ac109 is required for the nucleocapsid assembly of Autographa californica multiple nucleopolyhedrovirus

Virus Research 144 (2009) 130–135

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

ac109 is required for the nucleocapsid assembly of Autographa californica multiple nucleopolyhedrovirus Lin Lin, Jinwen Wang, Riqiang Deng, Jianhao Ke, Hongkai Wu, Xunzhang Wang ∗ State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, 510275 Guangzhou, China

a r t i c l e

i n f o

Article history: Received 27 February 2009 Received in revised form 13 April 2009 Accepted 14 April 2009 Available online 23 April 2009 Keywords: Baculovirus ac109 AcMNPV Nucleocapsid formation

a b s t r a c t ORF109 (Ac109) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is a highly conserved gene in all sequenced baculovirus genomes, but its function is not known. This paper describes generation of an ac109 knockout virus (Ac-ac109-KO-GP) and analyses of the influence of ac109 deletion on the virus replication in Sf-9 cells so as to investigate the role of ac109 in the viral life cycle. Results revealed that budded virus (BV) yields and occlusion body synthesis were completely blocked in cells infected with the mutant virus. Electron microscopy demonstrated that ac109 deletion blocked nucleocapsid formation, though infection was initiated and electron-dense bodies associated with the virogenic stroma appeared. The mutant phenotype was rescued by an ac109 rescue virus. On the other hand, real-time PCR analysis indicated that ac109 is not required for viral DNA replication. Thus, these results suggested that ac109 plays an important role in AcMNPV nucleocapsid formation. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Baculoviruses are insect-pathogenic and insect-specific viruses that have been utilized as biological control agents and vectors for the expression of heterologous proteins in insect cells in culture and insect larvae (Moscardi, 1999; Jarvis, 1997). The Baculovirade family encompasses a group of arthropod-specific DNA viruses with a circular covalently closed genome of 80–180 kb (Ayres et al., 1994; Jakubowska et al., 2006; Herniou et al., 2003). During baculovirus infection cycle, gene transcription is characteristic of early, late, and very late phases. By the host RNA polymerase II, the early gene transcription is initiated from a highly conserved TATA motif which is found in most early gene promoters or from other cis-acting regulatory elements, such as the initiator element CAGT motif (Blissard et al., 1992; Pullen and Friesen, 1995; Garcia-Maruniak et al., 2004). By the virus-encoded RNA polymerase, the late and very late gene transcription is initiated from a highly conserved motif containing the sequence (A/G/T) TAAG that is also found in most late and very late gene promoters (Garcia-Maruniak et al., 2004; Friesen, 1997). Two viral forms, budded virus (BV) and occlusion-derived virus (ODV), are produced during the viral infection cycle (Williams and Faulkner, 1997). BVs and ODVs are identical in nucleocapsid structure and genetic information, but the composition of their

∗ Corresponding author. Tel.: +86 20 84113964; fax: +86 20 84113964. E-mail addresses: [email protected] (L. Lin), [email protected] (X. Wang). 0168-1702/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2009.04.010

envelopes is different to accommodate their respective functions in an infection cycle (Funk et al., 1997; Braunagel and Summers, 1994). BV, generated early in infection when nucleocapsids bud through the plasma membrane, is responsible for systemic spread through the insect host and propagation in tissue culture. In contrast, ODV is responsible for horizontal transmission between insect hosts. Normally in the late stage of AcMNPV infection, BV production is reduced in favor of intranuclear envelopment of nucleocapsids for ODVs synthesis. The resulting ODVs are embedded within large proteinaceous paracrystalline occlusion bodies, also known as polyhedra (Williams and Faulkner, 1997). Autographa californica multiple nucleopolyhedrovirus (AcMNPV), which contains a genome of 134 kbp and about 154 predicted open reading frames (ORFs), is the most intensively studied member of Baculovirade family (Ayres et al., 1994). Comparative analysis of the over 30 completely sequenced baculovirus genomes revealed that there were 29 identified genes in common, which were grouped as the baculovirus core set genes and are therefore likely to serve essential roles in baculovirus life cycles (Garcia-Maruniak et al., 2004; Herniou et al., 2003). Orf109 (ac109) gene of AcMNPV, one of core genes, possesses only a typical late and very late gene promoter motif GTAAG. A previous report has shown that ac109 was expressed at the late stage of the infection life cycle (Jiang et al., 2006). Sequence-based queries performed with InterProScan program showed that Ac109, which is predicted to code for a 44.802 kDa 390-aa protein, belongs to a family of uncharacterized viral proteins of unknown function (family DUF673). With a very detailed proteomic analysis of ODV structure proteins of two baculoviruses (AcMNPV and Culex nigripalpus

L. Lin et al. / Virus Research 144 (2009) 130–135

NPV), AC109 or its homologs (CuniNPV ORF69) was convincingly indentified within ODV (Braunagel et al., 2003; Perera et al., 2007). However, as a core protein and ODV structural protein, the potentially vital role ac109 plays in AcMNPV life cycle is still unknown. To determine the role of ac109 in AcMNPV replication, we constructed an ac109 knockout AcMNPV bacmid via homologous recombination in Escherichia coli. Analyses showed that, though not required for viral DNA replication, ac109 was essential for nucleocapsid assembly and for BV and ODV or polyhedra syntheses in Sf-9 cells, which might provide a rationale for why ac109 is a core baculovirus gene. 2. Materials and methods 2.1. Cells and viruses The insect S. frugiperda cell line Sf-9 cells were cultured at 27 ◦ C in Grace’s medium (Invitrogen Life Technologies) supplemented with fetal bovine serum (10%), penicillin (100 ␮g/ml), and streptomycin (30 ␮g/ml). Bacmid bMON14272, containing an AcMNPV genome, was commercially available (Invitrogen Life Technologies) and propagated in E. coli strain DH10B (Luckow et al., 1993; McCarthy et al., 2008). 2.2. Construction of ac109 knockout AcMNPV bacmid An ac109-knockout AcMNPV bacmid was constructed by homologous recombination in E. coli as previously described (Ke et al., 2008). A transfer vector in which ac109 was replaced by Zeocin for antibiotic selection in E. coli was generated. With primers ac109U1: 5 TATGCGGCCGCACAAATTGGCCGAGCTGATC 3 (NotI site was underlined) and ac109U2: 5 GTCAAGCTTGCAGTCTTTGCTCGGCATTC 3 (HindIII site was underlined), a 515-bp fragment (nt 94 588–95 102) homologous to the upstream sequence of ac109 was PCR amplified from AcMNPV genome. The resulting product was digested with HindIII/NotI and then cloned into vector pET28a-Z (Ke et al., 2008), which was also digested with HindIII/NotI to generate the recombinant plasmid pET28a-US-Z. With primers ac109D1: 5 CATGGATCCCGGAATTTCACAAAGCGATCG 3 (BamH I site was underlined) and ac109D2: 5 GACTCTAGAATACATCACGATGGAGTGCC 3 (XbaI site was underlined), a 523bp fragment (nt 95 381–95 903) homologous to the downstream sequence of ac109 was PCR amplified from AcMNPV genome. The resulting product was digested with BamHI/XbaI and then cloned into vector pET28a-US-Z, which was also digested with BamHI/XbaI to generate the recombinant plasmid pET28a-US-ZDS. The pET28a-US-Z-DS was digested with NotI/XbaI. The resulting linear 1830-bp fragment containing Zeocin and ac109 flank regions was gel purified and suspended in distilled water. An AcMNPV ac109 knockout bacmid was generated by using a modification of the ␭phage Red recombinase system. Electro-competent DH10B cells harboring bMON14272 were first transformed with pBAD-gbaA which supplied ␭ Red recombination function (Muyrers et al., 1999). The resulting clone cells were then induced by the addition of l-arabinose to allow expression of the ␭ Red system, made competent and electro-transformed with 1 ␮g of the purified linear 1830-bp fragment as previously described (Pijlman et al., 2002). The electroporated cells were incubated at 37 ◦ C for 1 h in 1 ml SOC, 200 ␮1 was subsequently spreaded onto low salt LB agar containing 25 ␮g/ml Zeocin, 50 ␮g/ml Kanamycin. Plates were incubated at 37 ◦ C for 24 h, and colonies resistance to Zeocin and Kanamycin were selected and verified by PCR analysis. The resulting AcMNPV ac109 knockout bacmid was named Ac-ac109-KO.

131

The deletion of ac109 from the AcMNPV bacmid genome was confirmed by PCR analysis. Primer pairs, ac109U1 and ZeoP1 (Ke et al., 2008) as well as ZeoP2 (Ke et al., 2008) and ac109D2, were used to detect the correct junction between the upstream or downstream and Zeocin. Primers ac109U1 and ac109D2 were used to confirm the correct junction between upstream and downstream. 2.3. Construction of knockout, repair and wt AcMNPV bacmids with polyhedrin and gfp To confirm that the traits of the ac109 knockout were due to the deletion of the ac109, an ac109-repair bacmid was constructed. With primers REP1: 5 ACGTCTAGAGAGTTGTGGGCTTGGATGATG 3 (XbaI site was underlined) and REP2: 5 TTACTCGAGCCATTACAATTACGTGCCCG 3 (XhoI site was underlined), a 1369-bp XbaI/XhoI fragment containing the wt ac109 gene with its own promoter was PCR amplified. The resulting product was digested with XbaI/XhoI and cloned into XbaI/XhoI digested pFB-ieGP (Li et al., 2005), which contains two marker genes polyhedrin and green fluorescent protein (gfp), to generate pFB-ieGPac109. The electro-competent DH10B cells harboring wt bacmid and the helper plasmid pMON7124 were transformed with pFB-ieGP to generate the wt control bacmid (Ac-GP). The electro-competent DH10B cells harboring Ac-ac109-KO bacmid and the helper plasmid pMON7124 were transformed with pFB-ieGP and pFB-ieGP-ac109 to generate the ac109 knockout bacmid (Ac-ac109-KO-GP) and the ac109 repair bacmid (Ac-ac109-REP-GP), respectively. The successful transposition of ac109 was confirmed by PCR with primers REP1 and REP2. The correct recombinant bacmid was isolated and electroporated back into DH10B cell, and colonies were screened for sensitivity to tetracycline to ensure that the isolated bacmid was free of the helper plasmid. 2.4. Virus growth curve To assess whether ac109 knockout affect virus formation, a viral growth curve analysis was performed as previously described (Ke et al., 2008). 2 × 106 Sf-9 cells were transfected in triplicate with 2.0 ␮g of each bacmid DNA (Ac-GP, Ac-ac109-KO-GP, Ac-ac109-REP-GP) using Cellfectin liposome reagent (Invitrogen Life Technologies). Virus supernatant was collected at various posttransfection times. BV production was determined by TCID50 end point dilution assay in Sf-9 cells (O’Reilly et al., 1992). 2.5. DNA replication analysis by real-time PCR To assess whether ac109 is required for viral DNA replication, a quantitative real-time PCR (Q-PCR) assay was performed as described previously (Ke et al., 2008). 2 × 106 Sf-9 cells were transfected in triplicate with 2.0 ␮g of each bacmid DNA (Ac-GP, Ac-ac109-KO-GP and Ac-ac109-REP-GP). At designated time points, cells were harvested and washed twice with PBS. Total DNA was isolated from transfected Sf-9 cells at 0, 24, 48, 72 and 96 h p.t. using Universal Genomic DNA Extraction kit (TaKaRa) according to manufacturer’s instructions. The total DNA was diluted to a total volume of 50 ␮l with sterile water. 10 ␮l of total DNA from each time point were digested using 10 U of DpnI restriction enzyme (NEB) overnight in 50 ␮l total volume to eliminate input bacmid prior to PCR analysis. With primers described previously (Vanarsdall et al., 2005), the real-time PCR reaction was performed using 12.5 ␮l of the digested DNA added to iQTM SYBR® Green Supermix (Bio-rad) according to manufacturer’s instructions in the iQTM 5 machine (Bio-rad) and using following conditions: denaturation at 95 ◦ C for 5 min, followed by 45 cycles of 95 ◦ C for 30 s, 60 ◦ C for 20 s and 72 ◦ C for 20 s. Melting curve analysis was performed at the end of each PCR assay for specificity control. A standard curve was created with

132

L. Lin et al. / Virus Research 144 (2009) 130–135

Fig. 1. Construction of ac109 knockout, repair, and wt AcMNPV recombinant bacmids. (A) Schematic diagram for replacement of ac109 gene with Zeocin to construct an ac109 knockout bacmid in E. coli. A 278-bp fragment of the ac109 orf was deleted and replaced by Zeocin under the control of the EM7 promoter for antibiotic selection. (B) Diagram indicating the positions of primer pairs used in the confirmation of disruption of ac109 and the correct insertion of Zeocin in ac109 locus. (C) PCR confirmation of the presence or absence of sequence modifications in Ac-ac109-KO or wt AcMNPV bacmids. The virus templates are shown above each lane, and the primer pairs used are shown below. (D) Schematic diagram for insertion of the polyhedrin and gfp genes into the polyhedrin locus of the recombinant bacmids by Tn7-mediated transposition. (E) PCR Confirmation of the sequence modifications in Ac-GP, Ac-ac109-KO-GP and Ac-ac109-REP-GP by using primers REP1 and REP2.

a twofold sample of purified Ac-GP DNA templates at 96 h p.t. used in the quantitative PCR. Five dilutions (each 1:10) were prepared to cover the workable concentrations of the DNA templates. 2.6. Electron microscopy 2 × 106 Sf-9 cells were transfected with 2.0 ␮g of each bacmid DNA (Ac-GP and Ac-ac109-KO-GP). At designated time points, cells were dislodged and pelleted at 3000 × g for 10 min. Cells were fixed, dehydrated, embedded, sectioned, and stained as described previously (Li et al., 2005). Samples were observed under a JEM-100CXII transmission electron microscope operation at 80 kV. 3. Results 3.1. Construction of recombinant bacmids To determine if ac109 is essential for viral replication, ac109 knockout, repair, and wt AcMNPV bacmids containing gfp (green fluorescent protein) and polyhedrin were constructed. In ac109 knockout bacmid (Ac-ac109-KO), a 278-bp fragment of ac109 coding region (nt 95 103–95 380) was replaced with Zeocin by homologous recombination (Fig. 1A), which was confirmed by PCR (Fig. 1B and C). PCR with primers ac109U1 and ZeoP2 showed a 1307-bp band for Ac-ac109-KO, but no PCR product for wt bacmid. Primers ZeoP1 and ac109D2 produced a 1315-bp PCR product in Acac109-KO, but no PCR product in wt bacmid. Primers ac109U1 and ac109D2 produced an 1830-bp PCR product in Ac-ac109-KO, but a 1316-bp PCR product in wt bacmid. To facilitate the observation of BV transmission and occlusion morphogenesis, two marker genes, polyhedrin and gfp, were intro-

duced into the polyhedron locus of ac109 knockout bacmid by Tn7 mediated transposition (Fig. 1D). The resulting bacmid was named Ac-ac109-KO-GP. To confirm the phenotype resulting from ac109 deletion, a rescue bacmid (Ac-ac109-REP-GP) was constructed through introducing ac109, polyhedrin, and gfp into the polyhedrin locus of Ac-ac109-KO by transposition (Fig. 1D). The ac109 gene was under the control of its native promoter and the successful transposition was confirmed by PCR with primers REP1 and REP2 (Fig. 1E). PCR result showed a single band of 1369-bp and 1883-bp for Ac-ac109-GP and Ac-ac109KO-GP, respectively, but two bands of 1883 bp and 1369 bp for Acac109-REP-GP. Ac-GP, the positive control bacmid, was also generated through introducing two marker genes into the polyhedrin locus of the wt bacmid by transposition (Fig. 1D). Transposition event of polyhedrin and gfp marker genes was confirmed later by gfp expression and occlusion body formation in bacmid DNA-transfected Sf-9 cells. 3.2. Replication analysis for recombinant bacmids in transfected Sf-9 cells To determine the effect of ac109 deletion on virus replication, Sf-9 cells were transfected with Ac-GP, Ac-ac109-KO-GP, and Acac109-REP-GP, respectively. Fluorescence due to the expression of gfp in transfected cells was monitored (Fig. 2A). By 24 h p.t., similar amounts (approximately 10%) of cells transfected with the three viruses showed fluorescence, indicating comparable transfection efficiencies. By 72 h p.t., almost all Ac-GP or Ac-ac109-REP-GP transfected cells showed fluorescence, indicating the capability of these two viruses to generate infectious BV from the initial transfection. In sharp contrast, the amount of Ac-ac109-KO-GP transfected cells

L. Lin et al. / Virus Research 144 (2009) 130–135

133

Fig. 2. Viral replication in Sf-9 cells transfected with recombinant bacmid DNA. (A) Fluorescence microscopy of Ac-GP, Ac-ac109-KO-GP, and Ac-ac109-REP-GP transfected Sf-9 cells at 24 h p.t. and 72 h p.t. (B) Light microscopy of Ac-GP, Ac-ac109-KO-GP, and Ac-ac109-REP-GP transfected Sf-9 cells at 96 h p.t. (C) Virus growth curve generated from Ac-GP, Ac-ac109-KO-GP, and Ac-ac109-REP-GP-transfected Sf-9 cells. Cells were transfected with 2.0 ␮g of bacmid DNA and cultured at 27 ◦ C. Supernatants were harvested at the selected time points and assessed for infectious virus by TCID50 assay. Each datum point represents the average titer derived from three independent transfected cultures. Error bars represent standard errors.

showing fluorescence kept unchanged from 24 h p.t. to 72 h p.t. even to 96 h p.t. (Fig. 2A), indicating lack of virus spread beyond the initially transfected cells. Similarly, by 96 h p.t., occlusion bodies appeared in nearly all cells transfected with Ac-GP or Ac-ac109-REP-GP, while no occlusion body was observed in cells transfected with Ac-ac109-KO-GP (Fig. 2B). Effect of ac109 knockout on BV replication was also determined with a virus growth curve generated by 50% tissue culture infective dose (TCID50 ). Results revealed that Sf-9 cells transfected with Ac-GP or Ac-ac109-REP-GP showed a normal and similar increase in BV production (Fig. 2C), implying a similar proficiency in virus production between the two viruses. In contrast, no BV was detectable in Ac-ac109-KO-GP transfected cells at any time point up to 96 h p.t. (Fig. 2C), indicating lack of infectious virus production. These results demonstrated that ac109 is required for the syntheses of BVs and occlusion bodies. 3.3. Effect of ac109 deletion on viral DNA replication To detect whether the knockout of ac109 affects viral DNA replication, a real-time PCR analysis was performed by comparing the initiation and levels of viral DNA replication among Ac-GP, Acac109-REP-GP, and Ac-ac109-KO-GP transfected cells. The result showed that the initiation time of viral DNA replication and the increase of DNA levels by 24 h p.t. (Fig. 3) were similar among the cells transfected with the three bacmids, which indicated that viral DNA replication in the ac109 knockout virus transfected cells was not affected by deletion of the gene. A great difference of DNA levels from 24 h p.t. to 96 h p.t. between Ac-ac109-KO-GP and Ac-GP or

Fig. 3. Analysis of viral DNA replication in transfected Sf-9 cells by real-time PCR. Sf-9 cells were transfected in triplicate with 2.0 ␮g of Ac-GP, Ac-ac109-KO-GP, or Acac109-REP-GP bacmid. At the designated time points, total cellular DNA was isolated and digested with the restriction enzyme DpnI to eliminate input bacmid, and then analyzed by real-time PCR. The vertical bar height indicates the average viral DNA replication levels (folds relative to the viral DNA amounts at 0 h p.t.) and the error bar represents the standard deviation.

134

L. Lin et al. / Virus Research 144 (2009) 130–135

Fig. 4. Electron microscopic analysis of Sf-9 cells transfected with either Ac-GP (A and B) or Ac-ac109-KO-GP (C and D) at 36 h p.t. B and D are higher magnification of the rectangles in A and C, respectively. The nucleus (N), cytoplasm (C), and virogenic stroma (VS) regions are indicated. Black arrow indicates nucleocapsid in the virogenic stroma. For A–D, the bar represents 1 ␮m.

Ac-ac109-REP-GP was observed, which could be due to secondary infections in Ac-GP and Ac-ac109-REP-GP transfected cells, since viral DNA replication of Ac-ac109-KO-GP was restricted to the initially transfected cells. 3.4. Electron microscopy of ac109 knockout and wt transfected Sf-9 cells Sf-9 cells infected with Ac-GP or Ac-ac109-KO-GP were examined by electron microscope to detect any effect of ac109 deletion on virus morphogenesis. The nuclei of Ac-GP infected cells exhibited the typical baculovirus infection symptoms, including enlarged nuclei and a typically reorganized electron-dense virogenic stroma (VS, the putative site of nucleocapsid assembly) enriched with nucleocapsids (Fig. 4A and B). There were bundles of nucleocapsids aligning with envelopes (data not shown). And occlusion bodies containing ODVs were observed locating within the ring zone which yields along with maturation of the VS and is a significant and morphologically distinct peristromal compartment of nucleoplasm. In contrast, the Ac-ac109-KO-GP transfected cells exhibited only some typical infection symptoms, i.e. enlarged nuclei and electrondense bodies associated with VS (Fig. 4C and D). No nucleocapsids were found in Ac-ac109-KO-GP transfected cells, though preliminary infection was initiated, implying that ac109 deletion would lead to nucleocapsid assembly failure. 4. Discussion Baculovirus ac109 has been identified as one of the 29 baculovirus core set genes, which are highly conserved (GarciaMaruniak et al., 2004; Herniou et al., 2003). Although previous experiments did not examine the role of ac109 in the context of viral replication, as a core gene, it is most likely an essential gene for virus replication. This study, by comprehensive analyses of an ac109-null virus, provides primary evidence that ac109 gene is required for nucleocapsid formation and subsequent BV syntheses, though not essential for viral DNA replication.

Homologous recombination technology was used in the present study to delete ac109 from the AcMNPV genome, which allowed us to investigate the role of the gene in the life cycle of AcMNPV. The ac109-null virus exhibited such a phenotype that DNA transfection initiated the infection, while virus production was apparently defective due to the inability to generate nucleocapsids and BVs, which restricted the infection to the initially transfected Sf-9 cells. Electron microscopy demonstrated that formation of nucleocapsids was blocked, though the ac109-null virus transfected cells exhibited evident signs of initial viral infection, which include enlargement of the cell nucleus and formation of a loose network of granular material and a clear configuration of virogenic strom. The result from real-time PCR analysis indicated that viral DNA replication was not affected by ac109 deletion. The phenotype was directly due to the deletion of ac109 from AcMNPV bacmid DNA and not from a secondary mutation or disruption of regulatory elements located at the ac109 locus, since the wild-type phenotype was rescued by reinsertion of ac109 into the polyhedrin locus of the mutant bacmid. AcMNPV nucleocapsid morphogenesis is a complex procedure that involves synthesis and correct processing of viral DNA and production of structural proteins (Williams and Faulkner, 1997). First, the capsid proteins enter the nuclei and assemble many long fascicular arranged hollow-tube structures called capsid sheath. Then the viral DNA is packaged into a preassembled capsid sheath that turns into solid structure with high electronic density to form the mature nucleocapsid (Williams and Faulkner, 1997; Bassemir et al., 1983). Thus far a number of genes have been shown to involve in the process of nucleocapsid formation. For example the AcMNPV nucleocapsid protein VP1054, as a structural component of both BVs and ODVs, was demonstrated essential for nucleocapsid assembly (Olszewski and Miller, 1997). AcMNPV VLF-1, which is both a putative tyrosine recombinase and a component of nucleocapsid, plays a crucial role in nucleocapsid assembly and vlf-1-knockout virus produced malformed nucleocapsids (Yang and Miller, 1998; Vanarsdall et al., 2004; Li et al., 2005). Ac53, a highly conserved gene exist-

L. Lin et al. / Virus Research 144 (2009) 130–135

ing in all sequenced Lepidoptera and Hymenoptera baculoviruses, was shown to involve in nucleocapsid assembly (Liu et al., 2008). Another core gene, ac38K, is also required for the assembly of normal nucleocapsid (Wu et al., 2006). By separating BV and ODV into the nucleocapsid and envelope components through biochemical fractionation and Western blotting, 38K was found associated with the nucleocapsids. And by Yeast two-hybrid assays, 38K was also found interacted with nucleocapsid proteins VP1054, VP39, VP80 (Wu et al., 2008). Similar mutant phenotype was observed in the present study and AC109 was also convincingly identified as a component of ODV (Braunagel et al., 2003; Perera et al., 2007), though it is unclear if AC109 is also a component of BV and Western blot analysis will be required to address this possibility. Perhaps just like another core gene ac38K, the protein of ac109 played a role in nucleocapsid assembly by interacting with other proteins. Further study addressing this possibility would lead to a better understanding for the events associated with virus nucleocapsid assembly. The present study might lead to a better understanding of the molecular aspects of this protein and the molecular basis for factors governing these processes. Acknowledgments We gratefully thank Dr. Yi Luo for providing useful suggestion during the course of the study. This work was funded by the Natural Science Foundation of Guangdong Province under Grant 4203388, Research Fund for the Doctoral Program of Higher Education of China under grant no. 200805580033 and the State Key Laboratory for Biocontrol under grant no. SKLBC-08-B-01. References Ayres, M.D., Howard, S.C., Kuzio, J., Lopez-Ferber, M., Possee, R.D., 1994. The complete DNA sequence of Autograph californica nuclear polyhedrosis virus. Virology 202, 586–605. Bassemir, U., Miltenburger, H.G., David, P., 1983. Morphogenesis of nuclear polyhedrosis virus from Autographa californica in a cell line from Mamestra brassicae (cabbage moth). Further aspects on baculovirus assembly. Cell Tissue Res. 228, 587–595. Blissard, G.W., Kogan, P.H., Wei, R., Rohrmann, G.F., 1992. A synthetic early promoter from a baculovirus: roles of the TATA box and conserved start site CAGT sequence in basal levels of transcription. Virology 190, 783–793. Braunagel, S.C., Russell, W.K., Rosas-Acosta, G., Russell, D.H., Summers, M.D., 2003. Determination of the protein composition of the occlusionderived virus of Autographa californica nucleopolyhedrovirus. Proc. Natl. Acad. Sci. U.S.A. 100, 9797–9802. Braunagel, S.C., Summers, M.D., 1994. Autographa californica nuclearpolyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids:structural proteins, antigens, lipid and fatty acid profiles. Virology 202, 315–328. Friesen, P.D., 1997. Regulation of baculovirus early gene expression. In: Miller, L.K. (Ed.), The Baculoviruses. Plenum Press, New York, USA, pp. 141–166. Funk, C.J., Braunagel, S.C., Rohrmann, G.F., 1997. Baculovirus structure. In: Miller, L.K. (Ed.), The Baculoviruses. Plenum Press, New York, USA, pp. 7–32.

135

Garcia-Maruniak, A., Maruniak, J.E., Zanotto, P.M.A., Doumbouya, A.E., Liu, J.C., Merritt, T.M., Lanoie, J.S., 2004. Sequence analysis of the genome of the Neodiprion sertifer nucleopolyhedrovirus. J. Virol. 78, 7036–7051. Herniou, E.A., Olszewski, J.A., Cory, J.S., O’Reilly, D.R., 2003. The genome sequence and evolution of baculoviruses. Annu. Rev. Entomol. 48, 211–234. Jakubowska, A.K., Peters, S.A., Ziemnicka, J., Vlak, J.M., van Oers, M.M., 2006. Genome sequence of an enhancin gene-rich nucleopolyhedrovirus (NPV) from Agrotis segetum: collinearity with Spodoptera exigua multiple NPV. J. Gen. Virol. 87, 537–551. Jarvis, D.L., 1997. Baculovirus expression vectors. In: Miller, L.K. (Ed.), The Baculovirus. Plenum Press, New York, pp. 341–389. Jiang, S.S., Chang, I.S., Huang, L.W., Chen, P.C., Wen, C.C., Liu, S.C., Chien, L.C., Lin, C.Y., Hsiung, C.A., Juang, J.L., 2006. Temporal transcription program of recombinant Autographa californica multiple nucleopolyhedrosis virus. J. Virol. 80, 8989–8999. Ke, J., Wang, J., Deng, R., Wang, X., 2008. Autographa californica multiple nucleopolyhedrovirus ac66 is required for the efficient egress of nucleocapsids from the nucleus, general synthesis of preoccluded virions and occlusion body formation. Virology 374, 421–431. Li, Y., Wang, J., Deng, R., Zhang, Q., Yang, K., Wang, X., 2005. vlf-1 deletion brought AcMNPV to defect in nucleocapsid formation. Virus Genes 31, 275–284. Liu, C., Li, Z., Wu, W., Li, L., Yuan, M., Pan, L., Yang, K., Pang, Y., 2008. Autographa californica multiple nucleopolyhedrovirus ac53 plays a role in nucleocapsid assembly. Virology 382, 59–68. Luckow, V.A., Lee, S.C., Barry, G.F., Olins, P.O., 1993. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 67, 4566–4579. McCarthy, C.B., Dai, X., Donly, C., Theilmann, D.A., 2008. Autographa californica multiple nucleopolyhedrovirus ac142, a core gene that is essential for BV production and ODV envelopment. Virology 372, 325–339. Moscardi, F., 1999. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257–289. Muyrers, J.P., Zhang, Y., Testa, G., Stewart, A.F., 1999. Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res. 27, 1555–1557. Olszewski, J., Miller, L.K., 1997. Identification and characterization of a baculovirus structural protein, VP1054, required for nucleocapsid formation. J. Virol. 71, 5040–5050. O’Reilly, D.R., Miller, L.K., Luckow, V.A., 1992. Baculovirus Expression Vector: A Laboratory Manual. W.H. Freeman, Co., New York, USA. Perera, O., Green, T.B., Stevens Jr., S.M., White, S., Becnel, J.J., 2007. Proteins associated with Culex nigripalpus nucleopolyhedrovirus occluded virions. J. Virol. 81, 4585–4590. Pijlman, G.P., Dortmans, J.C., Vermeesch, A.M., Yang, K., Martens, D.E., Goldbach, R.W., Vlak, J.M., 2002. Pivotal role of the non-hr origin of DNA replication in the genesis of defective interfering baculoviruses. J. Virol. 76, 5605–5611. Pullen, S.S., Friesen, P.D., 1995. The CAGT motif functions as an initiator element during early transcription of the baculovirus transregulator ie-1. J. Virol. 69, 3575–3583. Vanarsdall, A.L., Okano, K., Rohrmann, G.F., 2004. Characterization of a Baculovirus with a deletion of VLF-1. Virology 326, 191–201. Vanarsdall, A.L., Okano, K., Rohrmann, G.F., 2005. Characterization of the replication of a baculovirus mutant lacking the DNA polymerase gene. Virology 331, 175–180. Williams, G.V., Faulkner, P., 1997. Cytological changes and viral morphogenesis during baculovirus infection. In: Miller, L.K. (Ed.), The Baculoviruses. Plenum Press, New York, USA, pp. 61–107. Wu, W., Liang, H., Kan, J., Liu, C., Yuan, M., Liang, C., Yang, K., Pang, Y., 2008. Autographa californica multiple nucleopolyhedrovirus 38K is a novel nucleocapsid protein that interacts with VP1054, VP39, VP80, and itself. J. Virol. 82, 12356–12364. Wu, W., Lin, T., Pan, L., Yu, M., Li, Z., Pang, Y., Yang, K., 2006. Autographa californica multiple nucleopolyhedrovirus nucleocapsid assembly is interrupted upon deletion of the 38K gene. J. Virol. 80, 11475–11485. Yang, S., Miller, L.K., 1998. Expression and mutational analysis of the baculovirus very late factor 1 (vlf-1) gene. Virology 245, 99–109.