Abundant polymorphisms at the microsatellite locus LEI0258 in indigenous chickens

Abundant polymorphisms at the microsatellite locus LEI0258 in indigenous chickens Bo Han, Ling Lian, Lujiang Qu, Jiangxia Zheng, and Ning Yang1 National Engineering Laboratory for Animal Breeding and MOA Key Laboratory of Animal Genetics and Breeding, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, China ing 21 novel alleles and 28 private alleles that existed in only one breed. Three alleles, 249 bp (7.04%), 489 bp (6.57%), and 309 bp (6.10%), were the most frequent in the indigenous chickens. A 489-bp novel allele was unique in Chinese local chicken breeds. Three indels and 4 SNP of upstream/downstream of 2 repeat regions (R13/R12) were found. Abundant variations indicate high genetic diversity at the MHC region in indigenous chickens. Rare alleles are vulnerable to genetic drift in small populations, and can be used as molecular markers for monitoring the dynamic conservation of many indigenous breeds.

Key words: polymorphism, major histocompatibility complex, LEI0258, indigenous chicken 2013 Poultry Science 92:3113–3119 http://dx.doi.org/10.3382/ps.2013-03416

INTRODUCTION The chicken major histocompatibility complex (MHC) with abundant SNP and indels (Wong et al., 2004) was closely related to host genetic resistance or susceptibility to disease. One of the hot spots in chicken genetics and breeding research has been to identify MHC haplotypes. Since the 1980s, many approaches have been used to test chicken MHC genotypes, including red blood serological reaction (Briles and Briles, 1982; Fulton et al., 1996), 2-dimensional electrophoresis (Miller et al., 1984), DNA RFLP (Miller et al., 1988; Juul-Madsen et al., 1993; Livant et al., 2001; Emara et al., 2002; Iglesias et al., 2003), single-strand conformation polymorphism (Goto et al., 2002; Iglesias et al., 2003), and a genotyping method based on DNA sequence typing (Zheng et al., 1999; Miller et al., 2004; Livant and Ewald, 2005). However, it is very difficult to detect large groups by these methods.

©2013 Poultry Science Association Inc. Received June 13, 2013. Accepted August 18, 2013. 1 Corresponding author: [email protected]

The microsatellite locus LEI0258 was a tetranucleotide repeat system physically located within the MHC on microchromosome 16 of the chicken (McConnell et al., 1999; Fulton et al., 2006). The LEI0258 microsatellite marker shows high polymorphism including a large number of alleles and large range in allele size. Although each LEI0258 allele may not necessarily be associated with the MHC haplotypes in different populations (Fulton et al., 2006), the LEI0258 marker genotype gave a good indication of the variability of the MHC region in different chicken populations (Izadi et al., 2011). Microsatellite detection of LEI0258 was simple and fast (Fulton et al., 2006), Thus, this marker has been widely used to evaluate genetic diversity in many regions with different chicken breeds or lines (LimaRosa et al., 2005; Fulton et al., 2006; Schou et al., 2007; Lwelamira et al., 2008; Hoque et al., 2011; Izadi et al., 2011; Chang et al., 2012; Nikbakht et al., 2013). China, as one of the largest chicken producers in the world, is rich in chicken genetic resources, and there are many local breeds scattered throughout the country. In this study, we applied the LEI0258 microsatellite marker to investigate polymorphism of the MHC region in Chinese indigenous chicken breeds, and use it to dynamically monitor the change of genetic resources.

3113

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014

ABSTRACT The chicken major histocompatibility complex (MHC) has abundant SNP and indels, and is closely related with host genetic resistance or susceptibility to disease. The LEI0258 locus is the most variable in the MHC region, and is a useful marker in reflecting the variability of MHC. In this study, we applied the LEI0258 microsatellite marker to investigate polymorphism of MHC in Chinese indigenous chickens. The size of LEI0258 fragments in 1,617 individuals from 33 Chinese chicken breeds was detected by capillary electrophoresis, and 213 samples with different fragment sizes were further sequenced. A total of 69 alleles ranging from 193 to 489 bp were found, includ-

3114

Han et al.

MATERIALS AND METHODS Samples

Genotyping by Detecting Size of LEI0258 Fragments The sizes of LEI0258 fragments in 1,617 individuals were detected. Polymerase chain reaction was done using 1.5 μL of genomic DNA, with 0.4 μL of each primer, 2 μL of buffer (10×), 0.8 μL of 10 mM dNTP, 0.3 μL of Taq DNA polymerase, and water in a final volume of 20 μL. The PCR cycles included 95°C for 5 min, 35 cycles of 95°C for 30 s, 65°C for 30 s, 72°C for 30 s, and 72°C for 5 min. The PCR primers for LEI0258 were CACGCAGCAGAACTTGGTAAGG (forward) and AGCTGTGCTCAGTCCTCAGTGC (reverse; McConnell et al., 1999, Fulton et al., 2006). The forward LEI0258 primer was dye-labeled with FAM to produce a PCR product labeled with fluorescence, and the PCR product was detected by capillary electrophoresis in Sangon Biotech (Shanghai, China). GeneMarker (GeneMarker V1.71, Soft Genetics LLC, State College, PA) was used to read the size of targeted fragments.

Sequencing Out of 1,617 samples, 213 with distinct sizes of LEI0258 fragments were sequenced. The DNA sequence was obtained using primers that bind just outside of the LEI0258 binding region, as follows: forward (CAJF01F): TCGGGAAAAGATCTGAGTCATTG; reverse CAJF01R): TGATTTTCAGATCGCGTTCCTC (Fulton et al., 2006). The PCR was performed in a final volume of 25 μL with 2 μL of chicken genomic DNA, 2.5 μL of buffer (10×), 0.5 μL of each forward and reverse primers, 1 μL of 10 mM dNTP, 0.5 μL of Taq DNA polymerase, and water. The PCR cycles included 95°C for 5 min, 35 cycles of 95°C for 30 s, 61°C for 30 s, 72°C for 30 s, and 72°C for 5 min. The PCR products were detected by Sangon Biotech. The sequences were further compared against homologous sequences

RESULTS AND DISCUSSION In this study, we used the fragment size detection by capillary electrophoresis to measure the polymorphisms in Chinese local chicken breeds, but some new alleles were found. To confirm the results, we selected 1 to 2 samples for each new allele to be sequenced. Briefly, if there was only one sample for a certain allele, the sample was selected to be sequenced. If there were more than 2 samples for a certain allele, we selected 2 samples with the highest peak values in capillary electrophoresis spectrum. Meanwhile, for those samples with the same allele size as the previous studies, 1 to 2 samples were also chosen for sequencing validation. A total of 213 samples were sequenced in our study. However, the sizes detected by capillary electrophoresis and sequencing did not exactly match. The fragment length by capillary electrophoresis and the consensus size by sequencing are shown in Table 1. The size difference ranged from 1 to 65 bp (Table 1). Fragment length by capillary electrophoresis did not exactly match that by sequencing for unclear reasons. Some environmental factors might affect electrophoresis, or capillary electrophoresis might have shown false-positive results. LEI0258 was a composite microsatellite that had 2 or more different repeat units of the structure of the microsatellite. It is common for a compound microsatellite to contain different repeating units with the same size of the fragments. Therefore, sequencing is more accurate. In this study, the results from sequencing were used. In total, 69 alleles were found in 1,617 individuals of 33 Chinese indigenous chicken strains, and the size of LEI0258 alleles ranged from 193 to 489 bp. Out of 69 alleles, 21 novel alleles and 28 private allele that existed in only one breed were found. Three alleles, 249 bp (7.04%), 489 bp (6.57%), and 309 bp (6.10%), were the most frequent in Chinese indigenous chickens (Table 1). The 489-bp novel allele was unique in Chinese indigenous chickens. The more alleles suggested higher polymorphism of LEI0258. The number of alleles is different depending on chicken breeds. Fifteen alleles were identified in Brazilian chicken (blue-egg caipira; Lima-Rosa et al., 2005). Twenty-six LEI0258 alleles, ranging from 182 to 552 bp, were detected in North American and European layer-type chickens (Fulton et al., 2006). Twenty-five alleles at the microsatellite locus LEI0258 were observed in 2 chicken breeds in Vietnam (Schou et al., 2007). Twenty-two and 23 alleles of LEI0258 were found in 2 Tanzania chicken ecotypes, respectively (Lwelamira et al., 2008). Izadi et al. (2011) used 2 parameters, heterozygosity and the number of alleles, to assess genetic variability. A total of 13 alleles were found in Korean native chicken (Hoque et al., 2011), 16 alleles in 6 Tai-

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014

A total of 1,617 purified DNA samples were obtained from 33 Chinese indigenous chicken strains, including Baier Yellow (n = 53), Beijing You (47), Tibetan (56), Chahua (34), Chongren Partridge (57), Dagu (35), Dongxiang Blue-eggshell (48), Gushi (48), Guangxi Yellow (55), Huaixiang (59), Huiyang Bearded (35), Jiangshan Black-bone (55), Langya (57), Lingkun (56), Luxi Game (38), Sichuan Mountain Black-bone (34), Yao (58), Ningdu Yellow (59), QiandongnanXiaoxiang (53), Qingyuan Partridge (35), Rugao Yellow (48), Silkies (48), Turpan Game (33), Wenchang (36), Wenshang Barred (55), Wumeng Black-bone (50), Wuding (54), Xishuangbanna Game (46), Xiayan (60), Yangshan (59), YunlongAijiao (56), Zhangzhou Game (45), and Zhuxiang chicken (55).

retrieved from GenBank using DNAMAN (DNAMAN Application 4.0.1.1, Lynnon BioSoft, USA).

— —

— — —

— — — —

— —

—

— —

△ — —

— △ — —

△ —

205

2061 217

2351 2371 2371

241

247

249

249

249

2591 261 261

2711 273

273 2831

207/208 217/218/219/220/261

237/238 240 223/230/240/241

244/250

251

250/253

250/252/253

243/252/254

255/261 254/264 264/265

273/274 275/276/283

276 279/285/286/288

— —

—

1 1

1 1

1 1 1

1

1

1

1

1

1 1 1

1 1

1

1

1

R13

9 10

9 9

8 8 8

7

7

7

7

7

6 6 6

4 5

4

3

3

R12

— —

— —

— — —

—

—

—

—

—

— — —

— —

—

T

—

C

5

A —

△ △

— —

— —

— — —

—

—

—

—

— —

— —

— — —

—

—

—

—

—

—

△

△

—

△

— — —

—

△

— — —

△

33

ATTTTGAG△

23–31

Position

T —

— —

— T —

—

—

T

—

—

— — —

— —

—

—

—

A

39

— —

A A

A — A

—

A

—

—

—

A — A

— —

—

—

—

T

46

Jiangshan Black-bone2 Guangxi Yellow, Xishuangbanna Game, Beijing You, Lingkun, Rugao Yellow Baier Yellow2 Wumeng Black-bone, Yangshan, Dagu, Rugao Yellow

Xishuangbanna Game, Qingyuan Partridge, Wenchang, Tibetan, Wenshang Barred, Gushi Ningdu Yellow, Xiayan Chongren Partridge, Jiangshan Black-bone, Yangshan, Wenchang, Tibetan, Langya, Xiayan Turpan Game2 Jiangshan Black-bone2 Yunlong Aijiao, Jiangshan Black-bone Yangshan, Dagu, Rugao Yellow, Guangxi Yellow Sichuan Mountain Blackbone2 Sichuan Mountain Blackbone, Tibetan, Ningdu Yellow, Luxi Game Yao, Chahua, Xishuangbanna Game, Zhangzhou Game, Sichuan Mountain Black-bone, Dongxiang Blue-eggshell Luxi Game, Gushi, Guangxi Yellow Yao, Guangxi Yellow Xishuangbanna Game, Yao Wenshang Barred, Gushi

Xishuangbanna Game, Xiayan Zhangzhou Game, Guangxi Yellow, Xiayan

Chicken breed

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014

— △

—

—

A

△ —

—

—

—

—

202/204/206/207/208/218

—

193

—

190/194/195/200

—

G

−28

193

TT

−30 to 29

190/195

Fragment length (bp, by genotyping)

Consensus size (bp, by sequencing)

Position

Table 1. Polymorphisms identified by the LEI0258 alleles in Chinese indigenous chicken breeds

KF534933* KF535090*

KF535088* KF534931* DQ239523, DQ239524, DQ239525, DQ239539 KF535089* KF534932*

KF534930*

DQ239513, DQ239531, DQ239551 KF534929*

KF534928*

KF534927*

KF535085* KF535086* KF535087*

KF535084* KF534926*

DQ239512, DQ239495, DQ239547, DQ239538 DQ239505, DQ239514, DQ239560

KF534925*

GenBank number

2, 29

Continued

15.2, 22, 73

13.2, 17, BW11

15.1, 11, 61, 27

B haplotype

RESEARCH NOTE

3115

— A — — — A

— — —

— — A — — — A — — A —

△ △ △ — — △

△ △ —

— — — △ △ — — △ — — △ —

295 295 295 297 3051 307

307

307 309

309

309

3171 3181 319

319 3201 321 3311 333

333

3431 3441

296/300 297/300 298 299 307 287/305/309/310

309

314 303/305/307/311/312

312

312

333 321 321/322/323

337 323 325 334 336/337

337

347 347/348/349

—

—

1 12

1

1 1 1 1 1

9 10 1

1

1

1 1

1

1 1 1 1 9 1

8

1

1 1 1

R13

15 3

14

13 13 13 14 14

4 3 13

12

12

12 12

12

11 11 11 11 3 12

3

10

10 10 10

R12

— —

—

— — — — —

— — —

—

—

— —

—

— — — — — —

—

—

— — —

C

5

— —

—

— — — — —

— — —

—

—

— —

—

— — — — — —

—

—

— — —

ATTTTGAG△

23–31

Position

— —

—

— — — — —

— — —

—

—

— —

—

— — — — — —

—

—

— — —

△

33

— —

—

— △ — — T

— — —

—

—

— T

—

— — — T — —

—

—

— — T

A

39

— —

A

A A A — —

— — —

A

—

A —

—

— — A — — —

—

A

— — —

T

46

Lingkun2 Tibetan, Wuding, Yao Qiandongnan Xiaoxiang, Wuding, Langya Sichuan Mountain Blackbone2 Chongren Partridge, Chahua, Tibetan Yunlong Aijiao, Xiayan Luxi Game2 Gushi2 Zhangzhou Game2 Zhuxiang, Tibetan Beijing You, Yunlong Aijiao, Qingyuan Partridge, Xiayan, Gushi, Dongxiang Blue-eggshell, Rugao Yellow Wenshang Barred, Luxi Game Xiayan2 Yao, Huaixiang, Wumeng Black-bone, Sichuan Mountain Black-bone, Wenchang, Wenshang Barred, Xiayan, Dongxiang Blue-eggshell Sichuan Mountain Blackbone, Qiandongnan Xiaoxiang Sichuan Mountain Blackbone2 Yao2 Zhuxiang, Luxi Game Ningdu Yellow, Luxi Game, Gushi, Silkies Dongxiang Blue-eggshell2 Qiandongnan Xiaoxiang2 Gushi2 Ningdu Yellow2 Yunlong Aijiao, Wenshang Barred, Gushi Sichuan Mountain Blackbone2 Xishuangbanna Game2 Baier Yellow, Silkies

Chicken breed

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014

—

—

—

2921

290/294/295

—

—

285

288

A —

△ —

2831 285 285

G

−28

TT

−30 to 29

285 287/288 287/288

Fragment length (bp, by genotyping)

Consensus size (bp, by sequencing)

Position

Table 1 (Continued). Polymorphisms identified by the LEI0258 alleles in Chinese indigenous chicken breeds

KF535098* KF535099*

DQ239562

KF534944* KF535096* KF534945* KF535097* KF534946*

KF535094* KF535095* KF534943*

KF534942*

KF534940* DQ239494, DQ239533, DQ239534, DQ239535, DQ239536, DQ239537 KF534941*

KF534939*

DQ239541 DQ239496 KF534937* KF534938* KF535093* DQ239550, DQ239555

KF535092*

KF534936*

KF535091* KF534934* KF534935*

GenBank number

BW4

Continued

10, 24, 26, 76

72, 78

5 11.1

B haplotype

3116 Han et al.

357

357 367 369

369 3791 381

381 393 405 419

420

421 432 4331 443 4581 4771 4831 4841 4891

360/361

360/370 370 372

372/373 314 384

385 396 408 423

424

425/426 437 438 448/449 463 479 488 489 490/493/494/495/496/ 499/500/502/504

— — — — — — — — —

—

— — — —

— △ —

— △ —

—

—

TT

−30 to 29

2Private

— — — — — — — — —

—

— — — —

— A —

— A —

—

—

G

−28

17 16 17 15 18 1 19 20 1

16

1 1 1 15

1 1 1

1 1 1

1

1

R13

4 6 5 8 6 26 7 6 27

5

18 19 20 6

17 18 18

16 17 17

16

15

R12

— — — — — — — — —

—

— — — —

— — —

— — —

—

—

C

5

— — — — — — — — —

—

— — — —

— — —

— — —

—

—

ATTTTGAG△

23–31

Position

— — — — — — — — —

—

— — — —

— — —

— — —

—

—

△

33

— — — — — — — — —

—

T T — —

— — —

— — T

T

T

A

39

— — — — — A — — A

—

— — A —

A — A

A — —

—

—

T

46

Baier Yellow, Rugao Yellow Xiayan2 Xiayan, Jiangshan Blackbone Yunlong Aijiao2 Wenchang2 Huiyang Bearded2 Qingyuan Partridge, Ningdu Yellow Yangshan, Zhangzhou Game, Ningdu Yellow Wenshang Barred, Dagu Tibetan, Ningdu Yellow Lingkun2 Yao, Rugao Yellow Gushi2 Chongren Partridge2 Wenshang Barred, Lingkun Silkies2 Chongren Partridge, Chahua, Huiyang Barred, Yao, Yangshan, Ningdu Yellow, Xiayan

Huaixiang, Guangxi Yellow Huiyang Bearded, Langya Turpan Game, Qingyuan Partridge

Turpan Game, Yao, Langya, Luxi Game, Lingkun Jiangshan Black-bone, Yao, Xiayan

Chicken breed

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014

allele detected in Chinese indigenous chickens. allele: the allele only appeared in one breed. *New sequence submitted in GenBank.

1New

345

349/350

Fragment length (bp, by genotyping)

Consensus size (bp, by sequencing)

Position

Table 1 (Continued). Polymorphisms identified by the LEI0258 alleles in Chinese indigenous chicken breeds

130, 131, 201, 5.1, 6.1, 21, 75

DQ239506, DQ239507, DQ239526, DQ239543, DQ239546, DQ239527, DQ239528, DQ239529, DQ239553 DQ239532 KF534947* DQ239530, DQ239558, DQ239559 KF534948* KF535100* KF534949*

6

62

DQ239548 KF534952* KF534953* KF535101* DQ239544 KF535102* KF535103* KF535104* KF535105* KF535106*

13.1 1

DQ239504 DQ239493 KF534950* KF534951*

21.1, Q, BW1

23

14

B haplotype

DQ239508

GenBank number

RESEARCH NOTE

3117

3118

Han et al.

ACKNOWLEDGMENTS The work was supported in part by the National High Technology Development Plan of China (2011AA100305, 2013AA102501), the Program for Changjiang Scholars and Innovative Research in University of China (IRT1191), and China Agriculture Research Systems (CARS-41).

REFERENCES Briles, W. E., and R. W. Briles. 1982. Identification of haplotypes of the chicken major histocompatibility complex (B). Immunogenetics 15:449–459. Chang, C. S., C. F. Chen, C. Berthouly-Salazar, O. Chazara, Y. P. Lee, C. M. Chang, K. H. Chang, B. Bed’Hom, and M. TixierBoichard. 2012. A global analysis of molecular markers and phenotypic traits in local chicken breeds in Taiwan. Anim. Genet. 43:172–182. Emara, M. G., H. Kim, J. Zhu, R. R. Lapierre, N. Lakshmanan, and H. S. Lillehojt. 2002. Genetic diversity at the major histocompatibility complex (B) and microsatellite loci in three commercial broiler pure lines. Poult. Sci. 81:1609–1617. Fulton, J. E., H. R. Juul-Madsen, C. M. Ashwell, A. M. McCarron, J. A. Arthur, N. P. O’Sullivan, and R. L. Taylor Jr. 2006. Molecular genotype identification of the Gallus gallus major histocompatibility complex. Immunogenetics 58:407–421. Fulton, J. E., E. E. Young, and L. D. Bacon. 1996. Chicken MHC alloantiserum cross-reactivity analysis by hemagglutination and flow cytometry. Immunogenetics 43:277–288. Goto, R. M., M. Afanassieff, J. Ha, G. M. Iglesias, S. J. Ewald, W. E. Briles, and M. M. Miller. 2002. Single-strand conformation polymorphism (SSCP) assays for major histocompatibility complex B genotyping in chickens. Poult. Sci. 81:1832–1841. Hoque, M. R., S. H. Lee, K. C. Jung, B. S. Kang, M. N. Park, H. K. Lim, K. D. Choi, and J. H. Lee. 2011. Discrimination of Korean Native Chicken populations using SNPs from mtDNA and MHC polymorphisms. Asian-australas. J. Anim. Sci. 24:1637–1643. Iglesias, G. M., L. A. Soria, R. M. Goto, A. M. Jar, M. C. Miquel, O. J. Lopez, and M. M. Miller. 2003. Genotypic variability at the major histocompatibility complex (B and Rfp-Y) in Camperos broiler chickens. Anim. Genet. 34:88–95. Izadi, F., C. Ritland, and K. M. Cheng. 2011. Genetic diversity of the major histocompatibility complex region in commercial and noncommercial chicken flocks using the LEI0258 microsatellite marker. Poult. Sci. 90:2711–2717. Juul-Madsen, H. R., J. E. Hedemand, J. Salomonsen, and M. Simonsen. 1993. Restriction fragment length polymorphism analysis of the chicken B-F and B-L genes and their association with serologically defined B haplotypes. Anim. Genet. 24:243–247. Lima-Rosa, C. A. V., C. Wageck Canal, P. Roberto Vargas Fallavena, L. Brandão de Freitas, and F. M. Salzano. 2005. LEI0258 microsatellite variability and its relationship to B-F haplotypes in Brazilian (blue-egg Caipira) chickens. Genet. Mol. Biol. 28:386–389. Livant, E. J., and S. J. Ewald. 2005. High-resolution typing for chicken BF2 (MHC class I) alleles by automated sequencing. Anim. Genet. 36:432–434. Livant, E. J., D. Zheng, L. W. Johnson, W. Shi, and S. J. Ewald. 2001. Three new MHC haplotypes in broiler breeder chickens. Anim. Genet. 32:123–131. Lwelamira, J., G. C. Kifaro, P. S. Gwakisa, and P. L. M. Msoffe. 2008. Association of LEI0258 microsatellite alleles with antibody response against Newcastle disease virus vaccine and body weight in two Tanzania chicken ecotypes. Afr. J. Biotechnol. 7:714–720. McConnell, S. K., D. A. Dawson, A. Wardle, and T. Burke. 1999. The isolation and mapping of 19 tetranucleotide microsatellite markers in the chicken. Anim. Genet. 30:183–189. Miller, M. M., H. Abplanalp, and R. Goto. 1988. Genotyping chickens for the B-G subregion of the major histocompatibility complex using restriction fragment length polymorphisms. Immunogenetics 28:374–379. Miller, M. M., L. D. Bacon, K. Hala, H. D. Hunt, S. J. Ewald, J. Kaufman, R. Zoorob, and W. E. Briles. 2004. 2004 Nomenclature for the chicken major histocompatibility (B and Y) complex. Immunogenetics 56:261–279. Miller, M. M., R. Goto, and H. Abplanalp. 1984. Analysis of the B-G antigens of the chicken MHC by two-dimensional gel electrophoresis. Immunogenetics 20:373–385. Nikbakht, G., A. Esmailnejad, and N. Barjesteh. 2013. LEI0258 microsatellite variability in Khorasan, Marandi, and Arian chickens. Biochem. Genet. 51:341–349.

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014

wan chicken breeds (Chang et al., 2012), and 25 alleles in 3 Iranian indigenous chicken populations (Nikbakht et al., 2013). In the current study, we found 21 novel alleles in Chinese indigenous chickens that were not found in other chicken populations (Lima-Rosa et al., 2005; Fulton et al., 2006; Schou et al., 2007; Lwelamira et al., 2008; Hoque et al., 2011; Izadi et al., 2011; Chang et al., 2012; Nikbakht et al., 2013). They might be specific in Chinese indigenous chickens. In addition, 28 private alleles showed a breed specificity, and distinct fragment sizes could be used to distinguish these breeds. The entire LEI0258 was sequenced, including the repeat region and 2 flanking regions. The repeat region contained 2 repeat fragments, a 13-bp repeat of CTATGTCTTCTTT and a 12-bp repeat of CTTTCCTTCTTT. The repeat numbers were different. The R13 has 1 to 20 times, and 3 to 27 times for R12. The flanking region consisted of the upstream and the downstream of the repeat region. The upstream region was from −78 to −1, and the downstream region from 1 to 88, including the last repeat. Seven polymorphisms were observed in the flanking region, 2 in the upstream region and 5 in the downstream region. The frequency of C/T (2.35%) and Δ/A (0.94%) downstream of the repeat region was relatively low. The 23 to 31 position upstream of the repeat region was sequenced as ATTTTGAGΔ in this study, which agreed with Hoque et al. (2011) but did not conform with the sequence ATTTGAGG detected by Fulton et al. (2006). This variation may be shared in the Asian chicken breed, but needs further research to confirm. In summary, indigenous chickens showed high polymorphism and genetic diversity. They were important genetic resources for breeding workers to protect and use. Here we evaluated genetic polymorphism in indigenous chickens by detecting the MHC locus using LEI0258 microsatellite marker. Abundant alleles and novel alleles were found, which indicated that plentiful variations existed in local chicken populations. In addition, some rare alleles, such as 28 private alleles found in this study with low frequency, are vulnerable to genetic drift in small populations. It will be a big loss to genetic resources of indigenous breeds if the rare alleles are lost. Therefore, it is necessary to assess genetic information of indigenous breeds. The LEI0258 microsatellite marker with high polymorphism can be used to dynamically monitor the change of genetic resources.

RESEARCH NOTE Schou, T. W., A. Permin, H. R. Juul-Madsen, P. Sorensen, R. Labouriau, T. L. Nguyen, M. Fink, and S. L. Pham. 2007. Gastrointestinal helminths in indigenous and exotic chickens in Vietnam: Association of the intensity of infection with the Major Histocompatibility Complex. Parasitology 134:561–573. Wong, G. K., B. Liu, J. Wang, Y. Zhang, X. Yang, Z. J. Zhang, Q. S. Meng, J. Zhou, D.W. Li, J. J. Zhang, P. X. Ni, S. G. Li, L. H. Ran, H. Li, J. G. Zhang, R. Q. Li, S. T. Li, H. K. Zheng, W. Lin, G. Y. Li, X. L. Wang, W. M. Zhao, J. Li, C. Ye, M. T. Dai, J. Ruan, Y. Zhou, Y. Z. Li, X. M. He, Y. Z. Zhang, J. Wang, X. G. Huang, W. Tong, J. Chen, J. Ye, C. Chen, N. Wei, G. Q. Li,

3119

L. Dong, F. D. Lan, Y. Q. Sun, Z. P. Zhang, Z. Yang, Y. P. Yu, Y. Q. Huang, D. D. He, Y. Xi, D. Wei, Q. H. Qi, W. J. Li, J. P. Shi, M. H. Wang, F. Xie, J. J. Wang, X. W. Zhang, P. Wang, Y. Q. Zhao, N. Li, N. Yang, W. Dong, S. N. Hu, C. Q. Zeng, W. M. Zheng, and B. L. Hao. 2004. A genetic variation map for chicken with 2.8 million single-nucleotide polymorphisms. Nature 432:717–722. Zheng, D., G. O’Keefe, L. Li, L. W. Johnson, and S. J. Ewald. 1999. A PCR method for typing B-L beta II family (class II MHC) alleles in broiler chickens. Anim. Genet. 30:109–119.

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014