Absence of a conventional spindle mitotic checkpoint in the binucleated single-celled parasite Giardia intestinalis

Accepted Manuscript Title: Absence of a conventional spindle mitotic checkpoint in the binucleated single-celled parasite Giardia intestinalis Author: Kristyna Markova Magdalena Uzlikova Pavla Tumova Klara Jirakova Guy Hagen Jaroslav Kulda Eva Nohynkova PII: DOI: Reference:

S0171-9335(16)30060-7 http://dx.doi.org/doi:10.1016/j.ejcb.2016.07.003 EJCB 50893

To appear in: Received date: Revised date: Accepted date:

1-5-2016 19-6-2016 13-7-2016

Please cite this article as: Markova, Kristyna, Uzlikova, Magdalena, Tumova, Pavla, Jirakova, Klara, Hagen, Guy, Kulda, Jaroslav, Nohynkova, Eva, Absence of a conventional spindle mitotic checkpoint in the binucleated single-celled parasite Giardia intestinalis.European Journal of Cell Biology http://dx.doi.org/10.1016/j.ejcb.2016.07.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Absence of a conventional spindle mitotic checkpoint in the binucleated single-celled parasite Giardia intestinalis Running title: Control of Giardia mitosis

Kristyna Markova1, Magdalena Uzlikova1, Pavla Tumova1, Klara Jirakova1, Guy Hagen2, Jaroslav Kulda3, and Eva Nohynkova1*

Department of Tropical Medicine, 1st Faculty of Medicine, Charles University in Prague, Studnickova 7, Prague 2, Czech Republic1 Institute of Cellular Biology and Pathology, 1st Faculty of Medicine, Charles University in Prague, Albertov 4, Prague 2, Czech Republic2 Department of Parasitology, Faculty of Science, Charles University in Prague, Vinicna 7, Prague 2, Czech Republic3

* Corresponding author. Mailing address: Department of Tropical Medicine, Studnickova 7, Prague 2, Czech Republic, Phone: +420 224968525. Fax: +420 224968525. Email: [email protected]

ABSTRACT The spindle assembly checkpoint (SAC) joins the machinery of chromosome-to-spindle microtubule attachment with that of the cell cycle to prevent missegregation of chromosomes during mitosis. Although a functioning SAC has been verified in a limited number of organisms, it is regarded as an evolutionarily conserved safeguard mechanism. In this report, we focus on the existence of the SAC in a single-celled parasitic eukaryote, Giardia intestinalis. Giardia belongs to Excavata, a large and diverse supergroup of unicellular eukaryotes in which SAC control has been nearly unexplored. We show that Giardia cells with absent or defective mitotic spindles due to the inhibitory effects of microtubule poisons do not arrest in mitosis; instead, they divide without any delay, enter the subsequent cell cycle and even reduplicate DNA before dying. We identified a limited repertoire of kinetochore and SAC components in the Giardia genome, indicating that this parasite is ill equipped to halt mitosis before the onset of anaphase via SAC control of chromosomespindle microtubule attachment. Finally, based on overexpression, we show that Giardia Mad2, a core SAC protein in other eukaryotes, localizes along intracytoplasmic portions of caudal flagellar axonemes, but never within nuclei, even in mitotic cells with blocked spindles, where the SAC should be active. These findings are consistent with the absence of a conventional SAC, known from yeast and metazoans, in the parasitic protist Giardia. Keywords Giardia, single-celled eukaryote, spindle assembly checkpoint, kinetochore, Mad2, albendazole

2

INTRODUCTION The accurate mitotic segregation of chromosomes into daughter cells represents a universal mechanism for maintaining genetic information in eukaryotes. While the organization of mitosis differs among eukaryotes, ranging from fully closed to open mitosis depending on the behavior of the nuclear envelope and the positioning of microtubule organizing centers (MTOCs) for mitotic spindle assembly (Drechsler and McAinsh, 2012), the function of mitosis is always the same: proper bi-polar chromosome segregation, achieved via the attachment of sister chromatids to microtubules emanating from opposite poles of the mitotic spindle prior to anaphase onset (Tanaka, 2002). During metaphase, a molecular safeguard mechanism termed the spindle assembly checkpoint (SAC) monitors the correctness of chromosome attachment to spindle microtubules (Musacchio and Salmon, 2007). If unattached chromosome(s) are present, their kinetochores generate a signal for the spindle checkpoint cascade to halt cells in metaphase via inhibition of E-ubiquitin ligase (known as the anaphase promoting complex, APC/C). Sister chromatids remain connected because securin, a protein responsible for suppressing the activity of separase, which destroys (cleaves) chromatid cohesion, cannot be degraded by the proteasome, and, consequently, separase remains inactive. The SAC thereby prevents chromosome missegregation and aneuploidy in progeny. Mutations in SAC proteins can result in cancer (Gordon et al., 2012). Core components of the SAC, consisting of the proteins Mad2, Mad3/BubR1, Bub3 and Cdc20, form a heterotetramer termed the mitotic checkpoint complex (MCC) (Foley and Kapoor, 2013). These proteins are conserved from yeast to humans, i.e., in closely evolutionarily related eukaryotes nested within the eukaryote supergroup Opisthokonta (Adl et al., 2012). Moreover, a recent phylogenomic study (Vleugel et al., 2012) showed that MCC homologues are present in representatives of nearly all eukaryote supergroups, suggesting the ancientness of these proteins or even of the SAC pathway itself. Comparative genomics suggest that the SAC may already have been present in the last eukaryotic common ancestor (LECA) (Vleugel et al., 2012).

3

Surprisingly, the genomes of a number parasitic species of unicellular eukaryotes, such as Plasmodium falciparum, Leishmania major, Trypanosoma brucei, Cryptosporidium parvum and Entamoeba histolytica, lack genes for most or all regulatory components of the SAC (Akiyoshi and Gull, 2013; Eme et al., 2011; Vleugel et al., 2012), which could indicate the existence of alternative control mechanisms independent of the SAC or that MCC genes have diverged in single-celled eukaryotes. Variations found in the few protozoan parasites in which cell cycle control has been studied, such as the malaria parasite Plasmodium or trypanosomes, which cause sleeping sickness (Arnot et al., 2011; Hammarton, 2007), support the former possibility. The remarkable (uncommon) localization of the core SAC protein Mad2 in the basal body area outside the nucleus in Trypanosoma cells further supports this idea (Akiyoshi and Gull, 2013). Similar to trypanosomes, Giardia intestinalis is also a representative protist from the eukaryotic supergroup Excavata. According to some phylogenetic studies (Yubuki and Leander, 2013), Excavata is regarded as a stem group from which all other eukaryotes evolved. Members of this supergroup are therefore important for studying the conservation of eukaryotic pathways. G. intestinalis is a unicellular parasite that causes diarrhea in humans and animals worldwide. Eight-flagellated trophozoites (the pathogenic form of the parasite), colonize the lumen of the upper small intestine, where they multiply while attached to enterocytes, resulting in the pathophysiology of the disease. Taxonomically, Giardia belongs to the diplomonads, which constitute an interesting group of protists that possess duplicated sets of core organelles, specifically the basal bodies/flagella and nuclei, with Giardia cells exhibiting two similar, transcriptionally active nuclei in interphase (Kabnick and Peattie, 1990). Each nucleus contains a complete copy of a compact 12-Mb genome distributed on five chromosomes (Yu et al., 2002). According to molecular karyotyping, Giardia cells are tetraploid (Hou et al., 1995), suggesting that each nucleus is diploid. Cytogenetic karyotyping of single cells revealed different chromosome numbers between cell nuclei in certain isolates, indicating tolerance for aneuploidy in Giardia (Tůmová et al., 2007; 2016).

4

A bi-nucleate Giardia undergoes a canonical cell cycle (G1/S/G2/M) (Bernander et al., 2001). Under standard conditions, a G2 cell enters M phase when its two nuclei divide in parallel using their own spindles (Nohýnková et al., 2000). Mitosis is semi-open, meaning that the spindle poles are cytoplasmic; each spindle is composed of extra- and intra-nuclear microtubules, with the latter penetrating the nucleus through tiny polar openings in the intact nuclear envelope (Sagolla et al., 2006; Tůmová et al., 2007). Mitosis lasts approximately three minutes and exhibits some unusual features, such as premature chromatid separation and non-alignment of chromosomes at the metaphase plate. Instead, chromosomes cluster in the center of the metaphase nucleus, and chromosomes stretch along spindle microtubules during anaphase (Tůmová et al., 2007; 2015). Moreover, Giardia mitosis proceeds independent of the APC (Gourguechon et al., 2013). Considering that premature chromatid separation is associated with mutations in the human spindle checkpoint protein BUBR1 (Bohers et al., 2008) and that experimentally induced premature chromatid separation (Hoque and Ishikawa, 2002) and chromosome misalignment (Ma et al., 2007) activate the SAC in human cells, current work in Giardia suggests deviations from a general scheme of mitotic control in this parasite. In the present study, we therefore examined the presence or absence of the SAC in Giardia by preventing spindle formation and inhibiting the proteolytic degradation necessary for mitotic progression, in addition to screening for the presence of kinetochore and SAC components in the Giardia genome and analyzing their expression and localization in Giardia cells. MATERIALS AND METHODS Cultures, media, growth conditions and inhibitory tests The HP-1 line of the G. intestinalis isolate Portland-1 (ATCC 30888), provided by E. A. Meyer (Oregon Health Sciences University, Portland, USA), was used in this study. Trophozoites were cultivated axenically in bovine bile-supplemented TYI-S-33 medium, pH 6.8, at 37°C and sub-cultured twice a week. Stock solutions of 1 mg/ml albendazole (Sigma), 5 mg/ml nocodazole (Sigma) and 1 mM (100 µg/180 µl) epoxomicin (Calbiochem Cat No. 324800) 5

were prepared in sterile dimethyl sulfoxide (DMSO) and stored at 4°C (albendazole) or -20°C (nocodazole and epoxomicin). Just before use, each stock solution was diluted in culture medium to the desired final concentration, which was 100 ng/ml for albendazole (≈ 400 nM), 10 ng/ml for nocodazole (≈ 33.3 nM) and 5 µM for epoxomicin. The final concentration of DMSO was always less than 0.1%. To test the effect of the anti-microtubule drugs albendazole and nocodazole on mitotic progression, cells were grown in medium without the inhibitor until they formed an approximately 70% confluent monolayer. Then, the spent medium was poured out, and the adherent cells were immediately overlaid with pre-warmed fresh medium containing the inhibitor and incubated at 37° C. Cell suspensions were obtained by incubating the tubes or flasks on ice to detach adherent cells, which were then thoroughly re-suspended. Aliquots (50 µl) of the suspensions were immediately diluted 1:10 (v/v) with 1% formaldehyde/phosphate buffered saline (PBS) for determination of the number of cells and cell types using a hemocytometer. Cells were harvested via centrifugation (900×g, 4°C, 10 min) and used as the initial material for subsequent experiments. Immunostaining For immunostaining, anaerobic chambers with coverslips at the bottom were used as described previously (Nohýnková et al., 2006). The following antibodies were employed at the indicated dilutions (v/v) in 2%BSA/0.01% Tween-20/PBS, pH 7.2: anti-acetylated α-tubulin 1:500 (clone 6-11B-1, Sigma), anti-centrin 1:5 (BAS 6.8, a gift from Professor M. Melkonian, University of Cologne, Germany) and anti-MPM2 1:20 (clone 0.T.181, Abcam, ab14581). Briefly, cells on coverslips were fixed in ice-cold methanol (-20°C, 7 min), permeabilized in acetone (-20°C, 5 min) and air-dried. Then, the coverslips were rehydrated with PBS, pH 7.2 (10 min), and processed for immunostaining. An Olympus BX51 fluorescence microscope equipped with a DP70-UCB camera was used for observations. Confocal imaging was performed with a Leica SP5 confocal microscope equipped with a 100X/1.4NA oil-immersion objective (Leica HCX PL APO CS). FITC and propidium iodide (PI) were excited with 488 nm and 561 nm lasers, respectively. The spectral detection windows were set to 500-556 nm for FITC and 598-724 nm for PI. The XY pixel size was 6

50.5 nm, and the Z-step size was 126 nm. The confocal image stacks were deconvolved using a theoretical point spread function (PSF) and the classic maximum likelihood estimation (CLME) algorithm within Huygens Pro software. Maximum intensity projections were then generated using Image J. Transmission electron microscopy Fixation and embedding of Giardia cells for TEM was performed exactly as described previously (Nohýnková et al., 2006). Chromosome spreads Chromosome spreads were prepared as previously described (Tůmová et al., 2007). Briefly, cultured trophozoites were hypotonized, repeatedly fixed in methanol/acetic acid, dropped on glass slides and stained with DAPI. The preparations were observed on an Olympus BX51 fluorescence microscope. Bioinformatics The G. intestinalis genome at www.eupathdb.org was probed for the presence of kinetochore, chromatid cohesion/condensation and mitotic checkpoint genes. Gene ontology terms (GO:0000135: septin checkpoint; GO:0031577: spindle checkpoint; GO:0033597: mitotic checkpoint complex; GO:0031578: mitotic cell cycle spindle orientation checkpoint; GO:0007093: mitotic cell cycle checkpoint; GO:0007094: mitotic cell cycle spindle assembly checkpoint; and GO:0007096: regulation of exit from mitosis) from GeneDB Gene Ontology (www.geneontology.org) were chosen to establish a set of Saccharomyces cerevisiae genes (protein sequences) to be compared with the complete genome of G. intestinalis to localize putative mitotic checkpoint genes. The WU blastp algorithm and the G. intestinalis genome GiardiaDB 2.5 release sourced at www.giardiadb.org were used, and hits were manually curated (e.g., alignments, conserved domains and binding site searches were assessed to reveal the true identity of the Giardia protein best matching the yeast sequence). Selected sequences of putative homologs were compared with all accessible sequences at www.ncbi.nlm.nih.gov/blastp, and the most closely related sequences were retrieved to consider their homology. The individual pairs of identified G. intestinalis and input S. 7

cerevisiae proteins were aligned using ClustalX2 software, and identity/similarity scores were calculated for the full-length aligned sequences using BioEdit 7.0.0. The set of kinetochore genes to be searched for was based on the work of Perpelescu and Fukagawa (2011), and the approach was analogous. A similar search was run against the genome database of Trichomonas vaginalis to compare putative Giardia kinetochore proteins with the results obtained from another parasitic protozoan (Tab S1). Basic sets of condensin and cohesin reference sequences were obtained from S. cerevisiae and probed against the Giardia genome database (Tab S2). Western blot analysis Cells were washed with ice-cold PBS, pH 7.2, and centrifuged, and the pelleted cells were lysed for 30 min on ice with agitation in RIPA lysis buffer containing a protease inhibitor cocktail (Complete Mini, Roche). The crude lysate was clarified via centrifugation (13,000 x g, 15 min, 4°C), after which the supernatant was collected, and the protein concentration was determined with the BCA assay. Approximately 40 µg of total protein was loaded per lane (except for pOndra-mad2, for which only 2 µg was loaded) in a 10% SDS-PAGE gel, then separated and either stained with SimplyBlue SafeStain according to the manufacturer's instructions (Invitrogen) or transferred to a nitrocellulose membrane through semi-dry blotting (Trans-Blot SD cell, Bio-Rad). Subsequent steps were performed while gently agitating the membranes. The membrane was blocked over-night with 5% low-fat milk in Tris-buffered saline (TBS) at 4°C and then incubated with the following primary antibodies diluted in 5% low-fat milk/TBS: anti-ubiquitin at 1:1000 (Abcam, ab19247) and anti-HA (Tachezy donation) at 1:150 to 1:500 or (Sigma, H3663) 1:1000 for 2 h at room temperature (anti-ubiquitin) or over-night at 4°C (anti-HA antibodies). The membrane was next washed three times with TBST (TBS plus Tween 20) (HA) or 5% low-fat milk/TBST (ubiquitin) for 10 min each time, incubated for 1 h with the secondary antibody (anti-mouse IgG-HRP) diluted 1:2500 in 5% low-fat milk/TBS at RT and washed again as above. Finally, the membrane was washed with PBS and incubated with a luminol/peroxide substrate for 5 min in the dark. The substrate solution was then drained; the membrane was placed between filter papers to remove the 8

residual solution; and autoradiography film was exposed and processed according the manufacturer's instructions (Thermo Scientific). Immunoprecipitation of Mad2 and protein analysis via MALDI TOF Immunoprecipitation experiments were carried out with RIPA lysates obtained from pOndramad2 and PAC-pBS-mad2 transfected cells. Cells from 250-ml tissue flasks were harvested, pelleted and washed twice with ice-cold PBS. The pelleted cells were mechanically homogenized in liquid nitrogen. RIPA buffer was added to the dry pellet and lysates were prepared according to manufacturer instructions (RIPA buffer, Sigma) using approximately 1 ml of the buffer per 5 x 107 cells. The lysates were kept on ice and used immediately or stored at -80°C. To equilibrate protein G-coupled Sepharose beads (Roche), 100 mg of beads was washed with 1 ml of distilled water and then rinsed once with PBS and twice with RIPA buffer. Between each step, the beads were spun down (4300 rpm/1 min/table top minicentrifuge), and the supernatant was discarded. Finally, the beads were equilibrated with 400 µl of RIPA buffer with protease inhibitors (Complete Mini, Roche) and immediately used for immunoprecipitation. The beads (25 μl) were gently mixed with 10 μl of an anti-HA tag antibody (Sigma H3663) by constantly rotating the tube end-over-end for 1 h at 4°C. Then, the beads were spun down (12,000 x g, 1 min, at 4°C), washed twice with 1 ml of RIPA lysis buffer at 4°C with agitation and pelleted via centrifugation. After washing, the beads were mixed with 170 μl of cell lysate prepared as described above plus 500 μl of PBS and incubated for 2 h at 4°C with agitation. The beads were subsequently spun down, washed 4 times with RIPA buffer and once with PBS, and after the last wash and centrifugation, the beads were resuspended in 25 μl of 2x Laemmli buffer and boiled for 5 min to elute the HAtagged Mad2 and anti-HA tag antibody complexes. The eluted sample was separated via SDS-PAGE, and the gel was stained with Simply Blue (Invitrogen) according to the manufacturer’s instructions. A band of approximately 34 kDa was cut out and analyzed in a 4800 Plus MALDI TOF/TOF spectrometer (AB SCIEX) in the Laboratory of Mass Spectrometry at the Faculty of Science of Charles University in Prague. Detection of DNA synthesis 9

DNA synthesis was visualized using an immunofluorescence assay for the detection of 5-bromo-2-deoxy-uridine (BrdU) incorporation into DNA (5-bromo-2-deoxy-uridine Labeling and Detection Kit I, Roche). The trophozoites were pulse-chased with 10 µM BrdU for 50 min at 37°C and then processed according to the manufacturer's instructions and Hofstetrova et al. (2010). Flow cytometry analysis For flow cytometry, Giardia trophozoites were fixed as previously described (Bernander et al., 2001). Briefly, approximately 1 × 107 cells were harvested via centrifugation (900 × g). The pelleted cells were then resuspended in a solution of 50 μl of fresh TYI-S-33 medium plus 150 μl of fixative (1% Triton X-100/40 mM citric acid/20 mM dibasic sodium phosphate/200 mM sucrose, pH 3.0) and incubated for 5 min at RT. Next, 350 μl of the diluent buffer (125 mM MgCl2 in PBS, pH 7.4) was added, and the samples were stored at 4°C until analysis. The fixed cells were then centrifuged (4000 × g, 3 min), washed with PBS, resuspended in 500 μl of PBS with 1 μg of RNase A (Fermentas) and incubated at 37°C for 30 min. Finally, the cells were centrifuged, resuspended in 10 mM Tris/10 mM MgCl2 with 10 μg/ml PI (Sigma) and stained for 30 min. Flow cytometry analysis was performed using a FACS Canto II (BD Biosciences), and the data were analyzed using BD FACSDivaTM software. Selective Mad2 transformation of G. intestinalis The Mad2 homolog (GL50803_100955) was cloned from Giardia cDNA using the following primers: mad2F (GAATTCC CATATGGCTACCCAGACCAAGAATGC) and mad2R (GCG GGATCC CAGCGCTTCCTCTCCAGACTT). The full-length sequence was cloned into the pOndra plasmid (a gift from Pavel Doležal, Charles University in Prague) under the control of a GDH promoter and flanked at the C-terminus by a 3xHA tag. Ampicillin and G418 resistance were encoded by the plasmid, which is maintained as an episome after transfection and selection. Approximately 1×107 trophozoites (in 300 µl) were incubated with 10-30 µg of the plasmid on ice for 15 min and electroporated at 350 V for 175 msec (Gene Pulser Xcell Electroporation System, Bio-Rad). Giardia cells containing the plasmid were 10

selected with G418 (Invitrogen) as follows: 24 h after transfection, cells were left in nonselective culture medium; for the following 4 days, the selective culture medium containing 150 µg/ml G418 was replaced daily; finally, the G418 concentration was increased to 600 µg/ml, and the medium was changed every other day. Stable transfection was established within 2-3 weeks. Empty vector-transfected cells were prepared as a control. Transfectants were sub-cloned via limiting dilution to obtain single-cell clones. Alternatively, Giardia Mad2 was cloned along with the 200 nt sequence upstream of the start codon (serving as a native promoter) into the PAC-pBS plasmid (a gift from Staffan G. Svärd, Uppsala University, Sweden) with HA tag at C-terminus using the following primers: pAC200mad2-F (HindIII) (CCCAAGCTTATTATCAGCTTTTCATAGAT) and pAC200mad2-R (NotI)

(TATCAAATGCGGCCGCCAGCGCTTCCTCTCCAGACT).

Puromycin

resistance,

encoded by the plasmid, was used for selection. All constructs were sequenced. At least three independent transfections with different plasmids were performed and used for subsequent experiments, which were repeated several times. RESULTS Giardia undergoes cell division in the absence of nuclear division We previously identified a benzimidazole derivative, albendazole, as an inhibitor of mitotic spindle assembly in Giardia cells (Nohýnková et al., 2000). Therefore, to investigate whether inhibition of spindle formation halts mitotic progression, Giardia cells were exposed to a low dose of albendazole (100 ng/ml). As expected, spindles did not form: no spindle microtubules were observed via immunostaining and transmission electron microscopy in any albendazole-treated cell (Fig. 1A-C). Consequently, the nuclei did not divide (Fig. 1A, C). However, the chromosomes condensed (Figs. 1A, 2A), and mitotic phosphoproteins recognized by the MPM2 antibody (Davis et al., 1983; Westendorf et al., 1994) were detected (Fig. 1D), suggesting entry into mitosis. Cells possessing blocked nuclei with condensed chromosomes progressed through M-phase, and the majority of these cells completed cytokinesis: the number of cells increased approximately 1.7 times over 9 h of exposure to the drug (an interval corresponding to the doubling time (cell cycle) of control 11

cells) (Fig. 1E). The characteristic reorganization of basal bodies/flagella that occurs during Giardia cell division (Nohýnková et al., 2006) proceeded exactly as in the control mitotic cells: two complexes of parental basal bodies (centriolar homologues and MTOCs for Giardia mitotic spindles) were laterally separated and finally reached an inter-MTOC distance of between 8.5 and 9.5 µm, as in normal telophase (Fig. 2A); normal separation of the basal body complexes was evident based on the presence of centrin, a calcium-binding protein localized at basal body areas in Giardia (Belhadri, 1995) (Fig. 2B), and the observed flagella rearrangement was in accord with that in a normally dividing cell (Figs. 2A,B). Mitotic progression was not delayed, as indicated by similar percentages of cells with reorganizing flagella in the presence or absence (control mitotic cells) of albendazole, 6.8% (32/440) or 6% (31/517), respectively. Nuclei of cells undergoing cytokinesis without mitosis Surprisingly, non-divided parent nuclei (two per cell) disengaged from the separating MTOCs (Figs. 1A, D; 2A, B). Then, during cytokinesis, the nuclei were irregularly distributed between progeny. The resulting cells possessed two, one or no nuclei (Fig. 2D) and exhibited clear non-adherent phenotypes due to the parallel effect of albendazole on microtubule assembly in adhesive discs, a Giardia-specific attachment organelle (Holberton, 1973). In an asynchronous population, the percentage of these phenotypes gradually increased, reaching 98 - 100% after 9 h of treatment (Fig. 2E) (the generation time of this line of Giardia is 9.2 h; because cells in asynchronous culture enter mitosis at different times, to cover one cell cycle, we followed the accumulation of aberrant phenotypes over a 9-h period after drug addition). Thus, any cell that entered and progressed through M-phase of the cell cycle in the presence of albendazole underwent division without karyokinesis. Complete cytokinesis occurred in approximately 80% of these cells. Approximately 20% of the progeny did not undergo the final separation: daughter cells remained connected through their caudal portions and formed bi-nucleate doublets (Figs. 2D, F). This effect explains the slight decrease in cell number (a doublet was counted as one cell) compared with control populations over the 9-h interval (Fig. 1E). The albendazole-affected, non-adherent aberrant progeny survived without 12

subsequent division for a further 48 h and then died. The consistent effect of albendazole on Giardia was confirmed by investigating hundreds of cells in many repeated experiments. Unequivocally, there was no phenotypic evidence of control of chromosome segregation in these cells through either inhibition of mitotic progression or cell death prior to anaphase onset. DNA reduplication in progeny produced by cytokinesis without karyokinesis We performed flow cytometry analyses to confirm that undergoing cytokinesis without karyokinesis leads albendazole-treated cells to generate progeny with a DNA content corresponding to that of premitotic G2 mother cells, i.e., bi-nucleate cells with a DNA content of 8N (2 x 4N) (Bernander et al., 2001). Surprisingly, some of the descendants exhibited a DNA content that was significantly higher than that of the G2 cells (Fig. S1 A, D). DNA synthesis, as determined via BrdU incorporation, was detected in the nuclei of approximately 50% of these cells, in both single cells and doublets, after 12 h of incubation with albendazole (Fig. S1B). When exposed to albendazole for an additional 12 h, the nuclei of approximately 7% of the cells possessed condensed chromosomes. Chromosomal spreads showed as many as twenty chromosomes per nucleus, twice the number that occurs in a normal mitotic cell (Fig. S1C). Giardia undergoes cell division in the presence of defective spindles To exclude the possibility that a total release of nuclei from spindle MTOCs may override the SAC in albendazole-treated cells, we exposed cells to the related inhibitor nocodazole, which partially blocks spindle assembly in Giardia (Sagolla et al., 2006). Exposing trophozoites to a low concentration of nocodazole (10 ng/ml ≈ 33.3 nM) resulted in the formation of defective mitotic spindles (Fig. 3A) but did not block or slow mitotic progression, as would be expected assuming a functional SAC: 7 of 253 cells (2.8%) were mitotic, consistent with the number of mitotic cells in control populations (2.5%). The defective spindles caused irregular segregation of parent chromosomes between progeny, leading to an abnormal positioning and/or number (1 to 3) and size of the nuclei in 77.9% (125/162) of daughter cells, as determined by immunostaining (Fig. 3B). The results of inhibitory experiments using anti13

microtubular drugs therefore indicated that in Giardia, the SAC is either absent or nonfunctional. Proteasome inhibition does not cause mitotic arrest To support this conclusion, we also investigated an alternative activation pathway for the SAC independent of spindle damage, as reported by Zeng et al. (2010) in human cancer cells after proteasome inhibition. To block the proteasome, Giardia cells were treated with epoxomicin, a highly specific inhibitor of the eukaryotic 20S proteasome core particle (CP) (Groll and Huber, 2004) also found in Giardia (Emmerlich et al., 2001). We first verified that epoxomicin inhibits the Giardia proteasome: in response to 5 µM epoxomicin, a significant accumulation of ubiquitinated proteins was detected through Western blotting in lysates prepared from nonsynchronous populations (Fig. 4A). Next, we found that epoxomicin had little effect on the M-to-G1 transition. When pre-mitotic cells entered mitosis in the presence of the inhibitor, their nuclei passed through normal karyokinesis, which was followed by normal cytokinesis, as demonstrated by the number of normal daughter cells without a median body. The median body is a unique cytoskeletal structure of the genus Giardia, and its absence is specific to G1 (post-mitotic) Giardia cells (Červa and Nohýnková, 1992; Soloviev, 1963). After 120 min of exposure, the percentage of these cells (70.5%; N=427) corresponded to that in controls (77%; N=424) (Fig. 4B). Notable changes in the anaphase:telophase ratio (Fig. 4C) had no obvious effect on the duration of cell division. In conclusion, none of experimental conditions known to activate the SAC in other cells caused metaphase arrest in Giardia. Mitotic checkpoint pre-requisites in the Giardia genome As the inhibitory experiments strongly indicated an absence of the SAC, we next asked whether the parasite possesses the genetic potential to assemble a functioning checkpoint. Considering that the SAC acts at the kinetochore and its function depends on the hierarchical recruitment of well-defined checkpoint proteins to generate a catalytic platform at the kinetochore (Foley and Kapoor, 2013), we searched the Giardia genome for orthologs of kinetochore proteins and for mitotic spindle checkpoint genes based on gene ontologies 14

(www.geneontology.org) and the relevant literature. Kinetochore proteins in Giardia Selected human and yeast kinetochore proteins (reference sequences downloaded from NCBI) were subjected to BLAST searches against the Giardia genome using the BLAST service at giardiadb.org, and results were then manually curated with respect to features such as conserved domains and binding sites. This search revealed only a few significant kinetochore proteins (Tab. S1), indicating that the Giardia kinetochore, if present in a form described in model eukaryotes, is quite minimalistic (Fig. S2). In addition to CENP-A, a variant of histone H3 and an epigenetic mark of centromeric DNA, which directs kinetochore assembly and was described in Giardia by Dawson et al. (2007), we identified a candidate coiled-coil protein with an Smc domain (chromosome segregation protein domain COG1196), but a low E-value (5.9e-05) for CENP-C, while no other members of the constitutive centromere-associated network (CCAN) were found. The CCAN generates a platform at the centromere for mitotic kinetochore formation. In vertebrates, the network is composed of 16 proteins (Takeuchi and Fukagawa, 2012), among which CENP-C directly binds to CENP-A nucleosomes and interacts with the KMN network, a core kinetochore component that mediates both the attachment of spindle microtubules and SAC activation/silencing (Foley and Kapoor, 2013). Among the KMN network proteins, only Ndc80 and Nuf2 were found in the Giardia genome, with a promising E-value lower than 1e-10 being observed for Ndc80 (3e-10). We also identified convincing orthologs of two other proteins with microtubule-binding domains that associate with the outer kinetochore: mitotic kinesin CENP-E (E-value 7.2e-79) and CENP-F (7.4e-59). Importantly, we did not detect kinetochore null 1 (Knl1), a protein complex that plays a central role in the kinetochore-dependent activation of the SAC in vertebrates (Sacristan and Kops, 2015). A similar search was run against the genomic database for T. vaginalis to compare putative Giardia kinetochore proteins with results obtained from a related parasitic Excavate (Aurrecoechea et al. 2009). Analogous centromeric proteins and a few other relevant 15

proteins were identified. In comparison, T. vaginalis proteins were then found to be closer in sequence to human orthologs than to those from Giardia (Tab. S1). SAC proteins in Giardia Searches for orthologs of SAC components identified a Giardia homolog of the yeast or human spindle checkpoint executive protein Mad2 (GL_50803_100955, E-value 2e-45), showing a general identity to human Mad2A of 43% (64% positivity). The sequence did not markedly differ from that previously described for Mad2. The position of the conserved HORMA domain (188 aa) that spans almost the entire length of Mad2 (203 aa) did not deviate from other Mad2 proteins. The C-terminal portion, which encodes a seatbelt (or safety belt) motif that is essential for conformational changes and Cdc20 binding (Hsmad2, 150-205 aa), appeared to be well conserved in Giardia (Fig. S3). We noted only a short Cterminal glutamine-rich extension, which is also present in Mad2 from two other protozoan parasites,

Leishmania

and

Trypanosoma,

as

well

as

in

plants

(Arabidopsis,

Chlamydomonas). Whole-sequence alignment identified the Mad2 proteins of two kinetoplastids, Leishmania and Trypanosoma, as the nearest homologues of Giardia Mad2. Despite the convincing homology of Giardia Mad2, several SAC-associated genes (Bub1, Mad3, and securin) were missing. The sequences of Mad1, a binding partner of Mad2 during the sequestration of Cdc20, and Cdc20 itself were also very poorly conserved or missing. An analysis of the closest match to budding yeast and human Cdc20 (GL_50803_33762) revealed that a WD40 domain was present (E-value 5e-54), but the region required for direct interaction with Mad2 immediately upstream of the WD40 repeats (Sironi et al., 2001) did not resemble any of the described patterns. However, none of the Giardia WD40 genes fit the Cdc20 profile with greater identity. The overall homology to Cdc20 from humans (25% identity, E value 3.4e-09) and budding yeast (24% identity, E value 3.5 e-10) was very low. These results indicated that the gene set for the conventional SAC is reduced or insufficiently conserved, although Mad2, Bub3, Mps1, aurora kinase, and a large set of NEK-like kinases are present (e.g., GL50803_92498, 111938, 5142, 16479; over two hundred NEK kinases are annotated in the Giardia genome project at www.giardiadb.org). 16

In contrast to the results for the spindle checkpoint, members of the mitotic exit network (MEN) (Bub2, cdc-14 and tem-1) were identified as conserved homologues of human or budding yeast genes, as previously noted (Morrison et al., 2007). We also found other checkpoint genes that were convincingly conserved compared with yeast and human sequences (e.g., cdc15, cdc42, cla4, mob1, ste20) (Tab. S2). This result suggests that, in contrast to the SAC, the MEN, which is the second branch involved in the regulation of mitotic progression, may be conserved in Giardia. Giardia Mad2 expression and overexpression Mad2 is essential for the SAC-dependent inhibition of the APC via direct binding to Cdc20, an activator of the APC (Fang et al., 1998). Based on our findings and those of others (Eme et al., 2011) showing that Cdc20 is poorly conserved/absent in Giardia, in addition to Gourguechon et al. (2013) demonstrating that mitosis in Giardia is independent of the APC, and recent work indicating extra-nuclear localization of Mad2 in T. brucei (Akiyoshi and Gull, 2013) and Giardia (Vicente and Cande, 2014), we next investigated whether Mad2 is targeted/localized to nuclei during Giardia mitosis and in albendazole-treated Giardia cells. Thus, Mad2 was fused to a hemagglutinin (HA) tag and expressed in PAC-pBS-mad2 cells (normal level of expression) or overexpressed in pOndra-mad2 cells (13-fold overexpression on average), and the localization of the protein was followed in interphase and mitotic Giardia. The effect of Mad2 overexpression on cell-cycle progression was assessed using growth curves as well as DNA content and karyotype analyses. Mad2 localization in interphase and mitotic Giardia Immunofluorescence detection of the intracellular localization of the Mad2 protein was performed using an antibody against the HA tag. Surprisingly, the antibody recognized a region of intracytoplasmic axonemes of the caudal flagella (localized along the longitudinal axis of the cell) and the median body, but never the nuclei (Fig. 5A). The staining pattern was the same in interphase and mitotic cells, with various staining intensities being observed in individual cells (Fig. 5A, C). This unusual localization was found in a majority of pOndramad2 cells and in a few PAC-pBS-mad2 cells (3/200), consistent with low gene expression. 17

The same pattern was observed in dividing pOndra-mad2 cells exposed to albendazole (data not shown) and in the resulting aberrant progeny (Fig. 5D). Our results therefore confirm and further extend recent work by Vicente and Cande (2014). Similar results were obtained using clones derived from a single transfected cell (data not shown). Mad2 expression was confirmed by Western blotting using the same anti-HA antibody. Because the antibody consistently recognized a band of approximately 34 kDa (Fig. 5E), which is slightly larger than expected according to published data (Mapelli et al., 2007), the protein was purified via immunoprecipitation (IP), and its identity was verified through MALDITOF/TOF tandem mass spectrometry. In parallel, size-matching regions from total PAC-pBSmad2 (native expression) and pOndra-mad2 (overexpression) lysates separated via SDSPAGE were also analyzed. The results showed a single hit for the IP sample (except for contaminating human keratins and trypsin) (GL50803_100955, mitotic spindle checkpoint protein Mad2) (Tab. S3) and multiple hits for size-matching regions in the total lysates (Tab. S4). In the pOndra-mad2 lysate sample, Mad2 was identified as the 10th of 43 hits obtained from the cut-out gel region. The hit was significant according to the P score and was the first non-structural protein identified in the sample (the first nine hits were all giardins and tubulins, which are extremely abundant in Giardia cells). In the PAC-pBS-mad2 (normal expression) sample, Mad2 was not identified due to its low abundance compared with other proteins present in the sample. All of the identified proteins in this sample belonged to protein families that are abundant in Giardia cells (e.g., giardins, tubulin, metabolic enzymes and ribosomal proteins). Characteristics of Mad2-overexpressing cells Mad2-overexpressing lines thrived soon after transfection, equally as well as control cells transfected with an empty vector. Cells overexpressing Mad2 did not show any phenotypic abnormalities regarding cell size, cell and mitotic spindle morphology, and the organization of mitosis (Fig. 5A, C). Karyotypes with a prevailing 9 + 11 chromosome composition of two nuclei in single cells were in agreement with control populations (Fig. 5F). No changes in the DNA content distribution were found via flow cytometry (data not shown). Mad2 18

overexpression lengthened the doubling time (generation time) by approximately 1.5-fold versus the control populations, but the Mad2-overexpressing cells reached similar densities to the control cells within approximately 120 h (Fig. 5B). Albendazole treatment of the Mad2overexpressing cells resulted in cytokinesis without karyokinesis, just as in the control cells (see above), leading to aberrant progeny with characteristic phenotypes. Importantly, in these cells, Mad2 was localized along caudal flagellar axonemes, but not within nuclei (Fig. 5D). DISCUSSION In this study, we have focused on the presence of the SAC in an evolutionarily distant parasitic protist, G. intestinalis. We showed that Giardia cells in which mitotic spindles are absent or defective do not arrest in mitosis; instead, they divide without any delay, enter the subsequent cell cycle and even reduplicate their DNA before dying. Then, we identified only a limited repertoire of kinetochore and SAC members in the Giardia genome. Finally, we showed that overexpressed Mad2, a core protein of the MCC, localizes along intracytoplasmic portions of the caudal flagella, but never within nuclei. This particular finding is in agreement with the recent work of Vicente and Cande (2014), who described a similar pattern of Mad2 localization. We conclude that Giardia does not possess a conventional SAC as a mechanism for avoiding genomic instability. Cytokinesis without nuclear division in Giardia exposed to mitotic poisons Our experiments involving microtubule poisons (a commonly used functional assay for checkpoint control (Meraldi et al., 2004; Shao et al., 2013)) demonstrated that the parasite continues division without monitoring whether chromosomes are attached to spindle microtubules or not. Giardia regularly underwent cytokinesis even though no spindle microtubules were formed and intact nuclei had been separated from segregated basal body complexes (Giardia MTOCs for mitotic spindles). Importantly, these nuclei enter mitosis, as evident from the mitosis-specific phosphorylation of the nuclear envelope and condensation of chromosomes. The fact that chromosomes condensed is crucial for evaluating the presence of the SAC. In model eukaryotes, the condensation of prophase chromosomes is 19

accompanied by the assembly of kinetochores competent for attachment to spindle microtubules (Roy et al., 2013). Kinetochores are indispensable for activating the SAC (Musacchio, 2011; see below). Although in Giardia, the exact timing of kinetochore assembly is as yet unknown, we assume that a fully competent kinetochore is built up on condensing chromosomes during early mitosis, as observed in other eukaryotes. Therefore, the SAC, if present in albendazole-treated Giardia, should trigger pre-anaphase arrest, as none of the condensed chromosomes were attached to spindle microtubules. However, compared with untreated control cells, we observed no changes in the duration of the prophase-to-telophase period in albendazole-treated cells or in cells exposed to nocodazole, which hinders but does not block spindle assembly at the low concentration used. Thus, we obtained experimental evidence that in Giardia, any safeguard mechanism that halts mitosis in the presence of unattached chromosomes does not work. In this respect, Giardia resembles another singlecelled eukaryote, the parasitic kinetoplastid T. brucei. Much like Giardia, cytokinesis in trypanosomes occurs independent of the mitotic spindle, as shown by inhibition of spindle assembly with the antimitotic agent rhizoxin (Ploubidou et al., 1999). There has also been no delay in mitosis progression observed in trypanosomes. The signal from a functioning SAC is generally though to originate at kinetochores that are not attached to spindle microtubules. Specifically, an outer kinetochore multiprotein complex termed the KMN network is responsible for both contacting spindle microtubules and the hierarchical recruitment of MCC proteins to produce a SAC signal. The KMN is composed of three subcomplexes with different, yet interconnected functions. According to current models, the Ndc80 complex is primarily required to bind spindle microtubules, while the Knl1 complex represents a principle platform/site for the recruitment of MCC proteins, and the Mis12 complex links the KMN network to centromeric DNA via association with CCAN proteins (Sacristan and Kops, 2015). Due to the small size of Giardia chromosomes and their lack of primary constrictions (Tůmová et al., 2007, 2015), the architecture of the Giardia kinetochore is unknown. According to findings in the Giardia genome, the kinetochore seems to be very simple. In the genome, we and others (Akiyoshi and Gull, 2014; Vleugel et al., 2012) 20

identified only members of the microtubule binding Ndc80 complex. In contrast, the repeatedly reported absence of components of the Knl1 complex (Vicente and Cande 2014; Vleugel et al. 2012; this paper) calls into question the possibility of assembling the MCC in Giardia as such. The current model of SAC activation starts with the phosphorylation of Knl1 by the Mps1 kinase. When phosphorylated, Knl1 creates a docking site for Bub1, a SAC protein kinase required for the kinetochore localization of Mad1, a binding partner of Mad2. Mad2, along with Bub3 and Mad3, constitutes the final effector pathway of the MCC (Sacristan and Kops, 2015). However, in parallel with Knl1, neither Bub1 nor Mad1 were found in the Giardia genome (Manning et al., 2011; Vleugel et al., 2012; this paper). Thus, in addition to a kinetochore scaffold for MCC assembly, Giardia also lacks upstream proteins of the SAC signaling cascade. Moreover, Cdc20, a protein downstream of the SAC that is necessary for direct inhibition of the APC and, consequently, for metaphase arrest (see below), also could not be found in the Giardia genome (Eme et al., 2011; Vleugel et al., 2012; this paper). Altogether, the results of the comparative genomic studies published to date, including the present data, agree well with our inhibition experiments in that they support the absence of the SAC in Giardia. The mechanism of SAC-triggered metaphase-to-anaphase arrest consists of blocking the ubiquitination of securin and cyclin B through inhibition of APC activation via Mad2 binding to Cdc20. Thus, sister chromatids remain connected because separase, the enzyme responsible for cleaving their connections, is inhibited by securin. Securin has not been found in the Giardia genome (Eme et al., 2011), and the APC, an enzyme complex that ligates ubiquitins to proteins designated for proteasomal degradation, is missing (Gourguechon et al., 2013), in agreement with the aforementioned absence of Cdc20 and the fact that proteasome inhibition has no effect on mitotic progression: we did not observe any mitotic abnormalities when the proteasomal inhibitor epoxomicin was directly applied to mitotic cells. These data complement our hypothesis that Giardia is almost completely devoid

21

of the armamentarium necessary to halt mitosis before anaphase onset via SAC-mediated control of chromosome-spindle microtubule attachment. SAC members in Giardia Although the results discussed above strongly support the absence of the SAC in Giardia, three essential members of the SAC (Mps1 kinase and two proteins of the MCC effector complex, Bub3 and Mad2) are present in the genome of this parasite (Vleugel et al., 2012; Vicente and Cande, 2014; this paper). These proteins obviously function outside of the SAC, but their actual roles remain unclear. It is known from other cell types that both Mps1 and Bub3 have various non-SAC functions. In yeast and metazoans, Mps1 kinases regulate different steps of mitosis, including spindle pole duplication and cytokinesis (Liu and Winey, 2012). Bub3 acts as a transcriptional repressor during interphase by directly binding to histone deacetylases (Yoon et al., 2004) and is also required for entry and progression through early phases of mitosis, as demonstrated in Drosophila (Lopes et al., 2005). In contrast, Mad2 seems to represent a “true” SAC protein without any known non-SAC function. In Giardia, morpholino-mediated gene knockdown of Mps1 and Bub3 caused various abnormalities in the morphology and/or positioning of the mitotic spindles as well as errors in chromosome segregation and growth slowdown (Vicente and Cande, 2014) but did not shed much light on the particular role of these proteins. Nevertheless, these findings highlight the importance of Mps1 and Bub3 in Giardia. On the other hand, neither Mad2 silencing (Vicente and Cande, 2014) nor Mad2 overexpression, as reported here, had a significant effect on Giardia, indicating that Giardia Mad2 is a non-essential protein. Mad2 In all eukaryotes that utilize the SAC, Mad2 serves to bind Cdc20 as a critical event required for APC inhibition. Cytosolic Mad2 translocates to the nucleus and undergoes dimerization to allow it to bind Cdc20 (Luo and Yu, 2012). In Giardia, in addition to the absence of Cdc20 (see above), Mad2 did not show any nuclear localization. Here, we clearly demonstrated that throughout the cell cycle of Mad2-overexpressing Giardia cells and in albendazole-treated cells, in which the SAC should be active, Mad2 is always cytoplasmic and regularly co22

localizes with intracytoplasmic microtubules of the caudal pair of flagella and the median body, if present. Mislocalization caused by overexpression can be excluded because we observed the same pattern when using PAC-pBS-mad2-transfected cells expressing the gene under the control of its native promoter, and a similar pattern has recently been described using the HA-tagged Mad2 gene integrated into the Giardia genome (Vicente and Cande, 2014). Mad2 belongs to the HORMA domain-containing proteins. Until recently, proteins of the HORMA domain family were thought to be directly associated with chromatin. However, recent findings revealed unexpected functions for some of these proteins (Muniyappa et al., 2014), including preventing the premature segregation of centrioles during spermatocyte meiosis in Caenorhabditis elegans (Schvarzstein et al., 2013). In this context, the hypothesis proposed by Akiyoshi and Gull (2013) that the original/ancient function of Mad2 might have been to control mitotic basal body/axoneme segregation should not be ignored. This idea is based on the localization of Mad2 in basal body (i.e., centriole) areas in T. brucei (Akiyoshi and Gull, 2013). In Giardia, Mad2 is not associated with basal bodies, but with a pair of caudal flagellar axonemes. This pair has a privileged status among the eight Giardia flagella, representing the oldest (most mature) and second oldest flagella. Moreover, during Giardia division, the basal bodies/axonemes segregate and participate in the positioning of the mitotic spindles (Nohŷnková et al., 2006). Based on recent observations in T. brucei and Giardia, it is tempting to speculate about whether Mad2 might co-operate with cytoplasmic microtubular systems involved in cell division. However, much work remains to be done to understand the exact function of Giardia Mad2. DNA over-replication in progeny Our findings showing that DNA replicates and chromosomes condense further in the progeny of albendazole-treated Giardia point to normal timing of mitotic progression in cells with blocked spindle assembly; in metazoans, even moderately prolonged mitosis induces cell cycle arrest in the subsequent G1 phase (Vitale et al., 2011). Moreover, DNA replication in Giardia progeny with undivided parental nuclei represents an additional round of replication 23

without mitotic intervention. This phenomenon resembles endoreduplication (Arias and Walter, 2007) in that already replicated DNA duplicates in the absence of mitosis. However, in contrast to endoreduplication, which occurs when a cell exits the cell cycle in G2 phase and then undergoes S phase without prior cell division (Zielke et al., 2013), an albendazoletreated G2 Giardia cell undergoes cytokinesis (in the absence of mitosis) and enters the next cell cycle, where reduplication of G2 DNA content occurs in the progeny. In the context of albendazole treatment, this is an aberrant event. Similar reduplication has been observed via flow cytometry analysis of Giardia cells under severe nocodazole stress (Reaume et al., 2013). Conversely, from a cell cycle perspective, a cell behaves normally, progressing through S phase of the subsequent cell cycle, albeit ignoring its G2 DNA content. This provides further evidence that the SAC cannot function as a mechanism joining the machinery of chromosome-to-spindle microtubule attachment to that of the cell cycle (Sacristan and Kops, 2015) in Giardia. In conclusion, our findings, in combination with already published data, unequivocally demonstrate the absence of a conventional SAC in Giardia. In the microsporidium Encephalitozoon cuniculi, the absence of SAC components along with the presence of structural components of the KMN led to the suggestion that the main role of kinetochores is microtubule attachment, and not connecting the monitoring of attachment with cell cycle progression (Meraldi et al., 2006). It appears that the attachment of chromosomes to spindle microtubule(s) and their segregation without SAC control also represents the only function of the simple kinetochore in Giardia. Moreover, the tolerance to aneuploidy observed in Giardia (Tůmová et al., 2007; 2016) may reflect weak control over chromosome segregation. Although bi- nucleated Giardia is regarded as tetraploid, with two diploid nuclei (Bernander et al., 2001) with 10 chromosomes each, the parasite is able to cope with a certain degree of aneuploidy and continue proliferating: viable variants have been identified with up to 14 chromosomes in one nucleus and 8 chromosomes in the second nucleus in each cell (Tůmová et al., 2016). Thus, whether this clonally propagated single-celled pathogen prefers the activation of cell death in cases where the chromosome number drops below a critical 24

limit over monitoring the correctness of microtubule attachment for every chromosome via the SAC remains a challenging question. ACKNOWLEDGEMENTS We thank Pavel Dolezal (Department of Parasitology, Charles University in Prague) for valuable tips regarding Giardia transfection and Hana Glierova (Department of Microbiology and Immunology, Charles University in Prague) for her assistance with flow cytometry. This work was supported by grants nos. 204/09/1029 and 305/12/1248 from the Grant Agency of the Czech Republic. G.H. was supported by grant no. GBP302/12/G157 from the same Agency.

25

REFERENCES Adl, S.M., Simpson, A.G., Lane, C.E., Lukeš, J., Bass, D., Bowser, S.S., Brown, M.W., Burki, F., Dunthorn, M., Hampl, V., Heiss, A., Hoppenrath, M., Lara, E., Le Gall, L., Lynn, D.H., McMannus, H., Mitchell, E.A., Mozley-Stanridge, S.E., Parfrey, L.W., Pawlowski, J., Rueckert, S., Shadwick, R.S., Schoch, C.L., Smirnov, A., Spiegel, F.W., 2012. The revised classification of eukaryotes. J. Eukaryot. Microbiol. 59, 429493. Akiyoshi, B., Gull, K., 2013. Evolutionary cell biology of chromosome segregation: insights from trypanosomes. Open Biol. 3, 130023. Akiyoshi, B., Gull, K., 2014. Discovery of unconventional kinetochores in kinetoplastids. Cell 156, 1247-1258. Arias, E.E., Walter, J.C., 2007. Strength in numbers: preventing rereplication via multiple mechanisms in eukaryotic cells. Genes Dev. 21, 497-518. Arnot, D.E., Ronander, E., Bengtsson, D.C., 2011. The progression of the intra-erythrocytic cell cycle of Plasmodium falciparum and the role of the centriolar plaques in asynchronous mitotic division during schizogony. Int. J. Parasitol. 41, 71-80. Aurrecoechea, C., Brestelli, J., Brunk, B.P., Carlton, J.M., Dommer, J., Fischer, S., Gajria, B., Gao, X., Gingle, A., Grant, G., Harb, O.S., Heiges, M., Innamorato, F., Iodice, J., Kissinger, J.C., Kraemer, E., Li, W., Miller, J.A., Morrison, H.G., Nayak, V., Pennington, C., Pinney, D.F., Roos, D.S., Ross, C., Stoeckert Jr., C.J., Sullivan, S., Treatman, C., Wang, H., 2009. GiardiaDB and TrichDB: integrated genomic resources for the eukaryotic protist pathogens Giardia lamblia and Trichomonas vaginalis. Nucleic Acids Res. 37, D526-D530. Belhadri, A., 1995. Presence of centrin in the human parasite giardia: a further indication of its ubiquity in eukaryotes. Biochem. Biophys. Res. Commun. 214, 597-601. Bernander, R., Palm, J.E., Svärd, S.G., 2001. Genome ploidy in different stages of the Giardia lamblia life cycle. Cell. Microbiol. 3, 55-62.

26

Bohers, E., Sarafan-Vasseur, N., Drouet, A., Paresy, M., Latouche, J.B., Flaman, J.M., Sesboüé, R., Frebourg, T., 2008. Gradual reduction of BUBR1 protein levels results in premature sister-chromatid separation then in aneuploidy. Hum. Genet. 124, 473478. Cerva, L., Nohýnková, E., 1992. A light microscopic study of the course of cellular division of Giardia intestinalis trophozoites grown in vitro. Folia Parasitol. 39, 97-104. Davis, F.M., Tsao, T.Y., Fowler, S.K., Rao, P.N., 1983. Monoclonal antibodies to mitotic cells. Proc. Natl Acad. Sci. U.S.A. 80, 2926–2930. Dawson, S.C., Sagolla, M.S., Cande, W.Z., 2007. The cenH3 histone variant defines centromeres in Giardia intestinalis. Chromosoma 116, 175-184. Drechsler, H., McAinsh, A.D., 2012. Exotic mitotic mechanisms. Open Biol. 2, 120140. Eme, L., Trilles, A., Moreira, D., Brochier-Armanet, C., 2011. The phylogenomic analysis of the anaphase promoting complex and its targets points to complex and modern-like control of the cell cycle in the last common ancestor of eukaryotes. BMC Evol. Biol. 11, 265. Emmerlich, V., Scholze, H., Gillin, F.D., Bakker-Grunwald, T., 2001. Characterization of a proteasome alpha-chain from Giardia lamblia. Parasitol. Res. 87, 112-115. Fang, G., Yu, H., Kirschner, M.W., 1998. The checkpoint protein MAD2 and the mitotic regulator CDC20 form a ternary complex with the anaphase-promoting complex to control anaphase initiation. Genes Dev. 12, 1871-1883. Foley, E.A., Kapoor, T.M., 2013. Microtubule attachment and spindle assembly checkpoint signalling at the kinetochore. Nat. Rev. Mol. Cell Biol. 14, 25-37. Gordon, D.J., Resio, B., Pellman, D., 2012. Causes and consequences of aneuploidy in cancer. Nat. Rev. Genet. 13, 189-203. Gourguechon, S., Holt, L.J., Cande, W.Z., 2013. The giardia cell cycle progresses independently of the anaphase-promoting complex. J. Cell Sci. 126, 2246-2255. Groll, M., Huber, R., 2004. Inhibitors of the eukaryotic 20S proteasome core particle: a structural approach. Biochim. Biophys. Acta 1695, 33-44. 27

Hammarton, T.C., 2007. Cell cycle regulation in Trypanosoma brucei. Mol. Biochem. Parasitol. 153, 1-8. Hofstetrová, K., Uzlíková, M., Tůmová, P., Troell, K., Svärd, S.G., Nohýnková, E., 2010. Giardia intestinalis: aphidicolin influence on the trophozoite cell cycle. Exp. Parasitol. 124, 159-166. Holberton, D.V., 1973. Fine structure of the ventral disk apparatus and the mechanism of attachment in the flagellate giardia muris. J. Cell Sci. 13, 11-41. Hoque, M.T., Ishikawa, F., 2002. Cohesin defects lead to premature sister chromatid separation, kinetochore dysfunction, and spindle-assembly checkpoint activation. J. Biol. Chem. 277, 42306-42314. Hou, G., Le Blancq, S.M., E, Y., Zhu, H., Lee, M.G., 1995. Structure of a frequently rearranged rRNA-encoding chromosome in Giardia lamblia. Nucleic Acids Res. 23, 3310–3317. Kabnick, K.S., Peattie, D.A., 1990. In situ analyses reveal that the two nuclei of Giardia lamblia are equivalent. J. Cell Sci. 95, 353–360. Liu, X., Winey, M., 2012. The MPS1 family of protein kinases. Annu. Rev. Biochem. 81, 561585. Lopes, C.S., Sampaio, P., Williams, B., Goldberg, M., Sunkel, C.E., 2005. The drosophila Bub3 protein is required for the mitotic checkpoint and for normal accumulation of cyclins during G2 and early stages of mitosis. J. Cell Sci. 118, 187-198. Luo, X., Yu, H., 2012. Mitosis: short-circuiting spindle checkpoint signaling. Curr. Biol. 22, R128-R130. Ma, N., Matsunaga, S., Takata, H., Ono-Maniwa, R., Uchiyama, S., Fukui, K., 2007. Nucleolin functions in nucleolus formation and chromosome congression. J. Cell Sci. 120, 2091-2105. Manning, G., Reiner, D.S., Lauwaet, T., Dacre, M., Smith, A., Zhai, Y., Svard, S., Gillin, F.D., 2011. The minimal kinome of Giardia lamblia illuminates early kinase evolution and unique parasite biology. Genome Biol. 12, R66. 28

Mapelli, M., Massimiliano, L., Santaguida, S., Musacchio, A., 2007. The Mad2 conformational dimer: structure and implications for the spindle assembly checkpoint. Cell 131, 730743. Meraldi, P., Draviam, V.M., Sorger, P.K., 2004. Timing and checkpoints in the regulation of mitotic progression. Dev. Cell 7, 45-60. Meraldi, P., McAinsh, A.D., Rheinbay, E., Sorger, P.K., 2006. Phylogenetic and structural analysis of centromeric DNA and kinetochore proteins. Genome Biol. 7, R23. Morrison, H.G., McArthur, A.G., Gillin, F.D., Aley, S.B., Adam, R.D., Olsen, G.J., Best, A.A., Cande, W.Z., Chen, F., Cipriano, M.J., Davids, B.J., Dawson,S.C., Elmendorf, H.G., Hehl, A.B., Holder, M.E., Huse, S.M., Kim, U.U., Lasek-Nesselquist, E., Manning, G., Nigam, A., Nixon, J.E., Palm, D., Passamaneck, N.E., Prabhu, A., Reich, C.I., Reiner, D.S., Samuelson, J., Svard, S.G., Sogin, M.L., 2007. Genomic minimalism in the early diverging intestinal parasite Giardia lamblia. Science 317, 1921-1926. Muniyappa, K., Kshirsagar, R., Ghodke, I., 2014. The HORMA domain: an evolutionarily conserved domain discovered in chromatin-associated proteins, has unanticipated diverse functions. Gene 545, 194-197. Musacchio, A., 2011. Spindle assembly checkpoint: the third decade. Philos. Trans. R. Soc. Lond. B Biol. Sci. 366, 3595-604. Musacchio, A., Salmon, E.D., 2007. The spindle-assembly checkpoint in space and time. Nat. Rev. Mol. Cell. Biol. 8, 379-393. Nohýnkova, E., Dráber, P., Reischig, J., Kulda, J., 2000. Localization of gamma-tubulin in interphase and mitotic cells of a unicellular eukaryote, Giardia intestinalis. Eur. J. Cell Biol. 79, 438-445. Nohynková, E., Tumová, P., Kulda, J., 2006. Cell division of Giardia intestinalis: flagellar developmental cycle involves transformation and exchange of flagella between mastigonts of a diplomonad cell. Eukaryot. Cell 5, 753-761. Perpelescu, M., Fukagawa, T., 2011. The ABCs of CENPs. Chromosoma 120, 425-426.

29

Ploubidou, A., Robinson, D.R., Docherty, R.C., Ogbadoyi, E.O., Gull, K., 1999. Evidence for novel cell cycle checkpoints in trypanosomes: kinetoplast segregation and cytokinesis in the absence of mitosis. J. Cell Sci. 112, 4641-4650. Reaume, C., Moore, B., Hernández, P., Ruzzini, A., Chlebus, M., Wasserman, M., Yee, J., 2013. Evaluation of drugs and stationary growth on the cell cycle of Giardia intestinalis. Mol. Biochem. Parasitol. 187, 72-76. Roy, B., Varshney, N., Yadav, V., Sanyal, K., 2013. The process of kinetochore assembly in yeasts. FEMS Microbiol. Lett. 338, 107-117. Sacristan, C., Kops, G.J., 2015. Joined at the hip: kinetochores, microtubules, and spindle assembly checkpoint signaling. Trends Cell Biol. 25, 21-29. Sagolla, M.S., Dawson, S.C., Mancuso, J.J., Cande, W.Z., 2006. Three-dimensional analysis of mitosis and cytokinesis in the binucleate parasite Giardia intestinalis. J. Cell Sci. 119, 4889-4900. Schvarzstein, M., Pattabiraman, D., Bembenek, J.N., Villeneuve, A.M., 2013. Meiotic HORMA domain proteins prevent untimely centriole disengagement during Caenorhabditis elegans spermatocyte meiosis. Proc. Natl Acad. Sci. U.S.A. 110, E898-E907. Shao, H., Li, R., Ma, C., Chen, E., Liu, X.J., 2013. Xenopus oocyte meiosis lacks spindle assembly checkpoint control. J. Cell Biol. 201, 191-200. Sironi, L., Melixetian, M., Faretta, M., Prosperini, E., Helin, K., Musacchio, A., 2001. Mad2 binding to Mad1 and Cdc20, rather than oligomerization, is required for the spindle checkpoint. EMBO J. 20, 6371-6382. Soloviev, M.M., 1963. Studies on lamblia duodenalis division in cultures. Med. Parazitol. Parazit. Bolezni 1, 96–101. (In Russian). Takeuchi, K., Fukagawa, T., 2012. Molecular architecture of vertebrate kinetochores. Exp. Cell Res. 318, 1367-1374. Tanaka, T.U., 2002. Bi-orienting chromosomes on the mitotic spindle. Curr. Opin. Cell Biol. 14, 365-371. 30

Tůmová, P., Hofstetrová, K., Nohýnková, E., Hovorka, O., Král, J., 2007. Cytogenetic evidence for diversity of two nuclei within a single diplomonad cell of giardia. Chromosoma 116, 65-78. Tůmová, P., Uzlikova, M., Jurczyk, T., Nohynkova, E., 2016. Constitutive aneuploidy and genomic instability in the single-celled eukaryote Giardia intestinalis. MicrobiologyOpen, doi: 10.1002/mbo3.351. Tůmová, P., Uzlíková, M., Wanner, G., Nohýnková, E., 2015. Structural organization of very small chromosomes: study on a single-celled evolutionary distant eukaryote Giardia intestinalis. Chromosoma 124, 81-94. Vicente, J.J., Cande, W.Z., 2014. Mad2, Bub3, and Mps1 regulate chromosome segregation and mitotic synchrony in Giardia intestinalis, a binucleate protist lacking an anaphasepromoting complex. Mol. Biol. Cell 25, 2774-2787. Vitale, I., Galluzzi, L., Castedo, M., Kroemer, G., 2011. Mitotic catastrophe: a mechanism for avoiding genomic instability. Nat. Rev. Mol. Cell Biol. 12, 385–392. Vleugel, M., Hoogendoorn, E., Snel, B., Kops, G.J., 2012. Evolution and function of the mitotic checkpoint. Dev. Cell 23, 239-250. Westendorf, J.M., Rao, P.N., Gerace, L., 1994. Cloning of cDNAs for M-phase phosphoproteins recognized by the MPM2 monoclonal antibody and determination of the phosphorylated epitope. Proc. Natl Acad. Sci. U.S.A. 91, 714-718. Yoon, Y.M., Baek, K.H., Jeong, S.J., Shin, H.J., Ha, G.H., Jeon, A.H., Hwang, S.G., Chun, J.S., Lee, C.W., 2004. WD repeat-containing mitotic checkpoint proteins act as transcriptional repressors during interphase. FEBS Lett. 575, 23–29. Yu, L.Z., Birky Jr., C.W., Adam, R.D., 2002. The two nuclei of giardia each have complete copies of the genome and are partitioned equationally at cytokinesis. Eukaryot. Cell 1, 191-199. Yubuki, N., Leander, B.S., 2013. Evolution of microtubule organizing centers across the tree of eukaryotes. Plant J. 75, 230-244.

31

Zeng, X., Sigoillot, F., Gaur, S., Choi, S., Pfaff, K.L., Oh, D.C., Hathaway, N., Dimova, N., Cuny, G.D., King, R.W., 2010. Pharmacologic inhibition of the anaphase-promoting complex induces a spindle checkpoint-dependent mitotic arrest in the absence of spindle damage. Cancer Cell 18, 382-395. Zielke, N., Edgar, B.A., DePamphilis, M.L., 2013. Endoreplication. Cold Spring Harb. Perspect. Biol. 5, a012948.

32

FIGURE LEGENDS Fig. 1. Inhibition of spindle assembly does not arrest bi-nucleated Giardia cells in mitosis. (A) Giardia cells in which the formation of mitotic spindles is prevented by treatment with the anti-microtubular drug albendazole (100 ng/ml); (B) Control mitotic cells. Immunofluorescence staining was performed using a 6-11B-1 monoclonal antibody against acetylated alpha tubulin. In both panels (A, B), the upper rows show DAPI-stained nuclei; the middle rows represent the same cells labeled with an anti-tubulin antibody to show basal body complexes and the presence/absence of mitotic spindles; the lower rows show fluorescent signals from microtubular structures (green) merged with the signals from DAPIstained nuclei (blue). Note two non-dividing parent nuclei present from prophase to ana/telophase in albendazole-treated cells (A: the upper and lower rows) and the absence of mitotic spindles along with correct mitotic segregation of basal body complexes in these cells (A: the middle and lower rows). Segregation of the basal body complexes (A: asterisks in the middle row) corresponds to that during normal mitotic progression as demonstrated in panel B, where the division of two parent nuclei via two parallel mitotic spindles is shown (B: metaphase, ana/telophase; double-headed arrow shows the direction of chromosome segregation during mitosis). N1, N2 – parent nuclei; N1´, N2´- daughter nuclei; condensed chromosomes (arrowheads). Bar: 10 µm. (C) Transmission electron microscopy showing the absence of mitotic spindle microtubules in albendazole-treated dividing cells (upper image) and the arrangement of spindle microtubules in semi-open Giardia mitosis (lower image) on the cross sections through nuclear areas. Upper inset: A detail of a nuclear envelope area without spindle microtubules. Lower image: Extra-nuclear spindle microtubules forming a single row externally to and parallel with the nuclear envelope of both nuclei as shown in detail in the inset (arrowheads). N – nucleus. Bar: 500 nm. (D) Mitosis-specific phosphorylation associated with nuclear envelope and basal body complexes. Immunofluorescence staining with the MPM-2 antibody (green) shows the same pattern of mitotic phosphorylation in albendazole-treated cells dividing in the absence of mitotic spindles (upper row) and in control mitotic cells (lower row). Interphase: no phosphoprotein 33

staining is visible in nuclear envelope and basal body complexes. Prophase to anaphase: intensive staining at areas of the basal body complexes (asterisks) and the nuclear envelopes (NE). Blue: nuclear DNA stained with DAPI. Bar: 5 µm. (E) A line graph to show division of cells with inhibited spindle assembly via albendazole (red line). Over 9 h, the number of these cells increases 1.7 times. Blue line: During the same time period, the number of control cells doubles. Values represent the mean of five independent experiments. Fig. 2. Inhibition of nuclear division does not block cell division in Giardia. (A) Giemsastaining of Giardia cells demonstrating an equal sequence of extensive flagellar reorganization typical for Giardia division in both albendazole-treated cells in which mitotic spindle assembly is inhibited by the drug (upper row; note condensed chromosomes in two non-dividing parent nuclei per cell) and control mitotic cells (lower row). Positioning of the basal body complexes determines the phases of Giardia mitosis. A line segment indicates the same distance between the segregated basal body complexes during telophase in the albendazole-treated and non-treated cells. (B) Centrin staining localized in the basal body areas illustrates the correct segregation of the basal body complexes, corresponding to normal telophase (left panel) during cell division without mitosis (right panel). Double immunofluorescence staining was performed with the BAS 6.8 anti-centrin antibody conjugated with Zenon Alexa (red) and the 6-11B-1 antibody against acetylated alpha-tubulin (green) to label basal body/axonemes of Giardia flagella. Nuclear DNA was stained with DAPI (blue). Lower row shows merged images. (C) Comparison of cytokinesis in the absence of mitosis (upper image) to normal Giardia cytokinesis. Cells stained with GiemsaRomanowski. Arrows point to the cleavage furrow. Note two undivided, incorrectly positioned parent nuclei during cytokinesis in the absence of mitosis. (D) Giemsa-stained descendants of cytokinesis without mitosis show four descendant phenotypes (albendazole phenotypes): single cells with none, one or two nuclei and doublet cells with two nuclei. N – nucleus in BD. Bars: 10 µm in A, C and D; 5 µm in B. (E) A column graph demonstrates an increasing number of descendant phenotypes in a proliferating population exposed to albendazole. Four phenotypes were counted together; each doublet cell was calculated as one cell. Blue 34

column: normal Giardia cells; red column: albendazole phenotypes. (F) A ratio of the albendazole phenotypes to the whole cells at 0, 1, 3, 6 and 9 h intervals. Note nearly 100% of the descendants after 9 h of treatment (approximately one cell cycle of the HP-1 isolate used in the experiments). Among the descendants, the ratio of single cells to doublets was determined. Blue column: normal Giardia cells; green column: single descendant cells; red column: doublet descendant cells. Values in E and F represent the mean of five independent experiments. Fig. 3. Defective spindle assembly results in progeny with nuclei of abnormal size, number and positioning. Mitotic Giardia cells were treated with nocodazole (10 ng/ml). (A) The upper panel shows clusters of nuclear DNA stained with DAPI. The middle panel represents the same cells labeled with the 6-11B-1 anti-tubulin antibody to visualize microtubules. Note the abnormal composition of mitotic spindles. Merged images of the two labels (lower panel) show incorrect spindle organization (green) and inaccurate chromosome (blue) distribution during mitosis. (B) Progeny of the nocodazole-treated Giardia cells. Right: Defects in size and/or number of daughter nuclei (DAPI staining). Left: A merged image with a FITC signal from the microtubule cytoskeleton (green), demonstrating defects in the positioning of these nuclei (blue) in daughter cells. Note two nuclei on one body side (arrow) or three nuclei of different sizes at the basal body area (arrowhead). Bar: 5 µm in A; 10 µm in B. Fig. 4. Proteasome inhibition does not influence the progression of Giardia cells through mitosis. (A) Left panel: Western blot analysis with an anti-ubiquitin antibody (rabbit polyclonal; Abcam, ab19247) to show the accumulation of ubiquitinated proteins in cells treated with 5 µM epoxomicin for 6, 8 and 12 h. Cell lysates prepared from control untreated cells and from cells treated with albendazole were examined in parallel. Equal amounts of protein were loaded in each lane corresponding to 40 µg of protein of each cell lysate. Right panel: Loading controls stained with SimplyBlue SafeStain. (B) Analysis of the cell cycle profile after 120 min of exposure to 5 µM epoxomicin. Mitotic cells were exposed to epoxomicin for the indicated time interval, fixed and immunostained with the 6-11B-1 anti35

tubulin antibody to visualize median body (MB) and mitotic spindles. Control untreated cells were processed the same way. Cells were counted (a total of 427 epoxomicin-treated and 425 control cells were viewed) and percentages of mitotic cells, G1 cells (i.e., interphase cells without a median body (- MB)), and G2 cells (i.e., interphase cells with median body (+ MB)) were calculated. Values represent the mean of three independent experiments. (C) Percentages of epoxomicin-treated and control cells at different phases of mitosis (N=400). Graphs represent the results of three independent experiments. Fig. 5. Mad2 overexpression. (A) Immunofluorescence staining of Mad2-overexpressing Giardia cells was performed using the HA-tag antibody to show the localization of Mad2 (green) during interphase. The cells were transfected with the pOndra plasmid containing the full-length sequence of the Mad2 homolog (GL50803_100955) under the control of a GDH promoter and flanked at the C-terminus by a 3xHA tag. Note a uniform pattern of Mad2 localization in a majority of the transfectants. Inset: a detail showing Mad2 localization along internal parts of the caudal flagella axonemes (arrow) and in the median body (MB), a Giardia-specific microtubular structure. (B) Growth curve of Mad2-overexpressing cells (green line) compared to that of control cells (red line). Values represent the mean of three independent experiments. (C) Localization of Mad2 during mitosis of the Mad2overexpressing cells (upper row) and of cells expressing Mad2 under the control of a native promoter (lower row). (D) Staining pattern in aberrant descendants of the Mad2overexpressing cells undergoing cytokinesis without mitosis due to inhibition of mitotic spindle assembly via albendazole treatment. Arrows point to the caudal flagella axonemes. Mad2-specific intranuclear staining was not observed in any transfected cells (A, C) as well as in the descendants generated in the absence of mitosis (D). Nuclei (N) are stained with DAPI (blue). Bars: 10 µm in A and C. (E) Western blot analysis of Giardia Mad2 performed with RIPA lysates from Giardia cells transfected with HA-tagged Mad2 constructs. Two different protocols (a, b) and two different antibodies against the HA tag (#1 = HA, Tachezy; #2 = HA, Sigma) were used. Lane 1: a control lysate from cells transfected with the empty vector pPAC. Lanes 2, 7, 9: lysates from cells overexpressing Mad2 via a strong GDH 36

promoter. Lanes 3, 4, 5, 6, 8: lysates from cells expressing the HA-tagged Mad2 under the control of a native promoter (lanes 3, 4, 5 were loaded with cell lysates prepared one, two and three months post-transfection). The molecular weight scale is given on the left (MW protein standard is in the middle). Both anti-HA tag antibodies recognized a single band of approximately 34 kDa. The protein identity was confirmed by mass spectrometry (MALDI TOF/TOF). All transfections were repeated at least three times. A typical experiment is shown. (F) A table comparing karyotypes of a parent line HP-1 and the same line overexpressing Mad2. A prevailing karyotype (meaning a karyotype that is most frequently represented by a combination of 9 chromosomes in one nucleus and 11 chromosomes in the second nucleus of a single cell) is exhibited by 93.3% and 95.2% cells of the parent line and the Mad2-overexpressing line, respectively.

37