- Email: [email protected]
Aberrant methylation of CpG islands in intraductal papillary mucinous neoplasms of the pancreas
GASTROENTEROLOGY 2002;123:365–372
Aberrant Methylation of CpG Islands in Intraductal Papillary Mucinous Neoplasms of the Pancreas NORIHIRO SATO,* TAKASHI UEKI,* NORIYOSHI FUKUSHIMA,* CHRISTINE A. IACOBUZIO–DONAHUE,* CHARLES J. YEO,‡,§ JOHN L. CAMERON,§ RALPH H. HRUBAN,*,‡ and MICHAEL GOGGINS*,‡,㛳 From the Departments of *Pathology, ‡Oncology, 㛳Medicine, and §Surgery, The Johns Hopkins Medical Institutions, Baltimore, Maryland
Background & Aims: The functional abrogation of several tumor suppressor genes, including p16, DPC4, and p53, is a major mechanism underlying pancreatic ductal carcinogenesis. However, mutational inactivation of these genes is relatively uncommon in intraductal papillary mucinous neoplasms (IPMNs) of the pancreas. We hypothesized that an alternative mechanism for gene inactivation (notably, transcriptional silencing by promoter methylation) could be important in the pathogenesis of IPMNs. Methods: Using methylation-specific polymerase chain reaction, we analyzed the methylation status of 7 CpG islands previously identified as aberrantly methylated in pancreatic adenocarcinoma (including preproenkephalin [ ppENK ], p16, and thrombospondin 1) in 51 IPMNs of different histologic grades. The relationship between methylation status and expression was evaluated using reverse-transcription polymerase chain reaction for ppENK and immunohistochemistry for p16. Results: We found that more than 80% of the IPMNs exhibited hypermethylation of at least one of these CpG islands. Hypermethylation of ppENK and p16 was detected at a significant higher frequency in high-grade (in situ carcinoma) IPMNs than in lowgrade (adenoma/borderline) IPMNs (ppENK, 82% vs. 28%, P ⴝ 0.0002; p16, 21% vs. 0%, P ⴝ 0.04). Furthermore, the average number of methylated loci was significantly higher in high-grade IPMNs than in low-grade IPMNs (2.4 vs. 0.9; P ⴝ 0.0008). Aberrant methylation of ppENK and p16 was associated with loss of expression. Conclusions: These results suggest that de novo methylation of multiple CpG islands is one of the critical pathways that contributes to the malignant progression of IPMNs.
ntraductal papillary mucinous neoplasms (IPMNs) of the pancreas constitute a unique clinicopathologic entity characterized by grossly identifiable proliferations of mucin-producing neoplastic epithelium within dilated pancreatic ducts and ductules.1–5 Patients with IPMNs have a better prognosis than those with pancreatic adenocarcinoma; however, presentation with recurrent IPMNs
I
or disseminated pancreatic adenocarcinoma several years after surgical resection is not uncommon.6 –9 These unique clinical features, as well as an increase in the number of patients diagnosed with IPMNs in recent years, have led to increasing interest in understanding the etiology, natural history, and molecular genetics of IPMNs. Although progress has been made in histologically classifying and radiologically diagnosing IPMNs, patients with IPMNs pose difficult management problems. Appropriate treatment remains uncertain because it is difficult to differentiate between benign and malignant IPMNs preoperatively.10,11 Currently, there are no reliable markers that can predict the underlying malignant potential and biological behavior of IPMNs. Characterization of the molecular pathology of IPMNs may lead to further understanding of this disease and could also lead to the development of diagnostic/prognostic markers. The reported genetic alterations in IPMNs include activating point mutations in the K-ras oncogene,12 overexpression of HER-2/neu (c-erbB2) gene product,13 loss of heterozygosity at several chromosomal loci,14 and inactivating mutations in the STK11/LKB1 gene.15 Inactivation of the tumor-suppressor genes p16, p53, and DPC4/SMAD4 is central to the development of pancreatic adenocarcinomas16 –18; however, mutations in these tumor-suppressor genes are relatively rare in IPMNs. For example, mutations in the p53 gene have been detected in only 8% of IPMNs by Sessa et al.19 IacobuzioDonahue et al.20 examined a large series of IPMNs for the immunohistochemical expression of Dpc4, a sensitive marker of DPC4 gene status,21 and found almost no loss Abbreviations used in this paper: IPMN, intraductal papillary mucinous neoplasm; MCA/RDA, methylated CpG island amplification coupled with representational difference analysis; MICP, methylated in carcinoma of the pancreas; PCR, polymerase chain reaction; ppENK, preproenkephalin. © 2002 by the American Gastroenterological Association 0016-5085/02/$35.00 doi:10.1053/gast.2002.34160
366
SATO ET AL.
of expression. Similarly, Moore et al.22 reported no mutations in p16, p53, and DPC4 in 10 IPMNs, including 7 malignant cases. These findings imply fundamental differences in the genetic alterations between pancreatic adenocarcinomas and IPMNs. Alternatively, other mechanisms associated with gene inactivation may play a role in the pathogenesis of IPMNs. Aberrant methylation of CpG islands is a common mechanism for tumor-suppressor gene inactivation.23,24 We have reported previously the aberrant methylation of various cancer-associated genes, including p16 and hMLH1 in invasive adenocarcinomas of the pancreas.25 In addition, we have isolated several novel CpG islands aberrantly methylated in pancreatic cancer but not in normal pancreas using a technique known as methylated CpG island amplification coupled with representational difference analysis (MCA/RDA).26 Thus, aberrant CpG island methylation may be an important mechanism responsible for the development of some pancreatic adenocarcinomas, but it is not known whether these epigenetic alterations occur in IPMNs. To address this issue, we analyzed a series of 51 IPMNs for the methylation status of multiple CpG islands, including newly cloned sequences and known cancer-related genes.
Materials and Methods Tumor Samples, Microdissection, and DNA Extraction From the archives of The Johns Hopkins Hospital, 51 IPMNs were selected based on the availability of sufficient quantities of tumor cells. H&E-stained slides from each case were reviewed, and the IPMNs were classified according to recently established criteria1 by 3 of the authors (R.H.H., N.F., and C.A.I.). Five-micrometer sections were prepared from the selected paraffin blocks and deparaffinized by routine techniques. IPMNs were needle dissected under direct visualization as previously described.27 Microdissection was performed to obtain a neoplastic cellularity of ⬃70%–100%. DNA was extracted from the microdissected tissue with the use of 200 g/mL proteinase K and 0.5% Tween 20 as previously described.28
Methylation-Specific Polymerase Chain Reaction Methylation status was determined by methylationspecific polymerase chain reaction (PCR) as previously described.29 Briefly, 1 g of genomic DNA was treated with sodium bisulfite for 16 hours at 50°C. After purification, 1 L of treated DNA was amplified using primers specific for either methylated or unmethylated DNA under the conditions as follows: 95°C for 3 minutes; then 40 cycles at 95°C for 30 seconds, the specific annealing temperature for 30 seconds, and 72°C for 30 seconds; and a final extension for 4 minutes at
GASTROENTEROLOGY Vol. 123, No. 1
72°C. Primer sequences and the specific annealing temperatures for the 7 CpG islands examined in this study are described in Table 1. Five microliters of each PCR product was loaded onto 3% agarose gels and visualized by ethidium bromide staining. All PCR reactions were repeated at least twice.
Reverse-Transcription PCR Total RNA was isolated from frozen tissues using TRIzol reagent (Invitrogen, Carlsbad, CA). Five micrograms of total RNA was reverse transcribed using Superscript II (Invitrogen). The preproenkephalin (ppENK) reverse-transcription PCR reaction was performed under the conditions as follows: 95°C for 3 minutes; then 32 cycles at 95°C for 20 seconds, 64°C for 20 seconds, and 72°C for 30 seconds; and a final extension for 4 minutes at 72°C. Primer sequences were 5⬘CCG AAT GCA GCC AGG ATT G-3⬘ (sense) and 5⬘-GTG CTG GTG CCA TCT TGA G-3⬘ (antisense). To check the integrity of messenger RNA (mRNA), glyceraldehyde-3-phosphate dehydrogenase was also amplified. PCR products were resolved by electrophoresis in 2% agarose gels and visualized by ethidium bromide staining.
Immunohistochemistry Five-micrometer sections were cut onto coated slides and deparaffinized by routine techniques. After antigen retrieval in 0.1 mol/L EDTA (pH 8.0) for 20 minutes at 95– 100°C, the sections were incubated with an anti-p16 monoclonal antibody (Neomarkers, Inc., Fremont, CA) diluted to a final concentration of 1 g/mL at 4°C overnight. Labeling was detected with the DAKO Envision Plus Detection Kit (DAKO, Carpinteria, CA) following the protocol suggested by the manufacturer, and all sections were counterstained with hematoxylin. A specimen was considered positive for p16 if there was nuclear staining above any cytoplasmic background as previously described.30 Sections from invasive pancreatic adenocarcinomas with known homozygous p16 deletions18 served as external negative controls. Normal pancreatic epithelial, islet, and/or stromal cells served as positive internal controls in every tissue section.30,31
Results Clinicopathologic Features The present series included 27 men and 24 women (mean age, 66 years; range, 36 – 83 years). The maximum diameter of these neoplasms ranged from 0.3 to 9.0 cm (mean, 3.6 cm). The intraductal components of these neoplasms were classified as adenoma in 6 (12%), borderline in 12 (23%), and carcinoma in situ in 33 (65%). Twenty-four (47%) of the IPMNs were associated with an infiltrating adenocarcinoma. Lymph node metastasis was identified in 9 (38%) of the 24 invasive IPMNs. Follow-up data were available in 33 cases, and the mean follow-up period was 17 months (median, 10
July 2002
ABERRANT DNA METHYLATION IN PANCREATIC IPMNS
367
Table 1. Primers and Annealing Temperatures for Methylation-Specific PCR Clone or gene MICP25
Primers Unmethylated Methylated
MICP27
Unmethylated Methylated
MICP36
Unmethylated Methylated
MICP38
Unmethylated Methylated
ppENK
Unmethylated Methylated
p16
Unmethylated Methylated
THBS1
Unmethylated Methylated
F GAGAAGATTTAGTGTTGTGTG R AAATACAATTATTCAAAATTACAACC F TTAGCGTTGTGCGAGGTC R GAAAATACAATTATTCAAAATTACG F GTTAGTGGGTATAGGATGTTG R TTCAAATCCTTCATAATCTTATTCA F ATAGGACGTCGGGTGTTC R AAATCCTTCGTAATCTTATTCG F TTTTTTTTTTGAATTTAGGTGTTTTG R AAACTCCCACAACTAAAACACA F ATTTTAATTGAGTTGGGGGC R TAAAACGCGAATAAATAAAAAACG F ATTTTTGTTGTGTTTTGAGTGTG R CCACTTTTATCCCCAACATC F GGAGTCGGTTAAAGTTTTTC R CTCTCCGTCCTCGCTCG F TTGTGTGGGGAGTTATTGAGT R CACCTTCACAAAAAAAATCAATC F TGTGGGGAGTTATCGAGC R GCCTTCGCGAAAAAAATCG F GGGTGGATTGTGTGTGTTTG R CCATTAACCAACCAATCAACCA F GGCGGATCGCGTGCGTTC R CGTAACCAACCAATCAACCG F GTTTGGTTGTTGTTTATTGGTTG R CCTAAACTCACAAACCAACTCA F CGGTCGTCGTTTATTGGTC R TAAACTCGCAAACCAACTCG
Annealing temperature (°C) 62 62 60 64 62 62 64 64 62 62 68 68 64 64
THBS1, thrombospondin 1.
months). Of these 33 patients, 3 with an invasive IPMN died of recurrence at 9, 12, and 23 months after surgery, respectively. Hypermethylation of CpG Islands in IPMNs In a previous study, we isolated 42 CpG islands differentially methylated in pancreatic cancer using MCA/RDA.26 Of these, 4 CpG islands (methylated in carcinoma of the pancreas [MICP] 25, 27, 36, and 38) were selected for the present analysis because these clones showed hypermethylation at different frequencies in pancreatic adenocarcinomas but not in normal pancreas.26 These MICP clones had significant homologies to human genomic DNA sequences, but the associated genes are presently unknown. We also studied the methylation status of cancer-associated genes, including ppENK (a ligand with tumor-suppressor properties), p16 (a cyclindependent kinase inhibitor), and thrombospondin 1 (an angiogenesis inhibitor). All of these clones and genes were unmethylated in a panel of 15 normal pancreatic tissues.25,26 In addition, the methylation status of these CpG islands was confirmed in normal pancreatic ductal epithelium selectively microdissected using a laser-capture microdissection system (data not shown). The methyl-
ation profile for each case is summarized in Figure 1. Overall, aberrant methylation of at least one of the 7 loci was detected in 42 (82%) of 51 IPMNs. The methylation frequency of each of the MICP clones ranged from 12% to 49%. Among the 3 tested genes, the most frequently methylated was ppENK (methylated in 63%), followed by p16 (14%) and thrombospondin 1 (12%). In most IPMNs containing methylated alleles, unmethylated alleles were also detected in the same samples (Figure 2), reflecting contamination by normal cells or perhaps tumor heterogeneity. However, some IPMNs with in situ carcinoma showed only methylated alleles. For example, whereas case 040 contained both methylated and unmethylated templates of p16, case 963 contained only methylated p16 (Figure 2). To determine how frequently these CpG islands became methylated during the progression of IPMNs, we compared methylation status with histologic grade of malignancy (Table 2). IPMNs were divided into 2 groups: those classified as adenoma or borderline (lowgrade IPMNs; n ⫽ 18) and those classified as in situ carcinoma (high-grade IPMNs; n ⫽ 33). The frequency of methylation at any of the loci examined tended to be
368
SATO ET AL.
GASTROENTEROLOGY Vol. 123, No. 1
quencies of other loci between pancreatic adenocarcinomas and IPMNs. Relationship Between Aberrant Methylation and Expression of ppENK and p16 To evaluate the relationship between methylation status and expression of ppENK, we used reverse-transcription PCR to examine mRNA expression of ppENK in 9 high-grade (in situ carcinoma) IPMNs for which frozen materials were available. These included 2 IPMNs with unmethylated ppENK and 7 IPMNs with methylated ppENK. Strong mRNA expression was detected in the 2 IPMNs with unmethylated ppENK, whereas all 7 IPMNs showing methylation at ppENK showed a loss of (6 cases) or weak expression (1 case) of ppENK mRNA (Figure 3). The correlation between methylation status of p16 and its protein expression was also examined in 39 IPMNs (including 26 high-grade neoplasms and 13 low-grade neoplasms) by immunohistochemical staining with an anti-p16 monoclonal antibody. Of these 39 IPMNs, 6 (15%) were methylated at p16 and the remaining 33 showed unmethylation of this gene. Overall, loss of nuclear labeling for p16 was detected in 13 of 39 IPMNs (33%) and was found exclusively in high-grade IPMNs but not in low-grade IPMNs. Importantly, p16 expression was significantly associated with its methylation status (Figure 4); loss of nuclear staining was detected in 5 of 6 IPMNs (83%) with methylated p16 but in only 8 of 33 IPMNs (24%) with unmethylated p16 (Fisher exact test, P ⫽ 0.01). Figure 1. Methylation profiles of multiple loci in IPMNs. The methylation status of 7 CpG islands in 51 IPMNs is shown. ■, methylated alleles in the neoplasm; 䊐, unmethylated alleles in the neoplasm.
higher in high-grade IPMNs than in low-grade IPMNs (91% vs. 67%; Fisher exact test; P ⫽ 0.05). Of the genes tested, ppENK and p16 were methylated more frequently in high-grade IPMNs than in low-grade IPMNs (ppENK, 82% vs. 28%, P ⫽ 0.0002; p16, 21% vs. 0%, P ⫽ 0.04). Furthermore, the average number of methylated loci was significantly higher in high-grade IPMNs than in lowgrade IPMNs (2.4 vs. 0.9; Mann-Whitney U nonparametric test; P ⫽ 0.0008). When the methylation pattern of each locus in the IPMNs was compared with that in pancreatic adenocarcinomas,25,26 MICP38 and ppENK were methylated at a higher frequency in pancreatic adenocarcinomas than in IPMNs (MICP38, 41% vs. 16%, P ⫽ 0.003; ppENK, 93% vs. 63%, P ⬍ 0.0001; Table 2). However, there were no significant differences in the methylation fre-
Discussion In the present study, we examined the methylation status of 7 CpG islands in a panel of 51 IPMNs. We found (1) aberrant methylation of at least one of these CpG islands in most (⬎80%) IPMNs; (2) that
Figure 2. Methylation-specific PCR analysis of MICP25 and p16 in IPMNs. DNA samples extracted from normal pancreata (NP) or IPMNs (samples 963, 096, 921, and 040) were amplified with primers specific to the unmethylated (U) or methylated (M) templates after modification with sodium bisulfite.
July 2002
ABERRANT DNA METHYLATION IN PANCREATIC IPMNS
369
Table 2. Methylation Status of Multiple CpG Islands in Low-Grade and High-Grade IPMNs Samples
Any locusa
MICP25
MICP27
MICP36
MICP38
ppENK
p16
THBS1
Low-grade IPMNsb (n ⫽ 18) High-grade IPMNsc (n ⫽ 33) Total (n ⫽ 51) Pancreatic adenocarcinomasd
67 91 82 95
6 27 20 15
33 58 49 48
6 15 12 19
11 18 16f 41
28 82e 63f 93
0 21e 14 18
6 15 12 7
NOTE. All values are expressed as percentages. THBS1, thrombospondin 1. a Methylation at any of the 7 CpG islands examined. b IPMNs that are classified as adenoma or borderline. c IPMNs that are classified as in situ carcinoma. d Data are from previous publications.25,26 n ⫽ 75 for any locus, MICPs, and ppENK and n ⫽ 45 for p16 and THBS1. e Statistically significant differences compared with low-grade IPMNs. f Statistically significant differences compared with pancreatic adenocarcinomas.
hypermethylation of ppENK and p16 was detected at a higher frequency in high-grade IPMNs than in lowgrade IPMNs; (3) that the average number of methylated loci was significantly higher in high-grade IPMNs than in low-grade IPMNs; and (4) that aberrant methylation of ppENK and p16 was associated with loss of expression. These results indicate that CpG island hypermethylation is one of the major pathways that contributes to the development and progression of IPMNs. Our results show that methylation abnormalities are present even in the low-grade (e.g., adenoma and borderline) IPMNs, providing evidence that CpG island methylation occurs relatively early in the natural history of IPMNs. Notably, the number of affected loci increases substantially as the tumor progresses from low-grade to high-grade IPMNs. Furthermore, some IPMNs with in situ carcinoma showed complete methylation of genes such as p16 and ppENK (Figure 2 and data not shown), suggesting that methylation defects may silence both
Figure 3. Reverse-transcription PCR analysis of ppENK in IPMNs. Strong expression is detected in 2 IPMNs (samples 981 and 816) unmethylated at ppENK, whereas 7 IPMNs having methylated ppENK show a loss of (samples 083, 050, 921, 482, 045, and 004) or weak (sample 979) expression of ppENK mRNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serves as an RNA control, and mRNA from a pancreatic cancer cell line (CFPAC1) treated with the demethylating agent 5-aza-2⬘-deoxycytidine (5Az-dC) serves as a positive control.
alleles of target genes in these high-grade neoplasms. Indeed, we found that hypermethylation of ppENK and p16 was almost always associated with loss of expression of these genes. These data suggest that aberrant methylation of p16, ppENK, and other genes may contribute to the malignant transformation of IPMNs. In support of this idea, a stepwise increase in de novo methylation of several genes has been reported during malignant progression of other tumor types, including pancreas,32 bladder,33 breast,34 and gastric35 cancers. Among the cancer-related genes analyzed, ppENK is the most frequently affected, with 63% of all IPMNs being methylated. Remarkably, more than 80% of highgrade IPMNs showed hypermethylation of this gene, whereas the frequency was only 28% in low-grade IPMNs. ppENK encodes a native opioid peptide [Met5]enkephalin, which is known to be a potent regulator of development, cell proliferation, angiogenesis, and wound healing.36 Importantly, several studies have suggested the tumorsuppressor properties of [Met5]enkephalin. For example, exposure of lung cancer cells to [Met5]enkephalin results in apoptotic cell death.37 Treatment with [Met5]enkephalin inhibits the growth of pancreatic cancer cells in vitro and in vivo.38,39 Our results raise the possibility that tests to detect aberrantly methylated genes in pancreatic juice, duodenal fluid, or stool samples have potential clinical use in refining preoperative diagnosis or the postoperative follow-up of patients with IPMNs.40 – 44 Because methylation abnormalities are both common in IPMNs and readily detectable using sensitive techniques such as methylation-specific PCR, these epigenetic alterations have the potential to be a sensitive marker for distinguishing high-grade IPMNs from low-grade IPMNs and nonneoplastic pancreatic lesions. Recent reports that aberrant methylation of p16 and other genes can be detected in DNA from blood or sputum of patients with
370
SATO ET AL.
GASTROENTEROLOGY Vol. 123, No. 1
Figure 4. Immunohistochemical labeling of IPMNs with an anti-p16 monoclonal antibody. Positive nuclear labeling for p16 is shown in low-grade IPMNs with unmethylated p16 (A and B), whereas the nuclear staining is lost in high-grade IPMNs with methylated p16 (C and D).
lung cancer or from ductal lavage fluid of patients with breast cancer support the feasibility of this approach.45– 48 In summary, we show for the first time that aberrant methylation of CpG islands is a frequent event in IPMNs and may contribute to their development and malignant progression.
References 1. Solcia E, Capella C, Klo¨ppel G. Tumors of the pancreas. In: Rosai J, Sobin LH, eds. Atlas of tumor pathology. 3rd series. Washington, DC: Armed Forces Institute of Pathology, 1997:31–144. 2. Fukushima N, Mukai K, Kanai Y, Hasebe T, Shimada K, Ozaki H, Kinoshita T, Kosuge T. Intraductal papillary tumors and mucinous cystic tumors of the pancreas: clinicopathologic study of 38 cases. Hum Pathol 1997;28:1010 –1017. 3. Nagai E, Ueki T, Chijiiwa K, Tanaka M, Tsuneyoshi M. Intraductal papillary mucinous neoplasms of the pancreas associated with so-called “mucinous ductal ectasia.” Histochemical and immunohistochemical analysis of 29 cases. Am J Surg Pathol 1995;19: 576 –589. 4. Loftus EV Jr, Olivares-Pakzad BA, Batts KP, Adkins MC, Stephens
5.
6.
7.
8.
9.
DH, Sarr MG, DiMagno EP. Intraductal papillary-mucinous tumors of the pancreas: clinicopathologic features, outcome, and nomenclature. Members of the Pancreas Clinic, and Pancreatic Surgeons of Mayo Clinic. Gastroenterology 1996;110:1909 – 1918. Paal E, Thompson LD, Przygodzki RM, Bratthauer GL, Heffess CS. A clinicopathologic and immunohistochemical study of 22 intraductal papillary mucinous neoplasms of the pancreas, with a review of the literature. Mod Pathol 1999;12:518 –528. Sohn TA, Yeo CJ, Cameron JL, Iacobuzio-Donahue CA, Hruban RH, Lillemoe KL. Intraductal papillary mucinous neoplasms of the pancreas: an increasingly recognized clinicopathological entity. Ann Surg 2001;234:313–321. Adsay NV, Conlon KC, Zee SY, Brennan MF, Klimstra DS. Intraductal papillary-mucinous neoplasms of the pancreas: an analysis of in situ and invasive carcinomas in 28 patients. Cancer 2002;94:62–77. Cuillerier E, Cellier C, Palazzo L, Deviere J, Wind P, Rickaert F, Cugnenc PH, Cremer M, Barbier JP. Outcome after surgical resection of intraductal papillary and mucinous tumors of the pancreas. Am J Gastroenterol 2000;95:441– 445. Sho M, Nakajima Y, Kanehiro H, Hisanaga M, Nishio K, Nagao M, Ikeda N, Kanokogi H, Yamada T, Nakano H. Pattern of recurrence
July 2002
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
after resection for intraductal papillary mucinous tumors of the pancreas. World J Surg 1998;22:874 – 878. Cellier C, Cuillerier E, Palazzo L, Rickaert F, Flejou JF, Napoleon B, Van Gansbeke D, Bely N, Ponsot P, Partensky C, Cugnenc PH, Barbier JP, Deviere J, Cremer M. Intraductal papillary and mucinous tumors of the pancreas: accuracy of preoperative computed tomography, endoscopic retrograde pancreatography and endoscopic ultrasonography, and long-term outcome in a large surgical series. Gastrointest Endosc 1998;47:42– 49. Zamora C, Sahel J, Cantu DG, Heyries L, Bernard JP, Bastid C, Payan MJ, Sielezneff I, Familiari L, Sastre B, Barthet M. Intraductal papillary or mucinous tumors (IPMT) of the pancreas: report of a case series and review of the literature. Am J Gastroenterol 2001;96:1441–1447. Z’Graggen K, Rivera JA, Compton CC, Pins M, Werner J, Fernandez-del Castillo C, Rattner DW, Lewandrowski KB, Rustgi AK, Warshaw AL. Prevalence of activating K-ras mutations in the evolutionary stages of neoplasia in intraductal papillary mucinous tumors of the pancreas. Ann Surg 1997;226:491– 498 [discussion 498 –500]. Satoh K, Sasano H, Shimosegawa T, Koizumi M, Yamazaki T, Mochizuki F, Kobayashi N, Okano T, Toyota T, Sawai T. An immunohistochemical study of the c-erbB-2 oncogene product in intraductal mucin-hypersecreting neoplasms and in ductal cell carcinomas of the pancreas. Cancer 1993;72:51–56. Fujii H, Inagaki M, Kasai S, Miyokawa N, Tokusashi Y, Gabrielson E, Hruban RH. Genetic progression and heterogeneity in intraductal papillary-mucinous neoplasms of the pancreas. Am J Pathol 1997;151:1447–1454. Sato N, Rosty C, Jansen M, Fukushima N, Ueki T, Yeo CJ, Cameron JL, Iacobuzio-Donahue CA, Hruban RH, Goggins M. STK11/LKB1 Peutz-Jeghers gene inactivation in intraductal papillary-mucinous neoplasms of the pancreas. Am J Pathol 2001; 159:2017–2022. Goggins M, Kern SE, Offerhaus JA, Hruban RH. Progress in cancer genetics: lessons from pancreatic cancer. Ann Oncol 1999;10:4 – 8. Rozenblum E, Schutte M, Goggins M, Hahn SA, Panzer S, Zahurak M, Goodman SN, Sohn TA, Hruban RH, Yeo CJ, Kern SE. Tumor-suppressive pathways in pancreatic carcinoma. Cancer Res 1997;57:1731–1734. Schutte M, Hruban RH, Geradts J, Maynard R, Hilgers W, Rabindran SK, Moskaluk CA, Hahn SA, Schwarte-Waldhoff I, Schmiegel W, Baylin SB, Kern SE, Herman JG. Abrogation of the Rb/p16 tumor-suppressive pathway in virtually all pancreatic carcinomas. Cancer Res 1997;57:3126 –3130. Sessa F, Solcia E, Capella C, Bonato M, Scarpa A, Zamboni G, Pellegata NS, Ranzani GN, Rickaert F, Klo¨ppel G. Intraductal papillary-mucinous tumours represent a distinct group of pancreatic neoplasms: an investigation of tumour cell differentiation and K-ras, p53 and c-erbB-2 abnormalities in 26 patients. Virchows Arch 1994;425:357–367. Iacobuzio-Donahue CA, Klimstra DS, Adsay NV, Wilentz RE, Argani P, Sohn TA, Yeo CJ, Cameron JL, Kern SE, Hruban RH. Dpc-4 protein is expressed in virtually all human intraductal papillary mucinous neoplasms of the pancreas: comparison with conventional ductal adenocarcinomas. Am J Pathol 2000;157:755– 761. Wilentz RE, Su GH, Dai JL, Sparks AB, Argani P, Sohn TA, Yeo CJ, Kern SE, Hruban RH. Immunohistochemical labeling for dpc4 mirrors genetic status in pancreatic adenocarcinomas: a new marker of DPC4 inactivation. Am J Pathol 2000;156:37– 43. Moore PS, Orlandini S, Zamboni G, Capelli P, Rigaud G, Falconi M, Bassi C, Lemoine NR, Scarpa A. Pancreatic tumours: molecular pathways implicated in ductal cancer are involved in ampullary but not in exocrine nonductal or endocrine tumorigenesis. Br J Cancer 2001;84:253–262.
ABERRANT DNA METHYLATION IN PANCREATIC IPMNS
371
23. Jones PA, Laird PW. Cancer epigenetics comes of age. Nat Genet 1999;21:163–167. 24. Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 2000;16:168 –174. 25. Ueki T, Toyota M, Sohn T, Yeo CJ, Issa JP, Hruban RH, Goggins M. Hypermethylation of multiple genes in pancreatic adenocarcinoma. Cancer Res 2000;60:1835–1839. 26. Ueki T, Toyota M, Skinner H, Walter KM, Yeo CJ, Issa JP, Hruban RH, Goggins M. Identification and characterization of differentially methylated CpG islands in pancreatic carcinoma. Cancer Res 2001;61:8540 – 8546. 27. Moskaluk CA, Kern SE. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections. Am J Pathol 1997;150:1547–1552. 28. Goggins M, Hruban RH, Kern SE. BRCA2 is inactivated late in the development of pancreatic intraepithelial neoplasia: evidence and implications. Am J Pathol 2000;156:1767–1771. 29. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996;93:9821–9826. 30. Geradts J, Wilentz RE, Roberts H. Immunohistochemical detection of the alternate INK4a-encoded tumor suppressor protein p14ARF in archival human cancers and cell lines using commercial antibodies: correlation with p16INK4a expression. Mod Pathol 2001;14:1162–1168. 31. Nielsen GP, Stemmer-Rachamimov AO, Shaw J, Roy JE, Koh J, Louis DN. Immunohistochemical survey of p16INK4A expression in normal human adult and infant tissues. Lab Invest 1999;79: 1137–1143. 32. Fukushima N, Sato N, Ueki T, Rosty C, Walter KM, Wilentz RE, Yeo CJ, Hruban RH, Goggins M. Aberrant methylation of preproenkephalin and plb genes in pancreatic intraepithelial neoplasia and pancreatic ductal adenocarcinoma. Am J Pathol 2002;160: 1573–1581. 33. Salem C, Liang G, Tsai YC, Coulter J, Knowles MA, Feng AC, Groshen S, Nichols PW, Jones PA. Progressive increases in de novo methylation of CpG islands in bladder cancer. Cancer Res 2000;60:2473–2476. 34. Nass SJ, Herman JG, Gabrielson E, Iversen PW, Parl FF, Davidson NE, Graff JR. Aberrant methylation of the estrogen receptor and E-cadherin 5⬘ CpG islands increases with malignant progression in human breast cancer. Cancer Res 2000;60:4346 – 4348. 35. Kang GH, Shim YH, Jung HY, Kim WH, Ro JY, Rhyu MG. CpG island methylation in premalignant stages of gastric carcinoma. Cancer Res 2001;61:2847–2851. 36. Zagon IS, Wu Y, McLaughlin PJ. Opioid growth factor and organ development in rat and human embryos. Brain Res 1999;839: 313–322. 37. Maneckjee R, Minna JD. Opioids induce while nicotine suppresses apoptosis in human lung cancer cells. Cell Growth Diff 1994;5:1033–1040. 38. Zagon IS, Smith JP, McLaughlin PJ. Human pancreatic cancer cell proliferation in tissue culture is tonically inhibited by opioid growth factor. Int J Oncol 1999;14:577–584. 39. Zagon IS, Hytrek SD, Smith JP, McLaughlin PJ. Opioid growth factor (OGF) inhibits human pancreatic cancer transplanted into nude mice. Cancer Lett 1997;112:167–175. 40. Iwao T, Tsuchida A, Hanada K, Eguchi N, Kajiyama G, Shimamoto F. Immunocytochemical detection of p53 protein as an adjunct in cytologic diagnosis from pancreatic duct brushings in mucinproducing tumors of the pancreas. Cancer 1997;81:163–171. 41. Inoue H, Tsuchida A, Kawasaki Y, Fujimoto Y, Yamasaki S, Kajiyama G. Preoperative diagnosis of intraductal papillary-mucinous tumors of the pancreas with attention to telomerase activity. Cancer 2001;91:35– 41. 42. Kaino M, Kondoh S, Okita S, Hatano S, Shiraishi K, Kaino S, Okita K. Detection of K-ras and p53 gene mutations in pancreatic
372
43.
44.
45.
46.
SATO ET AL.
juice for the diagnosis of intraductal papillary mucinous tumors. Pancreas 1999;18:294 –299. Kondo H, Sugano K, Fukayama N, Hosokawa K, Ohkura H, Ohtsu A, Mukai K, Yoshida S. Detection of K-ras gene mutations at codon 12 in the pancreatic juice of patients with intraductal papillary mucinous tumors of the pancreas. Cancer 1997;79: 900 –905. Tateishi K, Tada M, Yamagata M, Isayama H, Komatsu Y, Kawabe T, Shiratori Y, Omata M. High proportion of mutant K-ras gene in pancreatic juice of patients with pancreatic cystic lesions. Gut 1999;45:737–740. Evron E, Dooley WC, Umbricht CB, Rosenthal D, Sacchi N, Gabrielson E, Soito AB, Hung DT, Ljung B, Davidson NE, Sukumar S. Detection of breast cancer cells in ductal lavage fluid by methylation-specific PCR. Lancet 2001;357:1335–1336. Esteller M, Sanchez-Cespedes M, Rosell R, Sidransky D, Baylin SB, Herman JG. Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients. Cancer Res 1999;59:67–70.
GASTROENTEROLOGY Vol. 123, No. 1
47. Belinsky SA, Nikula KJ, Palmisano WA, Michels R, Saccomanno G, Gabrielson E, Baylin SB, Herman JG. Aberrant methylation of p16(INK4a) is an early event in lung cancer and a potential biomarker for early diagnosis. Proc Natl Acad Sci U S A 1998; 95:11891–11896. 48. Palmisano WA, Divine KK, Saccomanno G, Gilliland FD, Baylin SB, Herman JG, Belinsky SA. Predicting lung cancer by detecting aberrant promoter methylation in sputum. Cancer Res 2000;60: 5954 –5958.
Received March 6, 2002. Accepted April 8, 2002. Address requests for reprints to: Michael Goggins, M.D., Departments of Pathology, Medicine, and Oncology, The Johns Hopkins Medical Institutions, 632 Ross Building, 720 Rutland Avenue, Baltimore, Maryland 21205. e-mail: [email protected]; fax: (410) 614-0671. Supported by the National Institutes of Health SPORE grant in gastrointestinal malignancies (CA62924), the Lustgarten Foundation for Pancreatic Cancer Research, and the Michael Rolfe Foundation.
Aberrant Methylation of CpG Islands in Intraductal Papillary Mucinous Neoplasms of the Pancreas NORIHIRO SATO,* TAKASHI UEKI,* NORIYOSHI FUKUSHIMA,* CHRISTINE A. IACOBUZIO–DONAHUE,* CHARLES J. YEO,‡,§ JOHN L. CAMERON,§ RALPH H. HRUBAN,*,‡ and MICHAEL GOGGINS*,‡,㛳 From the Departments of *Pathology, ‡Oncology, 㛳Medicine, and §Surgery, The Johns Hopkins Medical Institutions, Baltimore, Maryland
Background & Aims: The functional abrogation of several tumor suppressor genes, including p16, DPC4, and p53, is a major mechanism underlying pancreatic ductal carcinogenesis. However, mutational inactivation of these genes is relatively uncommon in intraductal papillary mucinous neoplasms (IPMNs) of the pancreas. We hypothesized that an alternative mechanism for gene inactivation (notably, transcriptional silencing by promoter methylation) could be important in the pathogenesis of IPMNs. Methods: Using methylation-specific polymerase chain reaction, we analyzed the methylation status of 7 CpG islands previously identified as aberrantly methylated in pancreatic adenocarcinoma (including preproenkephalin [ ppENK ], p16, and thrombospondin 1) in 51 IPMNs of different histologic grades. The relationship between methylation status and expression was evaluated using reverse-transcription polymerase chain reaction for ppENK and immunohistochemistry for p16. Results: We found that more than 80% of the IPMNs exhibited hypermethylation of at least one of these CpG islands. Hypermethylation of ppENK and p16 was detected at a significant higher frequency in high-grade (in situ carcinoma) IPMNs than in lowgrade (adenoma/borderline) IPMNs (ppENK, 82% vs. 28%, P ⴝ 0.0002; p16, 21% vs. 0%, P ⴝ 0.04). Furthermore, the average number of methylated loci was significantly higher in high-grade IPMNs than in low-grade IPMNs (2.4 vs. 0.9; P ⴝ 0.0008). Aberrant methylation of ppENK and p16 was associated with loss of expression. Conclusions: These results suggest that de novo methylation of multiple CpG islands is one of the critical pathways that contributes to the malignant progression of IPMNs.
ntraductal papillary mucinous neoplasms (IPMNs) of the pancreas constitute a unique clinicopathologic entity characterized by grossly identifiable proliferations of mucin-producing neoplastic epithelium within dilated pancreatic ducts and ductules.1–5 Patients with IPMNs have a better prognosis than those with pancreatic adenocarcinoma; however, presentation with recurrent IPMNs
I
or disseminated pancreatic adenocarcinoma several years after surgical resection is not uncommon.6 –9 These unique clinical features, as well as an increase in the number of patients diagnosed with IPMNs in recent years, have led to increasing interest in understanding the etiology, natural history, and molecular genetics of IPMNs. Although progress has been made in histologically classifying and radiologically diagnosing IPMNs, patients with IPMNs pose difficult management problems. Appropriate treatment remains uncertain because it is difficult to differentiate between benign and malignant IPMNs preoperatively.10,11 Currently, there are no reliable markers that can predict the underlying malignant potential and biological behavior of IPMNs. Characterization of the molecular pathology of IPMNs may lead to further understanding of this disease and could also lead to the development of diagnostic/prognostic markers. The reported genetic alterations in IPMNs include activating point mutations in the K-ras oncogene,12 overexpression of HER-2/neu (c-erbB2) gene product,13 loss of heterozygosity at several chromosomal loci,14 and inactivating mutations in the STK11/LKB1 gene.15 Inactivation of the tumor-suppressor genes p16, p53, and DPC4/SMAD4 is central to the development of pancreatic adenocarcinomas16 –18; however, mutations in these tumor-suppressor genes are relatively rare in IPMNs. For example, mutations in the p53 gene have been detected in only 8% of IPMNs by Sessa et al.19 IacobuzioDonahue et al.20 examined a large series of IPMNs for the immunohistochemical expression of Dpc4, a sensitive marker of DPC4 gene status,21 and found almost no loss Abbreviations used in this paper: IPMN, intraductal papillary mucinous neoplasm; MCA/RDA, methylated CpG island amplification coupled with representational difference analysis; MICP, methylated in carcinoma of the pancreas; PCR, polymerase chain reaction; ppENK, preproenkephalin. © 2002 by the American Gastroenterological Association 0016-5085/02/$35.00 doi:10.1053/gast.2002.34160
366
SATO ET AL.
of expression. Similarly, Moore et al.22 reported no mutations in p16, p53, and DPC4 in 10 IPMNs, including 7 malignant cases. These findings imply fundamental differences in the genetic alterations between pancreatic adenocarcinomas and IPMNs. Alternatively, other mechanisms associated with gene inactivation may play a role in the pathogenesis of IPMNs. Aberrant methylation of CpG islands is a common mechanism for tumor-suppressor gene inactivation.23,24 We have reported previously the aberrant methylation of various cancer-associated genes, including p16 and hMLH1 in invasive adenocarcinomas of the pancreas.25 In addition, we have isolated several novel CpG islands aberrantly methylated in pancreatic cancer but not in normal pancreas using a technique known as methylated CpG island amplification coupled with representational difference analysis (MCA/RDA).26 Thus, aberrant CpG island methylation may be an important mechanism responsible for the development of some pancreatic adenocarcinomas, but it is not known whether these epigenetic alterations occur in IPMNs. To address this issue, we analyzed a series of 51 IPMNs for the methylation status of multiple CpG islands, including newly cloned sequences and known cancer-related genes.
Materials and Methods Tumor Samples, Microdissection, and DNA Extraction From the archives of The Johns Hopkins Hospital, 51 IPMNs were selected based on the availability of sufficient quantities of tumor cells. H&E-stained slides from each case were reviewed, and the IPMNs were classified according to recently established criteria1 by 3 of the authors (R.H.H., N.F., and C.A.I.). Five-micrometer sections were prepared from the selected paraffin blocks and deparaffinized by routine techniques. IPMNs were needle dissected under direct visualization as previously described.27 Microdissection was performed to obtain a neoplastic cellularity of ⬃70%–100%. DNA was extracted from the microdissected tissue with the use of 200 g/mL proteinase K and 0.5% Tween 20 as previously described.28
Methylation-Specific Polymerase Chain Reaction Methylation status was determined by methylationspecific polymerase chain reaction (PCR) as previously described.29 Briefly, 1 g of genomic DNA was treated with sodium bisulfite for 16 hours at 50°C. After purification, 1 L of treated DNA was amplified using primers specific for either methylated or unmethylated DNA under the conditions as follows: 95°C for 3 minutes; then 40 cycles at 95°C for 30 seconds, the specific annealing temperature for 30 seconds, and 72°C for 30 seconds; and a final extension for 4 minutes at
GASTROENTEROLOGY Vol. 123, No. 1
72°C. Primer sequences and the specific annealing temperatures for the 7 CpG islands examined in this study are described in Table 1. Five microliters of each PCR product was loaded onto 3% agarose gels and visualized by ethidium bromide staining. All PCR reactions were repeated at least twice.
Reverse-Transcription PCR Total RNA was isolated from frozen tissues using TRIzol reagent (Invitrogen, Carlsbad, CA). Five micrograms of total RNA was reverse transcribed using Superscript II (Invitrogen). The preproenkephalin (ppENK) reverse-transcription PCR reaction was performed under the conditions as follows: 95°C for 3 minutes; then 32 cycles at 95°C for 20 seconds, 64°C for 20 seconds, and 72°C for 30 seconds; and a final extension for 4 minutes at 72°C. Primer sequences were 5⬘CCG AAT GCA GCC AGG ATT G-3⬘ (sense) and 5⬘-GTG CTG GTG CCA TCT TGA G-3⬘ (antisense). To check the integrity of messenger RNA (mRNA), glyceraldehyde-3-phosphate dehydrogenase was also amplified. PCR products were resolved by electrophoresis in 2% agarose gels and visualized by ethidium bromide staining.
Immunohistochemistry Five-micrometer sections were cut onto coated slides and deparaffinized by routine techniques. After antigen retrieval in 0.1 mol/L EDTA (pH 8.0) for 20 minutes at 95– 100°C, the sections were incubated with an anti-p16 monoclonal antibody (Neomarkers, Inc., Fremont, CA) diluted to a final concentration of 1 g/mL at 4°C overnight. Labeling was detected with the DAKO Envision Plus Detection Kit (DAKO, Carpinteria, CA) following the protocol suggested by the manufacturer, and all sections were counterstained with hematoxylin. A specimen was considered positive for p16 if there was nuclear staining above any cytoplasmic background as previously described.30 Sections from invasive pancreatic adenocarcinomas with known homozygous p16 deletions18 served as external negative controls. Normal pancreatic epithelial, islet, and/or stromal cells served as positive internal controls in every tissue section.30,31
Results Clinicopathologic Features The present series included 27 men and 24 women (mean age, 66 years; range, 36 – 83 years). The maximum diameter of these neoplasms ranged from 0.3 to 9.0 cm (mean, 3.6 cm). The intraductal components of these neoplasms were classified as adenoma in 6 (12%), borderline in 12 (23%), and carcinoma in situ in 33 (65%). Twenty-four (47%) of the IPMNs were associated with an infiltrating adenocarcinoma. Lymph node metastasis was identified in 9 (38%) of the 24 invasive IPMNs. Follow-up data were available in 33 cases, and the mean follow-up period was 17 months (median, 10
July 2002
ABERRANT DNA METHYLATION IN PANCREATIC IPMNS
367
Table 1. Primers and Annealing Temperatures for Methylation-Specific PCR Clone or gene MICP25
Primers Unmethylated Methylated
MICP27
Unmethylated Methylated
MICP36
Unmethylated Methylated
MICP38
Unmethylated Methylated
ppENK
Unmethylated Methylated
p16
Unmethylated Methylated
THBS1
Unmethylated Methylated
F GAGAAGATTTAGTGTTGTGTG R AAATACAATTATTCAAAATTACAACC F TTAGCGTTGTGCGAGGTC R GAAAATACAATTATTCAAAATTACG F GTTAGTGGGTATAGGATGTTG R TTCAAATCCTTCATAATCTTATTCA F ATAGGACGTCGGGTGTTC R AAATCCTTCGTAATCTTATTCG F TTTTTTTTTTGAATTTAGGTGTTTTG R AAACTCCCACAACTAAAACACA F ATTTTAATTGAGTTGGGGGC R TAAAACGCGAATAAATAAAAAACG F ATTTTTGTTGTGTTTTGAGTGTG R CCACTTTTATCCCCAACATC F GGAGTCGGTTAAAGTTTTTC R CTCTCCGTCCTCGCTCG F TTGTGTGGGGAGTTATTGAGT R CACCTTCACAAAAAAAATCAATC F TGTGGGGAGTTATCGAGC R GCCTTCGCGAAAAAAATCG F GGGTGGATTGTGTGTGTTTG R CCATTAACCAACCAATCAACCA F GGCGGATCGCGTGCGTTC R CGTAACCAACCAATCAACCG F GTTTGGTTGTTGTTTATTGGTTG R CCTAAACTCACAAACCAACTCA F CGGTCGTCGTTTATTGGTC R TAAACTCGCAAACCAACTCG
Annealing temperature (°C) 62 62 60 64 62 62 64 64 62 62 68 68 64 64
THBS1, thrombospondin 1.
months). Of these 33 patients, 3 with an invasive IPMN died of recurrence at 9, 12, and 23 months after surgery, respectively. Hypermethylation of CpG Islands in IPMNs In a previous study, we isolated 42 CpG islands differentially methylated in pancreatic cancer using MCA/RDA.26 Of these, 4 CpG islands (methylated in carcinoma of the pancreas [MICP] 25, 27, 36, and 38) were selected for the present analysis because these clones showed hypermethylation at different frequencies in pancreatic adenocarcinomas but not in normal pancreas.26 These MICP clones had significant homologies to human genomic DNA sequences, but the associated genes are presently unknown. We also studied the methylation status of cancer-associated genes, including ppENK (a ligand with tumor-suppressor properties), p16 (a cyclindependent kinase inhibitor), and thrombospondin 1 (an angiogenesis inhibitor). All of these clones and genes were unmethylated in a panel of 15 normal pancreatic tissues.25,26 In addition, the methylation status of these CpG islands was confirmed in normal pancreatic ductal epithelium selectively microdissected using a laser-capture microdissection system (data not shown). The methyl-
ation profile for each case is summarized in Figure 1. Overall, aberrant methylation of at least one of the 7 loci was detected in 42 (82%) of 51 IPMNs. The methylation frequency of each of the MICP clones ranged from 12% to 49%. Among the 3 tested genes, the most frequently methylated was ppENK (methylated in 63%), followed by p16 (14%) and thrombospondin 1 (12%). In most IPMNs containing methylated alleles, unmethylated alleles were also detected in the same samples (Figure 2), reflecting contamination by normal cells or perhaps tumor heterogeneity. However, some IPMNs with in situ carcinoma showed only methylated alleles. For example, whereas case 040 contained both methylated and unmethylated templates of p16, case 963 contained only methylated p16 (Figure 2). To determine how frequently these CpG islands became methylated during the progression of IPMNs, we compared methylation status with histologic grade of malignancy (Table 2). IPMNs were divided into 2 groups: those classified as adenoma or borderline (lowgrade IPMNs; n ⫽ 18) and those classified as in situ carcinoma (high-grade IPMNs; n ⫽ 33). The frequency of methylation at any of the loci examined tended to be
368
SATO ET AL.
GASTROENTEROLOGY Vol. 123, No. 1
quencies of other loci between pancreatic adenocarcinomas and IPMNs. Relationship Between Aberrant Methylation and Expression of ppENK and p16 To evaluate the relationship between methylation status and expression of ppENK, we used reverse-transcription PCR to examine mRNA expression of ppENK in 9 high-grade (in situ carcinoma) IPMNs for which frozen materials were available. These included 2 IPMNs with unmethylated ppENK and 7 IPMNs with methylated ppENK. Strong mRNA expression was detected in the 2 IPMNs with unmethylated ppENK, whereas all 7 IPMNs showing methylation at ppENK showed a loss of (6 cases) or weak expression (1 case) of ppENK mRNA (Figure 3). The correlation between methylation status of p16 and its protein expression was also examined in 39 IPMNs (including 26 high-grade neoplasms and 13 low-grade neoplasms) by immunohistochemical staining with an anti-p16 monoclonal antibody. Of these 39 IPMNs, 6 (15%) were methylated at p16 and the remaining 33 showed unmethylation of this gene. Overall, loss of nuclear labeling for p16 was detected in 13 of 39 IPMNs (33%) and was found exclusively in high-grade IPMNs but not in low-grade IPMNs. Importantly, p16 expression was significantly associated with its methylation status (Figure 4); loss of nuclear staining was detected in 5 of 6 IPMNs (83%) with methylated p16 but in only 8 of 33 IPMNs (24%) with unmethylated p16 (Fisher exact test, P ⫽ 0.01). Figure 1. Methylation profiles of multiple loci in IPMNs. The methylation status of 7 CpG islands in 51 IPMNs is shown. ■, methylated alleles in the neoplasm; 䊐, unmethylated alleles in the neoplasm.
higher in high-grade IPMNs than in low-grade IPMNs (91% vs. 67%; Fisher exact test; P ⫽ 0.05). Of the genes tested, ppENK and p16 were methylated more frequently in high-grade IPMNs than in low-grade IPMNs (ppENK, 82% vs. 28%, P ⫽ 0.0002; p16, 21% vs. 0%, P ⫽ 0.04). Furthermore, the average number of methylated loci was significantly higher in high-grade IPMNs than in lowgrade IPMNs (2.4 vs. 0.9; Mann-Whitney U nonparametric test; P ⫽ 0.0008). When the methylation pattern of each locus in the IPMNs was compared with that in pancreatic adenocarcinomas,25,26 MICP38 and ppENK were methylated at a higher frequency in pancreatic adenocarcinomas than in IPMNs (MICP38, 41% vs. 16%, P ⫽ 0.003; ppENK, 93% vs. 63%, P ⬍ 0.0001; Table 2). However, there were no significant differences in the methylation fre-
Discussion In the present study, we examined the methylation status of 7 CpG islands in a panel of 51 IPMNs. We found (1) aberrant methylation of at least one of these CpG islands in most (⬎80%) IPMNs; (2) that
Figure 2. Methylation-specific PCR analysis of MICP25 and p16 in IPMNs. DNA samples extracted from normal pancreata (NP) or IPMNs (samples 963, 096, 921, and 040) were amplified with primers specific to the unmethylated (U) or methylated (M) templates after modification with sodium bisulfite.
July 2002
ABERRANT DNA METHYLATION IN PANCREATIC IPMNS
369
Table 2. Methylation Status of Multiple CpG Islands in Low-Grade and High-Grade IPMNs Samples
Any locusa
MICP25
MICP27
MICP36
MICP38
ppENK
p16
THBS1
Low-grade IPMNsb (n ⫽ 18) High-grade IPMNsc (n ⫽ 33) Total (n ⫽ 51) Pancreatic adenocarcinomasd
67 91 82 95
6 27 20 15
33 58 49 48
6 15 12 19
11 18 16f 41
28 82e 63f 93
0 21e 14 18
6 15 12 7
NOTE. All values are expressed as percentages. THBS1, thrombospondin 1. a Methylation at any of the 7 CpG islands examined. b IPMNs that are classified as adenoma or borderline. c IPMNs that are classified as in situ carcinoma. d Data are from previous publications.25,26 n ⫽ 75 for any locus, MICPs, and ppENK and n ⫽ 45 for p16 and THBS1. e Statistically significant differences compared with low-grade IPMNs. f Statistically significant differences compared with pancreatic adenocarcinomas.
hypermethylation of ppENK and p16 was detected at a higher frequency in high-grade IPMNs than in lowgrade IPMNs; (3) that the average number of methylated loci was significantly higher in high-grade IPMNs than in low-grade IPMNs; and (4) that aberrant methylation of ppENK and p16 was associated with loss of expression. These results indicate that CpG island hypermethylation is one of the major pathways that contributes to the development and progression of IPMNs. Our results show that methylation abnormalities are present even in the low-grade (e.g., adenoma and borderline) IPMNs, providing evidence that CpG island methylation occurs relatively early in the natural history of IPMNs. Notably, the number of affected loci increases substantially as the tumor progresses from low-grade to high-grade IPMNs. Furthermore, some IPMNs with in situ carcinoma showed complete methylation of genes such as p16 and ppENK (Figure 2 and data not shown), suggesting that methylation defects may silence both
Figure 3. Reverse-transcription PCR analysis of ppENK in IPMNs. Strong expression is detected in 2 IPMNs (samples 981 and 816) unmethylated at ppENK, whereas 7 IPMNs having methylated ppENK show a loss of (samples 083, 050, 921, 482, 045, and 004) or weak (sample 979) expression of ppENK mRNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serves as an RNA control, and mRNA from a pancreatic cancer cell line (CFPAC1) treated with the demethylating agent 5-aza-2⬘-deoxycytidine (5Az-dC) serves as a positive control.
alleles of target genes in these high-grade neoplasms. Indeed, we found that hypermethylation of ppENK and p16 was almost always associated with loss of expression of these genes. These data suggest that aberrant methylation of p16, ppENK, and other genes may contribute to the malignant transformation of IPMNs. In support of this idea, a stepwise increase in de novo methylation of several genes has been reported during malignant progression of other tumor types, including pancreas,32 bladder,33 breast,34 and gastric35 cancers. Among the cancer-related genes analyzed, ppENK is the most frequently affected, with 63% of all IPMNs being methylated. Remarkably, more than 80% of highgrade IPMNs showed hypermethylation of this gene, whereas the frequency was only 28% in low-grade IPMNs. ppENK encodes a native opioid peptide [Met5]enkephalin, which is known to be a potent regulator of development, cell proliferation, angiogenesis, and wound healing.36 Importantly, several studies have suggested the tumorsuppressor properties of [Met5]enkephalin. For example, exposure of lung cancer cells to [Met5]enkephalin results in apoptotic cell death.37 Treatment with [Met5]enkephalin inhibits the growth of pancreatic cancer cells in vitro and in vivo.38,39 Our results raise the possibility that tests to detect aberrantly methylated genes in pancreatic juice, duodenal fluid, or stool samples have potential clinical use in refining preoperative diagnosis or the postoperative follow-up of patients with IPMNs.40 – 44 Because methylation abnormalities are both common in IPMNs and readily detectable using sensitive techniques such as methylation-specific PCR, these epigenetic alterations have the potential to be a sensitive marker for distinguishing high-grade IPMNs from low-grade IPMNs and nonneoplastic pancreatic lesions. Recent reports that aberrant methylation of p16 and other genes can be detected in DNA from blood or sputum of patients with
370
SATO ET AL.
GASTROENTEROLOGY Vol. 123, No. 1
Figure 4. Immunohistochemical labeling of IPMNs with an anti-p16 monoclonal antibody. Positive nuclear labeling for p16 is shown in low-grade IPMNs with unmethylated p16 (A and B), whereas the nuclear staining is lost in high-grade IPMNs with methylated p16 (C and D).
lung cancer or from ductal lavage fluid of patients with breast cancer support the feasibility of this approach.45– 48 In summary, we show for the first time that aberrant methylation of CpG islands is a frequent event in IPMNs and may contribute to their development and malignant progression.
References 1. Solcia E, Capella C, Klo¨ppel G. Tumors of the pancreas. In: Rosai J, Sobin LH, eds. Atlas of tumor pathology. 3rd series. Washington, DC: Armed Forces Institute of Pathology, 1997:31–144. 2. Fukushima N, Mukai K, Kanai Y, Hasebe T, Shimada K, Ozaki H, Kinoshita T, Kosuge T. Intraductal papillary tumors and mucinous cystic tumors of the pancreas: clinicopathologic study of 38 cases. Hum Pathol 1997;28:1010 –1017. 3. Nagai E, Ueki T, Chijiiwa K, Tanaka M, Tsuneyoshi M. Intraductal papillary mucinous neoplasms of the pancreas associated with so-called “mucinous ductal ectasia.” Histochemical and immunohistochemical analysis of 29 cases. Am J Surg Pathol 1995;19: 576 –589. 4. Loftus EV Jr, Olivares-Pakzad BA, Batts KP, Adkins MC, Stephens
5.
6.
7.
8.
9.
DH, Sarr MG, DiMagno EP. Intraductal papillary-mucinous tumors of the pancreas: clinicopathologic features, outcome, and nomenclature. Members of the Pancreas Clinic, and Pancreatic Surgeons of Mayo Clinic. Gastroenterology 1996;110:1909 – 1918. Paal E, Thompson LD, Przygodzki RM, Bratthauer GL, Heffess CS. A clinicopathologic and immunohistochemical study of 22 intraductal papillary mucinous neoplasms of the pancreas, with a review of the literature. Mod Pathol 1999;12:518 –528. Sohn TA, Yeo CJ, Cameron JL, Iacobuzio-Donahue CA, Hruban RH, Lillemoe KL. Intraductal papillary mucinous neoplasms of the pancreas: an increasingly recognized clinicopathological entity. Ann Surg 2001;234:313–321. Adsay NV, Conlon KC, Zee SY, Brennan MF, Klimstra DS. Intraductal papillary-mucinous neoplasms of the pancreas: an analysis of in situ and invasive carcinomas in 28 patients. Cancer 2002;94:62–77. Cuillerier E, Cellier C, Palazzo L, Deviere J, Wind P, Rickaert F, Cugnenc PH, Cremer M, Barbier JP. Outcome after surgical resection of intraductal papillary and mucinous tumors of the pancreas. Am J Gastroenterol 2000;95:441– 445. Sho M, Nakajima Y, Kanehiro H, Hisanaga M, Nishio K, Nagao M, Ikeda N, Kanokogi H, Yamada T, Nakano H. Pattern of recurrence
July 2002
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
after resection for intraductal papillary mucinous tumors of the pancreas. World J Surg 1998;22:874 – 878. Cellier C, Cuillerier E, Palazzo L, Rickaert F, Flejou JF, Napoleon B, Van Gansbeke D, Bely N, Ponsot P, Partensky C, Cugnenc PH, Barbier JP, Deviere J, Cremer M. Intraductal papillary and mucinous tumors of the pancreas: accuracy of preoperative computed tomography, endoscopic retrograde pancreatography and endoscopic ultrasonography, and long-term outcome in a large surgical series. Gastrointest Endosc 1998;47:42– 49. Zamora C, Sahel J, Cantu DG, Heyries L, Bernard JP, Bastid C, Payan MJ, Sielezneff I, Familiari L, Sastre B, Barthet M. Intraductal papillary or mucinous tumors (IPMT) of the pancreas: report of a case series and review of the literature. Am J Gastroenterol 2001;96:1441–1447. Z’Graggen K, Rivera JA, Compton CC, Pins M, Werner J, Fernandez-del Castillo C, Rattner DW, Lewandrowski KB, Rustgi AK, Warshaw AL. Prevalence of activating K-ras mutations in the evolutionary stages of neoplasia in intraductal papillary mucinous tumors of the pancreas. Ann Surg 1997;226:491– 498 [discussion 498 –500]. Satoh K, Sasano H, Shimosegawa T, Koizumi M, Yamazaki T, Mochizuki F, Kobayashi N, Okano T, Toyota T, Sawai T. An immunohistochemical study of the c-erbB-2 oncogene product in intraductal mucin-hypersecreting neoplasms and in ductal cell carcinomas of the pancreas. Cancer 1993;72:51–56. Fujii H, Inagaki M, Kasai S, Miyokawa N, Tokusashi Y, Gabrielson E, Hruban RH. Genetic progression and heterogeneity in intraductal papillary-mucinous neoplasms of the pancreas. Am J Pathol 1997;151:1447–1454. Sato N, Rosty C, Jansen M, Fukushima N, Ueki T, Yeo CJ, Cameron JL, Iacobuzio-Donahue CA, Hruban RH, Goggins M. STK11/LKB1 Peutz-Jeghers gene inactivation in intraductal papillary-mucinous neoplasms of the pancreas. Am J Pathol 2001; 159:2017–2022. Goggins M, Kern SE, Offerhaus JA, Hruban RH. Progress in cancer genetics: lessons from pancreatic cancer. Ann Oncol 1999;10:4 – 8. Rozenblum E, Schutte M, Goggins M, Hahn SA, Panzer S, Zahurak M, Goodman SN, Sohn TA, Hruban RH, Yeo CJ, Kern SE. Tumor-suppressive pathways in pancreatic carcinoma. Cancer Res 1997;57:1731–1734. Schutte M, Hruban RH, Geradts J, Maynard R, Hilgers W, Rabindran SK, Moskaluk CA, Hahn SA, Schwarte-Waldhoff I, Schmiegel W, Baylin SB, Kern SE, Herman JG. Abrogation of the Rb/p16 tumor-suppressive pathway in virtually all pancreatic carcinomas. Cancer Res 1997;57:3126 –3130. Sessa F, Solcia E, Capella C, Bonato M, Scarpa A, Zamboni G, Pellegata NS, Ranzani GN, Rickaert F, Klo¨ppel G. Intraductal papillary-mucinous tumours represent a distinct group of pancreatic neoplasms: an investigation of tumour cell differentiation and K-ras, p53 and c-erbB-2 abnormalities in 26 patients. Virchows Arch 1994;425:357–367. Iacobuzio-Donahue CA, Klimstra DS, Adsay NV, Wilentz RE, Argani P, Sohn TA, Yeo CJ, Cameron JL, Kern SE, Hruban RH. Dpc-4 protein is expressed in virtually all human intraductal papillary mucinous neoplasms of the pancreas: comparison with conventional ductal adenocarcinomas. Am J Pathol 2000;157:755– 761. Wilentz RE, Su GH, Dai JL, Sparks AB, Argani P, Sohn TA, Yeo CJ, Kern SE, Hruban RH. Immunohistochemical labeling for dpc4 mirrors genetic status in pancreatic adenocarcinomas: a new marker of DPC4 inactivation. Am J Pathol 2000;156:37– 43. Moore PS, Orlandini S, Zamboni G, Capelli P, Rigaud G, Falconi M, Bassi C, Lemoine NR, Scarpa A. Pancreatic tumours: molecular pathways implicated in ductal cancer are involved in ampullary but not in exocrine nonductal or endocrine tumorigenesis. Br J Cancer 2001;84:253–262.
ABERRANT DNA METHYLATION IN PANCREATIC IPMNS
371
23. Jones PA, Laird PW. Cancer epigenetics comes of age. Nat Genet 1999;21:163–167. 24. Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 2000;16:168 –174. 25. Ueki T, Toyota M, Sohn T, Yeo CJ, Issa JP, Hruban RH, Goggins M. Hypermethylation of multiple genes in pancreatic adenocarcinoma. Cancer Res 2000;60:1835–1839. 26. Ueki T, Toyota M, Skinner H, Walter KM, Yeo CJ, Issa JP, Hruban RH, Goggins M. Identification and characterization of differentially methylated CpG islands in pancreatic carcinoma. Cancer Res 2001;61:8540 – 8546. 27. Moskaluk CA, Kern SE. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections. Am J Pathol 1997;150:1547–1552. 28. Goggins M, Hruban RH, Kern SE. BRCA2 is inactivated late in the development of pancreatic intraepithelial neoplasia: evidence and implications. Am J Pathol 2000;156:1767–1771. 29. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996;93:9821–9826. 30. Geradts J, Wilentz RE, Roberts H. Immunohistochemical detection of the alternate INK4a-encoded tumor suppressor protein p14ARF in archival human cancers and cell lines using commercial antibodies: correlation with p16INK4a expression. Mod Pathol 2001;14:1162–1168. 31. Nielsen GP, Stemmer-Rachamimov AO, Shaw J, Roy JE, Koh J, Louis DN. Immunohistochemical survey of p16INK4A expression in normal human adult and infant tissues. Lab Invest 1999;79: 1137–1143. 32. Fukushima N, Sato N, Ueki T, Rosty C, Walter KM, Wilentz RE, Yeo CJ, Hruban RH, Goggins M. Aberrant methylation of preproenkephalin and plb genes in pancreatic intraepithelial neoplasia and pancreatic ductal adenocarcinoma. Am J Pathol 2002;160: 1573–1581. 33. Salem C, Liang G, Tsai YC, Coulter J, Knowles MA, Feng AC, Groshen S, Nichols PW, Jones PA. Progressive increases in de novo methylation of CpG islands in bladder cancer. Cancer Res 2000;60:2473–2476. 34. Nass SJ, Herman JG, Gabrielson E, Iversen PW, Parl FF, Davidson NE, Graff JR. Aberrant methylation of the estrogen receptor and E-cadherin 5⬘ CpG islands increases with malignant progression in human breast cancer. Cancer Res 2000;60:4346 – 4348. 35. Kang GH, Shim YH, Jung HY, Kim WH, Ro JY, Rhyu MG. CpG island methylation in premalignant stages of gastric carcinoma. Cancer Res 2001;61:2847–2851. 36. Zagon IS, Wu Y, McLaughlin PJ. Opioid growth factor and organ development in rat and human embryos. Brain Res 1999;839: 313–322. 37. Maneckjee R, Minna JD. Opioids induce while nicotine suppresses apoptosis in human lung cancer cells. Cell Growth Diff 1994;5:1033–1040. 38. Zagon IS, Smith JP, McLaughlin PJ. Human pancreatic cancer cell proliferation in tissue culture is tonically inhibited by opioid growth factor. Int J Oncol 1999;14:577–584. 39. Zagon IS, Hytrek SD, Smith JP, McLaughlin PJ. Opioid growth factor (OGF) inhibits human pancreatic cancer transplanted into nude mice. Cancer Lett 1997;112:167–175. 40. Iwao T, Tsuchida A, Hanada K, Eguchi N, Kajiyama G, Shimamoto F. Immunocytochemical detection of p53 protein as an adjunct in cytologic diagnosis from pancreatic duct brushings in mucinproducing tumors of the pancreas. Cancer 1997;81:163–171. 41. Inoue H, Tsuchida A, Kawasaki Y, Fujimoto Y, Yamasaki S, Kajiyama G. Preoperative diagnosis of intraductal papillary-mucinous tumors of the pancreas with attention to telomerase activity. Cancer 2001;91:35– 41. 42. Kaino M, Kondoh S, Okita S, Hatano S, Shiraishi K, Kaino S, Okita K. Detection of K-ras and p53 gene mutations in pancreatic
372
43.
44.
45.
46.
SATO ET AL.
juice for the diagnosis of intraductal papillary mucinous tumors. Pancreas 1999;18:294 –299. Kondo H, Sugano K, Fukayama N, Hosokawa K, Ohkura H, Ohtsu A, Mukai K, Yoshida S. Detection of K-ras gene mutations at codon 12 in the pancreatic juice of patients with intraductal papillary mucinous tumors of the pancreas. Cancer 1997;79: 900 –905. Tateishi K, Tada M, Yamagata M, Isayama H, Komatsu Y, Kawabe T, Shiratori Y, Omata M. High proportion of mutant K-ras gene in pancreatic juice of patients with pancreatic cystic lesions. Gut 1999;45:737–740. Evron E, Dooley WC, Umbricht CB, Rosenthal D, Sacchi N, Gabrielson E, Soito AB, Hung DT, Ljung B, Davidson NE, Sukumar S. Detection of breast cancer cells in ductal lavage fluid by methylation-specific PCR. Lancet 2001;357:1335–1336. Esteller M, Sanchez-Cespedes M, Rosell R, Sidransky D, Baylin SB, Herman JG. Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients. Cancer Res 1999;59:67–70.
GASTROENTEROLOGY Vol. 123, No. 1
47. Belinsky SA, Nikula KJ, Palmisano WA, Michels R, Saccomanno G, Gabrielson E, Baylin SB, Herman JG. Aberrant methylation of p16(INK4a) is an early event in lung cancer and a potential biomarker for early diagnosis. Proc Natl Acad Sci U S A 1998; 95:11891–11896. 48. Palmisano WA, Divine KK, Saccomanno G, Gilliland FD, Baylin SB, Herman JG, Belinsky SA. Predicting lung cancer by detecting aberrant promoter methylation in sputum. Cancer Res 2000;60: 5954 –5958.
Received March 6, 2002. Accepted April 8, 2002. Address requests for reprints to: Michael Goggins, M.D., Departments of Pathology, Medicine, and Oncology, The Johns Hopkins Medical Institutions, 632 Ross Building, 720 Rutland Avenue, Baltimore, Maryland 21205. e-mail: [email protected]; fax: (410) 614-0671. Supported by the National Institutes of Health SPORE grant in gastrointestinal malignancies (CA62924), the Lustgarten Foundation for Pancreatic Cancer Research, and the Michael Rolfe Foundation.