & Yao, B. (2014b). A thermophilic agalactosidase from Neosartorya fischeri P1 with high specific activity, broad substrate specificity and significant hydrolysis ability of soymilk. Bioresource Technology, 153, 361–364. Wu, G., Bryant, M., Voitle, R., & Roland, D. (2005). Effects of b-mannanase in cornsoy diets on commercial leghorns in second-cycle hens. Poultry Science, 84, 894–897. Yang, Y., Iji, P. A., Kocher, A., Thomson, E., Mikkelsen, L. L., & Choct, M. (2008). Effects of mannanoligosaccharide in broiler chicken diets on growth performance, energy utilisation, nutrient digestibility and intestinal microflora. British Poultry Science, 49, 186–194. Yamabhai, M., Sak-Ubol, S., Srila, W., & Haltrich, D. (2014). Mannan biotechnology: From biofuels to health. Critical Reviews in Biotechnology, 15, 1–11. Zhao, J., Shi, P., Luo, H., Yang, P., Zhao, H., Bai, Y., Huang, H., Wang, H., & Yao, B. (2010). An acidophilic and acid-stable b-mannanase from Phialophora sp. p13 with high mannan hydrolysis activity under simulated gastric conditions. Journal of Agricultural and Food Chemistry, 58, 3184–3190.