ABCC1 axis

Biomedicine & Pharmacotherapy 124 (2020) 109828

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

CircPVT1 contributes to chemotherapy resistance of lung adenocarcinoma through miR-145-5p/ABCC1 axis

T

Fushuang Zheng, Ran Xu* Department of Thoracic Surgery, Shengjing Hospital, China Medical University, Shenyang, Liaoning, China

ARTICLE INFO

ABSTRACT

Keywords: Lung adenocarcinoma Circular RNA CircPVT1 MiR-145-5p ABCC1 Chemotherapy resistance

Recently, increasing studies have confirmed some circRNAs were involved in the genesis of chemotherapy resistance in almost all kinds of malignant tumors, including lung adenocarcinoma (LAD). Nevertheless, the function and mechanism of circPVT1 in regulating chemotherapy resistance of LAD has not been elucidated so far. The current study found circPVT1 was highly expressed in LAD, which expression was positively related to N stage and chemotherapy insensitivity (cisplatin and pemetrexed) of LAD patients, and it was an independent prognostic biomarker for LAD patients. The circPVT1 expression was up-regulated in LAD tissues and cell line (A549/DR) resistant to cisplatin and pemetrexed. CircPVT1 knockdown sensitized A549/DR cells to cisplatin and pemetrexed. RNA pull-down assay et al. confirmed circPVT1 acted as a ceRNA for miR-145-5p in A549/DR cells. In addition, miR-145-5p was lowly expressed in cisplatin and pemetrexed resistant LAD tissues and cell line, and its over-expression also sensitized A549/DR cells to cisplatin and pemetrexed. The luciferase reporter assay et al. proved ABCC1 was a target gene of miR-145-5p in A549/DR cells. Moreover, miR-145-5p enhancement partly restored the effecting of circPVT1 knockdown on chemotherapy resistance in A549/DR cells, miR-145-5p/ABCC1 pathway mediated chemotherapy resistance induced by circPVT1 knockdown in LAD cells. In conclusion, the high-expression of circPVT1 is related with the cisplatin and pemetrexed insensitivity of LAD patients, circPVT1 contributes to cisplatin and pemetrexed chemotherapy resistance through miR-145-5p/ ABCC1 axis.

1. Introduction Lung cancer has the highest incidence and mortality in China and even in the world, about 85 % of them are non-small cell lung cancer (NSCLC) [1]. Lung adenocarcinoma (LAD) is the main pathological type of NSCLC, accounting for about 40 %. Chemotherapy is one of the main treatment methods for LAD, which can significantly improve the prognosis of patients with LAD [2]. Lung Cancer Guideline (NCCN.v2.2009) defined the application of cisplatin combined with pemetrexed in the first-line treatment of LAD. Recent study demonstrates that this chemotherapy protocol is more effective, less toxic and safer for LAD patients [3]. However, most of the LAD patients showed acquired drug resistance after receiving this chemotherapy protocol for 6–12 months, which led to disease progression. The mechanism of this acquired drug resistance has not been fully elucidated so far. Circular RNAs (circRNAs) are a kind of endogenous non coding RNAs, which are the research hotspot in life sciences field. Their closed ring structure protects circRNAs from the degradation of RNase and makes them more stable than linear RNAs. The expression level of

⁎

circRNAs was tissue-specific, spatiotemporal specific and disease-specific [4]. The biological functions of circRNAs are closely related to their cellular location. circRNAs located in the cytoplasm are mainly combined with microRNAs as competitive endogenous RNA (ceRNA), to relieve the negative regulatory effects of microRNAs on the expression of target mRNAs, that is the sponge adsorption of circRNAs for microRNAs [5,6]. Recent studies confirm that circRNAs are closely related to the genesis and development of various diseases, including malignant tumors, as well as treatment and prognosis, and are the potential molecular biomarkers and intervention targets for clinical diagnosis, treatment and prognosis [7,8]. For example, circPLEKHM3 acted as a tumorsuppressor gene to restrain proliferation and migration through miR-9/ BRCA1/DNAJB6/KLF4/AKT1 axis in ovarian cancer, and could be a prognosis biomarker for patients with ovarian cancer [9]. Our previous study found that circRNA CDR1-AS was high-expressed in LAD and was an independent prognostic biomarker for LAD patients [10]. CircRNA circPVT1 derived from the PVT1 gene locus, which located at 8q24. Till now, about 10 literatures reported circPVT1 was highly

Corresponding author at: Department of Thoracic Surgery, Shengjing Hospital, No. 39 Huaxiang Road, Tiexi District, Shenyang, 110022, China. E-mail address: [email protected] (R. Xu).

https://doi.org/10.1016/j.biopha.2020.109828 Received 18 December 2019; Received in revised form 1 January 2020; Accepted 10 January 2020 0753-3322/ © 2020 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 124 (2020) 109828

F. Zheng and R. Xu

expressed and works as an oncogene in esophageal carcinoma, hepatocellular carcinoma, gastric cancer and so on [11–15]. Qin S and Li X found circPVT1 was upregulated in NSCLC and could inhibit the malignant biological behaviors of NSCLC cells [16,17]. Moreover, Liu YY et al. discovered that circPVT1 contributed to chemotherapy resistance of gastric cancer cells to paclitaxel via miR-124-3p/ZEB1 pathway [18]. However, it is not known whether circPVT1 is involved in chemotherapy resistance of lung cancer, especially in LAD. Our earlier transcriptome sequencing found the high-expression of circPVT1 in LAD tissues. In the current study, the function and mechanisms of circPVT1 in regulating chemotherapy resistance of LAD will be clarified.

Table 1 The primers for qRT-PCR. Genes

Primers

Sequences

circPVT1

Forward Reward Forward Reward Forward Reward Anchor RT primer

CGACTCTTCCTGGTGAAGCATCTGAT TACTTGAACGAAGCTCCATGCAGC CGCTCTGGGACTGGAATGT ACCCACACTGAGGTTGGTTA GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC CGACTCGATCCAGTCTCAGGGTCCGAGGTATT CGATCGAGTCGCACTTTTTTTTTTTTV TCCCTAAGGACCCTTTTGACC AGTCTCAGGGTCCGAGGTATTC CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT

ABCC1 GAPDH miR-145

U6

2. Material and methods 2.1. Clinical specimens

Forward Reward Forward Reward

The miR-145-5p agonist and negative control (agomiR-145-5p and agomiR-NC) as well as the agomiR-NC antagonist and negative control (antagomiR-145-5p and antagomiR-NC) were designed and synthesized by GenePharma (Shanghai, China). Lipofectamine™ 3000 (Thermo Fisher Scientific, Waltham, MA, USA) was applied to transfect plasmids into A549/DR cells according to manufacturer’s instructions.

104 cases of LAD and corresponding normal lung tissues (NLT) specimens were obtained from the tumor case bank of Shengjing Hospital, which was achieved through percutaneous lung biopsy or bronchoscopic biopsy between October 2012 to February 2014. The inclusive criteria of patients was that all specimens were diagnosed as LAD by two pathologists, and all LAD patients were untreated before definite diagnosis. The exclusive criteria was that the patient suffered from other diseases including other tumors, or the pathological data were incomplete. After diagnosis, 57 cases of LAD patients were treated with neoadjuvant chemotherapy (cisplatin and pemetrexed). After 2∼3 courses of chemotherapy, chest enhanced CT and serum tumor biomarkers were examined. According to the changes of tumor size and the level of serum tumor markers, 57 patients were divided into sensitive group (n = 39) and insensitive group (n = 18).

2.6. Chemotherapy drugs sensitivity detection 5 × 103 cells were seed in a well of a 96-well plate; new culture medium with cisplatin (5 μg/ml, 10 μg/ml, 20 μg/ml, 50 μg/ml and 75 μg/ml) or pemetrexed (0.5 μg/ml, 1 μg/ml, 5 μg/ml, 10 μg/ml, 20 μg/ ml and 50 μg/ml) (Sigma-Aldrich, St. Louis, MO, USA) was added to replace old culture medium 6 h later [10]. After 24 h, the cell viability was examined using Cell Counting Kit-8 (MedChemExpress, Monmouth Junction, NJ, USA), and the IC50 was calculated according to our previous studies [19].

2.2. Cell lines and culture

2.7. RNA pull-down assay

Human pulmonary alveolar epithelial cells (PAEC) and human LAD PC9 and A549 cell lines were stored in our laboratory. A549/DR cell line was established previously and stored in our laboratory, which was resistant to cisplatin and pemetrexed (their resistance indexes were 4.49 and 6.21) [1°]. All cells were cultured in a medium containing 10 % fetal bovine serum (Genetimes, Shanghai, China) under the conditions of constant temperature incubator (37 C, 5 % CO2).

The biotinylated wild-type and mutant probes for circPVT1 (biocircPVT1-W and bio-circPVT1-M) as well as the biotinylated wild-type and mutant probes for miR-145-5p (bio-miR145-5p-W and bio-miR1455p-W) were designed and synthetized by GenePharma. The RNA pulldown assay was applied all according to previous literature [20]. 2.8. Luciferase reporter gene assay

2.3. Transcriptome sequencing The extraction, purification and identification of RNA were applied all according to our previous studies [19]. RNA library construction was performed by CloudSeq (Shanghai, China). The HiSeq 4000 Sequencing system (Illumina, Shenzhen, Guangdong, China) was applied to complete circRNA sequencing.

The ABCC1 3′-UTR wild-type and mutant luciferase reporter plasmids (p-ABCC1-W and p-ABCC1-M) were designed and synthesized by GenePharma. MicroRNAs and plasmids were cotransfected using Lipofectamine™ 3000. 48 h later, the luciferase activity was detected using Dual Luciferase Reporter Gene Assay Kit (Beyotime, Shanghai, China) according to previous literature [21].

2.4. Real-time quantitative PCR (qRT-PCR)

2.9. Western blotting

The methods of RNA extraction, purification and identification were the same as transcriptome sequencing. SYBR RT-PCR Kit (Takara, Dalian, Liaoning, China) was used to qualify the expression level of circPVT1, miR-145-5p and ABCC1 according to manufacturer’s instructions. The sequences of primers were listed in Table 1. The relative expression level of circPVT1, miR-145-5p and ABCC1 was calculated as 2−ΔΔCT method after normalization with reference to expression of GAPDH and U6.

The protein extraction and western blotting of ABCC1 protein were applied all according to our previous studies [10,19]. The ABCC1 and GAPDH antibody (ab32574 and ab181602) were purchased from Abcam (Cambridge, MA, USA). The relative expression of ABCC1 protein was analyzed with Image J software (NIH, Bethesda, MD, USA). 2.10. Statistical analysis The data in this study was analyzed using Graphpad prism 5 (GraphPad Software, San Diego, CA, USA). The difference comparison was analyzed by one-way ANOVA, Student’s t-test and Chi-square test. The survival rate was calculated with Kaplan-Meier method with the log-rank test for comparisons. Variables with a value of P < 0.05 in the

2.5. Cells transfection CircPVT1 silence plasmid (sh-circPVT1) and negative control plasmid (sh-NC) were constructed by GeneChem (Shanghai, China). 2

Biomedicine & Pharmacotherapy 124 (2020) 109828

F. Zheng and R. Xu

Fig. 1. CircPVT1 was highly expressed in LAD. (A) Top ten high-expressed circRNAs in LAD compared with NLT specimens analyzed by transcriptome sequencing (n = 4). (B) The expression of circPVT1 was up-regulated in LAD compared with NLT (n = 104). * P < 0.05 vs. NLT. (C) The expression of circPVT1 was up-regulated in PC9 and A549 cells in comparison with PAEC cells. * P < 0.05 vs. PAEC cells. (D) Kaplan-Meier analysis exhibited that LAD patients with high circPVT1 expression showed a shorter survival time than those with low circPVT1 expression. * P < 0.05.

univariate analysis were included in the subsequent multivariate analysis based on the Cox proportional hazards model. A P value of less than 0.05 was considered to be statistically significant.

Table 2 The correlation between circPVT1 expression and clinical pathological characteristics of 104 LUAD patients. Characteristics

3. Results 3.1. CircPVT1 was highly expressed in LAD

Age ＜63 ≥63 Gender Male Female Smoking history No Yes T stage T1 T2 T3-T4 N stage N0 N1 N2-N3 M stage M0 M1 Neoadjuvant chemotherapy Sensitive Insensitive

Firstly, transcriptome sequencing was applied to screen the differentially expressed circRNAs between NLT and LAD specimens, which showed circPVT1 had an over sixfold up-regulation in LAD specimens (Fig. 1A). Secondly, the high-expression of circPVT1 in 104 cases of LAD specimens was confirmed using qRT-PCR assay (Fig. 1B, P < 0.05). Thirdly, the circPVT1 expression in PC9 and A549 cells was much higher than that in PAEC cells (Fig. 1C, P < 0.05). All LAD patients were divided into low expression group (n = 56) and high expression group (n = 48) according to the average value of relative circPVT1 expression. The statistical analysis results showed that the circPVT1 expression had a close correlation with N stage and chemotherapy insensitivity (cisplatin and pemetrexed) of LAD patients (Table 2, P < 0.05). 3.2. CircPVT1 was an independent prognostic biomarker for LAD patients The 5 year over survival rate (OS) in low or high circPVT1 expression group were 53.57 % and 33.33 % respectively, and the KaplanMeier analysis found LAD patients with higher circPVT1 expression showed a shorter survival time than those with lower circPVT1 expression (Fig. 1D, P < 0.05). Moreover, Cox regression analysis exhibited that circPVT1 expression was an independent prognostic biomarker for LAD patients (Table 3).

* P < 0.05.

3

Case number

Relative circPVT1 expression Low

High

P value

52 52

31 25

21 27

0.238

37 67

20 36

17 31

0.975

84 20

44 12

40 8

0.539

31 59 14

19 32 5

12 27 9

0.279

47 36 21

32 16 8

15 20 13

0.027 *

101 3

55 1

46 2

0.469

39 18

27 7

12 11

0.030 *

Biomedicine & Pharmacotherapy 124 (2020) 109828

F. Zheng and R. Xu

3.4. CircPVT1 acted as a ceRNA for miR-145-5p in A549/DR cells

Table 3 The influence of the circPVT1 expression and clinical pathological characteristics on OS in LUAD patients. Characteristics

Univariate analysis

Firstly, the online bioinformatics software (circular RNA interactome) predicted that circPVT1 serve a specific binding site for miR145-5p (Fig. 3A). Secondly, RNA pull-down assay verified circPVT1 was combined with bio-miR145-W probe but not bio-miR145-M probe (Fig. 3B); miR-145-5p was specifically combined with bio-circPVT1-W probe correspondingly (Fig. 3C). Thirdly, knockdown of circPVT1 decreased ABCC1 protein expression (Fig. 3D), which was a target gene of miR-145-5p. These founding elucidated circPVT1 could act as a ceRNA for miR-145-5p in A549/DR cells.

Multivariate analysis

HR

95 % CI

P value

T stage

1.746

0.451

N stage

1.534

The circPVT1 expression

1.679

0.9622.815 0.8562.752 1.0652.638

HR

95 % CI

P value

3.376

1.4415.914

0.005*

0.152 0.025*

* P < 0.05.

3.5. MiR-145-5p sensitized A549/DR cells to cisplatin and pemetrexed

3.3. Knockdown of circPVT1 sensitized A549/DR cells to cisplatin and pemetrexed

MiR-145-5p was low-expressed in insensitive group LUAD patients compared with those sensitive group LUAD patients (Fig. 4A, P < 0.05). Moreover, the expression of miR-145-5p in A549/DR cells was much lower than that in A549 cells (Fig. 4B, P < 0.05). The 5 year over survival rate (OS) in low or high miR-145-5p expression group were 32.00 % and 55.55 % respectively, and the Kaplan-Meier analysis found LAD patients with lower miR-145-5p expression showed a shorter survival time than those with higher miR-145-5p expression (Fig. 4C, P < 0.05). AgomiR-145-5p was transfected into A549/DR cells to up-regulate the expression of miR-145-5p. Over-expression of miR-145-5p inhibited the IC50 of cisplatin from 47.24 ± 5.35 μg/ml to 16.37 ± 3.92 μg/ml (Fig. 4D, P < 0.05), and also decreased the IC50 of pemetrexed from 14.09 ± 1.27 μg/ml to 5.64 ± 0.87 μg/ml in A549/DR cells (Fig. 4E, P < 0.05), which certified that miR-145-5p over-expression increased sensitivity of A549/DR cells to cisplatin and pemetrexed.

The expression of circPVT1 in insensitive group LAD patients was much higher than that in sensitive group LAD patients (Fig. 2A, P < 0.05). Moreover, circPVT1 was highly expressed in A549/DR cells compared with that in A549 cells (Fig. 2B, P < 0.05). To clarify the function of circPVT1 on cisplatin and pemetrexed resistance, sh-circPVT1 transfection knockdown the expression of circPVT1 in A549/DR cells (Fig. 2C, P < 0.05). Knockdown of circPVT1 reduced the IC50 of cisplatin from 45.33 ± 4.15 μg/ml to 17.24 ± 2.68 μg/ml (Fig. 2D, P < 0.05), and also decreased the IC50 of pemetrexed from 12.74 ± 1.35 μg/ml to 5.16 ± 0.82 μg/ml in A549/DR cells (Fig. 2E, P < 0.05), which certified that circPVT1 knockdown increased cisplatin and pemetrexed sensitivity in A549/DR cells.

Fig. 2. Knockdown of circPVT1 sensitized A549/DR cells to cisplatin and pemetrexed. (A) circPVT1 was highly expressed in insensitive group LAD patients (n = 18) compared with sensitive group LAD patients (n = 39). * P < 0.05 vs. sensitive group. (B) circPVT1 was highly expressed in A549/DR cells compared with that in A549 cells. * P < 0.05 vs. A549 cells. (C) Transfection of sh-circPVT1 knockdown the expression of circPVT1 in A549/DR cells. * P < 0.05 vs. sh-NC group. (D&E) Knockdown of circPVT1 reduced IC50 of cisplatin and pemetrexed in A549/DR cells. * P < 0.05 vs. sh-NC group. 4

Biomedicine & Pharmacotherapy 124 (2020) 109828

F. Zheng and R. Xu

Fig. 3. CircPVT1 acted as a ceRNA for miR-145-5p in A549/DR cells. (A) The specific binding site of circPVT1 for miR-145-5p. (B) Detection of circPVT1 using qRTPCR in the sample pulled down by biotinylated miR-145-5p probe. * P < 0.05 vs. bio-NC group. (C) Detection of miR-145-5p using qRT-PCR in the sample pulled down by biotinylated circPVT1 probe. * P < 0.05 vs. bio-NC group. (D) Knockdown of circPVT1 decreased the protein expression of ABCC1. * P < 0.05 vs. sh-NC group.

Fig. 4. MiR-145-5p sensitized A549/DR cells to cisplatin and pemetrexed. (A) MiR-145-5p was down-regulated in insensitive group LUAD patients (n=18) compared with those sensitive group LUAD patients (n=39). * P < 0.05 vs. sensitive group. (B) MiR-145-5p was lowly expressed in A549/DR cells compared with that in A549 cells. * P < 0.05 vs. A549 cells. (C) Kaplan-Meier analysis exhibited that LAD patients with low miR-145-5p expression showed a shorter survival time than those with high miR-145-5p expression. * P < 0.05. (D&E) Over-expression of miR-145-5p inhibited the IC50 of cisplatin and pemetrexed in A549/DR cells. * P < 0.05 vs. agomiR-NC group.

3.6. ABCC1 was a target gene of miR-145-5p in A549/DR cells

0.7857, P < 0.001). In addition, the expression of ABCC1 in A549/DR cells was much higher than that in A549 cells (Fig. 5D, P < 0.05). The 5 year over survival rate (OS) in low or high ABCC1 expression group were 56.60 % and 31.37 % respectively, and the Kaplan-Meier analysis found LAD patients with higher ABCC1 expression showed a shorter survival time than those with lower ABCC1 expression (Fig. 5E, P < 0.05). A potential binding sites for miR-145-5p in ABCC1 3′-UTR was

ABCC1 was highly expressed in insensitive group LAD patients compared with those sensitive group LAD patients (Fig. 5A, P < 0.05). A negative correlation between miR-145 and ABCC1 was confirmed by the co-expression patterns analysis in 57 LAD patients with neoadjuvant chemotherapy (Fig. 5B, r=-0.7323, P < 0.001). On the contrary, there was a positive correlation between circPVT1 and ABCC1 (Fig. 5C, r = 5

Biomedicine & Pharmacotherapy 124 (2020) 109828

F. Zheng and R. Xu

Fig. 5. ABCC1 was a target gene of miR-145-5p in A549/DR cells. (A) ABCC1 was highly expressed in insensitive group LAD patients (n=18) compared with sensitive group LAD patients (n=39). * P < 0.05 vs. sensitive group. (B) the co-expression patterns analysis showed a negative correlation between miR-145 and ABCC1 in 57 cases of LAD patients with neoadjuvant chemotherapy. (C) the co-expression patterns analysis showed a positive correlation between circPVT1 and ABCC1 in 57 cases of LAD patients with neoadjuvant chemotherapy. (D) Kaplan-Meier analysis exhibited that LAD patients with high ABCC1 expression showed a shorter survival time than those with low ABCC1 expression. * P < 0.05. (E) ABCC1 was highly expressed in A549/DR cells compared with that in A549 cells. * P < 0.05 vs. A549 cells. (F) The binding site of miR-145-5p in the 3’ UTR of ABCC1. (G) MiR-145-5p inhibited the relative luciferase activity by combining with wild-type binding site of ABCC1, but not to mutant binding site. (H) MiR-145-5p negatively regulated the expression of ABCC1 protein in A549/DR cells. * P < 0.05 vs. agomiR-NC group, # P < 0.05 vs. antagomiR-NC group.

predicted by TargetScan 7.2 software (Fig. 5F). Luciferase reporter assay proved miR-145-5p could specifically combine with wild-type binding site to restrain the luciferase activity (Fig. 5G, P < 0.05). And, miR-145-5p over-expression inhibited ABCC1 protein expression in A549/DR cells, miR-145-5p silence showed the opposite effect (Fig. 5H, P < 0.05). To sum up, ABCC1 was a target gene of miR-145-5p.

P < 0.05), and IC50 of pemetrexed increased from 5.46 ± 0.91 μg/ml to 10.28 ± 0.94 μg/ml in A549/DR cells (Fig. 6B, P < 0.05). Furthermore, co-transfecion with sh-circPVT1 and antagomiR-145-5p led to an obvious increase of ABCC1 protein expressions in A549/DR cells (Fig. 6C, P < 0.05). In brief, these founding indicated that circPVT1 contributed to cisplatin and pemetrexed resistance through miR-145-5p/ABCC1 axis in chemo-resistant LAD cells.

3.7. Knockdown of circPVT1 sensitized A549/DR cells to cisplatin and pemetrexed through miR-145-5p/ABCC1 axis

4. Discussion

To determine whether circPVT1 mediated chemotherapy resistance of A549/DR Cells through miR-145-5p/ABCC1 axis, A549/DR cells were co-transfected with sh-circPVT1 and antagomiR-145-5p or antagomiR-NC. While combined using sh-circPVT1 and antagomiR-145-5p, A549/ DR cells showed lower sensitivity to cisplatin and pemetrexed compared with sh-circPVT1 and antagomiR-NC group. The IC50 of cisplatin increased from 17.84 ± 3.17 μg/ml to 34.26 ± 4.11 μg/ml (Fig. 6A,

In the past, the research on circRNAs mainly focused on their relationship with the genesis and development of malignant tumors, and believed that circRNAs can participate in the regulation of malignant biological behaviors of tumor cells [22,23]. At present, more and more scholars paid attention to the relationship between circRNAs and the sensitivity of cancer treatment, including radiotherapy and chemotherapy [24,25]. Although the research in this field is still in its 6

Biomedicine & Pharmacotherapy 124 (2020) 109828

F. Zheng and R. Xu

Fig. 6. Knockdown of circPVT1 sensitized A549/DR cells to cisplatin and pemetrexed through miR-145-5p/ABCC1 axis. (A&B) The IC50 of cisplatin and pemetrexed in sh-circPVT1 + antagomiR-145-5p group A549/DR was higher than those in sh-NC + antagomiR-NC group A549/DR cells. * P < 0.05 vs sh-NC + antagomiR-NC group, # P < 0.05 vs sh-circPVT1 + antagomiR-NC group. (C) The co-transfecion with sh-circPVT1 and antagomiR-145-5p increased of ABCC1 expressions in A549/ DR cells * P < 0.05 vs sh-NC + antagomiR-NC group, # P < 0.05 vs sh-circPVT1 + antagomiR-NC group.

effects of circPVT1 on chemotherapy resistance in LAD. As everyone knows, some microRNAs silenced their target genes to exert their biological functions [36,21], therefore miR-145-5p might modulate chemotherapy resistance through silencing its target gene. Afterwards, a series of gain-of-function experiments, including western blotting and luciferase reporter assay, proved ABCC1 gene was a target gene of miR-145-5p. ABCC1, formerly named MRP1, belongs to a ATPbinding cassette (ABC) transporter superfamily, is a classic multidrug resistance related gene. ABCC1 protein mediates substance transport in and out of cells, and can exclude chemotherapeutic drugs from the cell before they work. More and more studies reported ABCC1 participated in the genesis of chemotherapy resistance in almost all malignant tumors, including LAD [37–39]. These findings give us a nice enlightenment, accordingly, we speculated that circPVT1 might promote chemotherapy resistance of LAD through miR-145-5p/ABCC1 axis. Follow up experiments verified this hypothesis, miR-145-5p enhancement partly restored the effecting of circPVT1 silence on chemotherapy resistance in A549/DR cells, miR145-5p/ABCC1 pathway mediated chemotherapy resistance induced by circPVT1 knockdown in LAD cells.

infancy, it is of great significance for the precise treatment of clinical malignant tumors. Recently, increasing studies had confirmed that some circRNAs, such as circ-101505 and circHIPK3, were involved in the genesis of chemotherapy resistance of malignant tumors [26,27]. However, were are few studies on the relationship between circRNAs and chemotherapy resistance of lung cancer [28,29]. Huang MS reported that circ-0001946 mediated cisplatin sensitivity through nucleotide excision repair pathway in NSCLC [30]. Our previous study found that CDR1-AS promoted cisplatin and pemetrexed resistance through EGFR/PI3K pathway in LAD [10]. However, it is not known whether circPVT1 is involved in chemotherapy resistance of lung cancer, especially in LAD. In our study, transcriptome sequencing found circPVT1 was highly expressed in LAD, and its high-expression in LAD tissues and cell lines was confirmed using qRT-PCR. Besides, high-expression of circPVT1 was correlated with N stage and chemotherapy resistance (cisplatin and pemetrexed) of LAD patients. These results were consistent with the previous studies in NSCLC reported by Qin S and Li X et al. [16,17]. Those findings suggested that circPVT1 might play an oncogene role in LAD. Moreover, circPVT1 could predict poor prognosis of LAD patients and was an independent prognostic biomarker for LAD, which could offer guidance for the early clinical diagnosis and treatment of LAD. Given the close relationship between the high-expression of circPVT1 and chemotherapy resistance of LAD patients, the subsequent experiments confirmed that circPVT1 was high-expressed in cisplatin and pemetrexed-resistant LAD tissues and cell lines. These further clarified that circPVT1 participated in chemotherapy resistance of LAD. Therefore, the impacts of circPVT1 on cisplatin and pemetrexed sensitivity in LAD were examined through the loss of function assay. The results showed knockdown of circPVT1 reduced IC50 of cisplatin and pemetrexed in chemo-resistant LAD cell line, which showed knockdown of circPVT1 re-sensitized chemo-resistant LAD cell line to cisplatin and pemetrexed. However, the underlying mechanism is unclear. It is well-known that some circRNA molecules are rich in microRNA binding sites and can act as ceRNAs to adsorb microRNAs [31,32]. For instance, circABCC2 sponged miR-665 to advance cell proliferation and invasion in hepatocellular cancer [33]. The online bioinformatic analysis predicted the targeted binding between circPVT1 and miR-145-5p. RNA pull-down assay and other experiments confirmed circPVT1 could act as a ceRNA for miR-145-5p in A549/DR cells. Wang Z et al. demonstrated circPVT1 could sponge miR-145 to promote metastasis of colorectal cancer cells [34], which strongly supported the findings of this study. Further research found miR-145-5p was down-regulated in LAD tissues and cell lines resistant to cisplatin and pemetrexed, and overexpression of miR-145-5p sensitized A549/DR cells to cisplatin and pemetrexed. Pan Y et al. reported that miR-145 could improve the docetaxel sensitivity of LAD cells through targeted silencing FSCN1 gene [35]. On these grounds, miR-124-5p mediated the regulatory

5. Conclusions The circPVT1 is high-expressed in LAD and is an independent prognostic biomarker for LAD patients. The high-expression of circPVT1 is related with the cisplatin and pemetrexed insensitivity of LAD patients, circPVT1 contributes to cisplatin and pemetrexed chemotherapy resistance through miR-145-5p/ABCC1 axis. This study helps to expound the mechanism of chemotherapy resistance in LAD, and may offer a therapeutic target for LAD. Funding This study was funded by National Nature Science Foundation of China (81872067) and Doctoral Research Initiation Foundation of Liaoning Province (201601121). Ethical approval This study were approved by the Medical Ethics Committee of Shengjing Hospital, and all patients were informed and signed informed consent. Declaration of Competing Interest The authors have declared that no competing interest exists. 7

Biomedicine & Pharmacotherapy 124 (2020) 109828

F. Zheng and R. Xu

Appendix A. Supplementary data [19]

Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2020.109828.

[20]

References [21]

[1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, 2018, CA Cancer J. Clin. 68 (2018) 7–30. [2] T. Ye, L. Deng, J. Xiang, Y. Zhang, H. Hu, Y. Sun, Y. Li, L. Shen, S. Wang, L. Xie, H. Chen, Predictors of pathologic tumor invasion and prognosis for ground glass opacity featured lung adenocarcinoma, Ann. Thorac. Surg. 106 (2018) 1682–1690. [3] M. Kreuter, J. Vansteenkiste, J.R. Fischer, W.E. Eberhardt, H. Zabeck, J. Kollmeier, M. Serke, N. Frickhofen, M. Reck, W. Engel-Riedel, S. Neumann, M. Thomeer, C. Schumann, P. De Leyn, T. Graeter, G. Stamatis, F. Griesinger, M. ThomasM, TREAT investigators, three-year follow-up of a randomized Phase II Trial on refinement of early-stage NSCLC adjuvant chemotherapy with cisplatin and pemetrexed versus cisplatin and vinorelbine (the TREAT Study), J. Thorac. Oncol. 11 (2016) 85–93. [4] I.L. Patop, S. Wüst, S. Kadener, Past, present, and future of circRNAs, EMBO J. 38 (2019) e100836. [5] X. Zhao, Y. Cai, J. Xu, Circular RNAs: biogenesis, mechanism, and function in human cancers, Int. J. Mol. Sci. 20 (2019) pii: E3926. [6] C. Braicu, A.A. Zimta, A. Harangus, I. Iurca, A. Irimie, O. Coza, I. Berindan-Neagoe, The Function of non-coding RNAs in lung cancer tumorigenesis, Cancers (Basel) 11 (2019) pii: E605. [7] Y. Yin, J. Long, Q. He, Y. Li, Y. Liao, P. He, W. Zhu, Emerging roles of circRNA in formation and progression of cancer, J. Cancer 10 (2019) 5015–5021. [8] B. Pan, J. Qin, X. Liu, B. He, X. Wang, Y. Pan, H. Sun, T. Xu, M. Xu, X. Chen, X. Xu, K. Zeng, L. Sun, S. Wang, Identification of serum exosomal hsa-circ-0004771 as a novel diagnostic biomarker of colorectal cancer, Front. Genet. 10 (2019) 1096. [9] L. Zhang, Q. Zhou, Q. Qiu, L. Hou, M. Wu, J. Li, X. Li, B. Lu, X. Cheng, P. Liu, W. Lu, Y. Lu, CircPLEKHM3 acts as a tumor suppressor through regulation of the miR-9/ BRCA1/DNAJB6/KLF4/AKT1 axis in ovarian cancer, Mol. Cancer 18 (2019) 144. [10] Y. Mao, R. Xu, Circular RNA CDR1-AS contributes to cisplatin and pemetrexed chemoresistance through EGFR/PI3K signaling pathway in lung adenocarcinoma, Biomed. Pharmacother. (2020), https://doi.org/10.1016/j.biopha.2019.109771. [11] J. Chen, Y. Li, Q. Zheng, C. Bao, J. He, B. Chen, D. Lyu, B. Zheng, Y. Xu, Z. Long, Y. Zhou, H. Zhu, Y. Wang, X. He, Y. Shi, S. Huang, Circular RNA profile identifies circPVT1 as a proliferative factor and prognostic marker in gastric cancer, Cancer Lett. 388 (2017) 208–219. [12] L. Verduci, M. Ferraiuolo, A. Sacconi, F. Ganci, J. Vitale, T. Colombo, P. Paci, S. Strano, G. Macino, N. Rajewsky, G. Blandino, The oncogenic role of circPVT1 in head and neck squamous cell carcinoma is mediated through the mutant p53/YAP/ TEAD transcription-competent complex, Genome Biol. 18 (2017) 237. [13] Y. Zhu, Y. Liu, B. Xiao, H. Cai, M. Liu, L. Ma, H. Yin, F. Wang, The circular RNA PVT1/miR-203/HOXD3 pathway promotes the progression of human hepatocellular carcinoma, Biol. Open 8 (2019) pii: bio043687. [14] R. Zhong, Z. Chen, T. Mo, Z. Li, P. Zhang, Potential Role of circPVT1 as a proliferative factor and treatment target in esophageal carcinoma, Cancer Cell Int. 19 (2019) 267. [15] T. He, X. Li, D. Xie, L. Tian, Overexpressed circPVT1 in oral squamous cell carcinoma promotes proliferation by serving as a miRNA sponge, Mol. Med. Rep. 20 (2019) 3509–3518. [16] S. Qin, Y. Zhao, G. Lim, H. Lin, X. Zhang, X. Zhang, Circular RNA PVT1 acts as a competing endogenous RNA for miR-497 in promoting non-small cell lung cancer progression, Biomed. Pharmacother. 111 (2019) 244–250. [17] X. Li, Z. Zhang, H. Jiang, Q. Li, R. Wang, H. Pan, Y. Niu, F. Liu, H. Gu, X. Fan, J. Gao, Circular RNA circPVT1 promotes proliferation and invasion through sponging miR-125b and activating E2F2 signaling in non-small cell lung Cancer, cell physiol, Biochem. 51 (2018) 2324–2340. [18] Y.Y. Liu, L.Y. Zhang, W.Z. Du, Circular RNA circ-PVT1 contributes to paclitaxel

[22] [23] [24] [25]

[26]

[27] [28] [29] [30]

[31]

[32] [33] [34] [35] [36] [37] [38] [39]

8

resistance of gastric cancer cells through regulates ZEB1 expression by sponging miR-124-3p, Biosci. Rep. (2019), https://doi.org/10.1042/BSR20193045. R. Xu, Y. Han, Long non-coding RNA FOXF1 adjacent non-coding developmental regulatory RNA inhibits growth and chemotherapy resistance in non-small cell lung cancer, Arch. Med. Sci. 15 (2019) 1539–1546. B. Li, D. Xie, H. Zhang, Long noncoding RNA neuroblastoma-associated transcript 1 gene inhibits malignant cellular phenotypes of bladder cancer through miR-21/ SOCS6 axis, Cell Death Dis. 9 (2018) 1042. B. Li, D. Xie, H. Zhang, MicroRNA-101-3p advances cisplatin sensitivity in bladder urothelial carcinoma through targeted silencing EZH2, J. Cancer 10 (2019) 2628–2634. E. Arnaiz, C. Sole, L. Manterola, L. Iparraguirre, D. Otaegui, C.H. Lawrie, CircRNAs and cancer: biomarkers and master regulators, Semin. Cancer Biol. 58 (2019) 90–99. X. Fang, J. Wen, M. Sun, Y. Yuan, Q. Xu, CircRNAs and its relationship with gastric cancer, J. Cancer 10 (2019) 6105–6113. B. Ding, W. Lou, L. Xu, W. Fan, Non-coding RNA in drug resistance of hepatocellular carcinoma, Biosci. Rep. 38 (2018) pii: BSR20180915. L. Wang, X. Peng, X. Lu, Q. Wei, M. Chen, L. Liu, Inhibition of hsa_circ_0001313 (circCCDC66) induction enhances the radio-sensitivity of colon cancer cells via tumor suppressor miR-338-3p: effects of cicr_0001313 on colon cancer radio-sensitivity, Pathol. Res. Pract. 215 (2019) 689–696. Y. Luo, Y. Fu, R. Huang, M. Gao, F. Liu, R. Gui, X. Nie, CircRNA_101505 sensitizes hepatocellular carcinoma cells to cisplatin by sponging miR-103 and promotes oxidored-nitro domain-containing protein 1 expression, Cell Death Discov. 5 (2019) 121. Y. Zhang, C. Li, X. Liu, Y. Wang, R. Zhao, Y. Yang, X. Zheng, Y. Zhang, X. Zhang, circHIPK3 promotes oxaliplatin-resistance in colorectal cancer through autophagy by sponging miR-637, EBioMedicine 48 (2019) 277–288. T. Chen, J. Luo, Y. Gu, J. Huang, Q. Luo, Y. Yang, Comprehensive analysis of circular RNA profiling in AZD9291-resistant non-small cell lung cancer cell lines, Thorac. Cancer 10 (2019) 930–941. N. Xu, S. Chen, Y. Liu, W. Li, Z. Liu, X. Bian, C. Ling, M. Jiang, Profiles and bioinformatics analysis of differentially expressed circrnas in taxol-resistant nonsmall cell lung cancer cells, Cell Physiol. Biochem. 48 (2018) 2046–2060. M.S. Huang, J.Y. Liu, X.B. Xia, Y.Z. Liu, X. Li, J.Y. Yin, J.B. Peng, L. Wu, W. Zhang, H.H. Zhou, Z.Q. Liu, Hsa_circ_0001946 inhibits lung cancer progression and mediates cisplatin sensitivity in non-small cell lung cancer via the nucleotide excision repair signaling pathway, Front. Oncol. 9 (2019) 508. Y. Zhong, Y. Du, X. Yang, Y. Mo, C. Fan, F. Xiong, D. Ren, X. Ye, C. Li, Y. Wang, F. Wei, C. Guo, X. Wu, X. Li, Y. Li, G. Li, Z. Zeng, W. Xiong, Circular RNAs function as ceRNAs to regulate and control human cancer progression, Mol. Cancer 17 (2018) 79. W. Song, T. Fu, Circular RNA-associated competing endogenous RNA network and prognostic nomogram for patients with colorectal cancer, Front. Oncol. 9 (2019) 1181. N. Bai, E. Peng, F. Xia, D. Wang, X. Li, X. Li, CircABCC2 regulates hepatocellular cancer progression by decoying MiR-665, J. Cancer 10 (2019) 3893–3898. Z. Wang, M. Su, B. Xiang, K. Zhao, B. Qin, Circular RNA PVT1 promotes metastasis via miR-145 sponging in CRC, Biochem. Biophys. Res. Commun. 512 (2019) 716–722. Y. Pan, J. Chen, L. Tao, K. Zhang, R. Wang, X. Chu, L. Chen, Long noncoding RNA ROR regulates chemoresistance in docetaxel-resistant lung adenocarcinoma cells via epithelial mesenchymal transition pathway, Oncotarget 8 (2017) 33144–33158. T.X. Lu, M.E. Rothenberg, MicroRNA, J. Allergy Clin. Immunol. 141 (2018) 1202–1207. J.F. Lu, D. Pokharel, M. Bebawy, MRP1 and its role in anticancer drug resistance, Drug Metab. Rev. 47 (2015) 406–419. B. Li, D. Xie, H. Zhang, Long non-coding RNA GHET1 contributes to chemotherapeutic resistance to Gemcitabine in bladder cancer, Cancer Chemother. Pharmacol. 84 (2019) 187–194. Z. Fang, W. Chen, Z. Yuan, X. Liu, H. Jiang, LncRNA-MALAT1 contributes to the cisplatin-resistance of lung cancer by upregulating MRP1 and MDR1 via STAT3 activation, Biomed. Pharmacother. 101 (2018) 536–542.