Accurate identification of closely related Dendrobium species with multiple species-specific gDNA probes

J. Biochem. Biophys. Methods 62 (2005) 111 – 123 www.elsevier.com/locate/jbbm

Accurate identification of closely related Dendrobium species with multiple species-specific gDNA probes Tongxiang Li, Jinke Wang, Zuhong Lu* Chien-Shiung Wu Laboratory, Southeast University, Nanjing 210096, P.R. China Received 10 March 2004; received in revised form 6 August 2004; accepted 10 October 2004

Abstract About 63 species of Dendrobium are identified in China, making the identification of the origin of a particular Dendrobium species on the consumer market very difficult. We report evaluation of multiple species-specific probes screened from genomic DNA for closely related Dendrobium species identification, based on DNA array hybridization. Fourteen species-specific probes were screened from five closely related Dendrobium species, D. aurantiacum Kerr, D. officinale Kimura et Migo, D. nobile Lindl., D. chrysotoxum Lindl. and D. fimbriatum Hook., based on the SSH-Array technology we developed. Various commercial Dendrobium samples and unrelated samples were definitely identified. The specificity and accuracy of the multiple species-specific probes for species identification was assessed by identifying various commercial Dendrobium samples (Herba Dendrobii). Hybridization patterns of these multiple probes on digested genomic DNAs of Dendrobium species indicated that there are distinct polymorphic sequence fragment in the higher eukaryotes. This is the first report on detection and utilization of multiple speciesspecific probes of Dendrobium in whole genomic DNA, and this could be useful tools not only for a new technical platform for the closely related species identification but also for epidemiological studies on higher eukaryotes. D 2004 Elsevier B.V. All rights reserved. Keywords: Identification; DNA array; Species-specific probes; Dendrobium

* Corresponding author. Fax: +86 025 83619983. E-mail address: [email protected] (Z. Lu). 0165-022X/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.jbbm.2004.10.006

112

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

1. Introduction The traditional Chinese medicine Herba Dendrobii (stems of Dendrobium) has been used in the preparation of herbal medicine in many Asian countries for hundreds of years [1]. A large quantity of Herba Dendrobii is needed throughout the world, particularly in Southeast Asia. There are about 1100 Dendrobium species in the world and 63 species Dendrobium found in China [2]. However, according to the Pharmacopoeia of the People’s Republic of China, only five of these carry the name Herba Dendrobii on the market of herbal medicine and they have different efficacy [3]. The most commonly used Herba Dendrobii is the stems of D. officinale Kimura et Migo. The authentic identification of Herba Dendrobii is very difficult for consumers. Commercial form of Dendrobium (Herba Dendrobii) is very similar to adulterants made from the stems of various other species of Dendrobium in appearance and tissue structure, particularly to an unrelated genus of P. chinensis Lindl., which is not herbal medicine [4–6]. Therefore, the adulterants of Herba Dendrobii are sold in markets [7]. The close resemblance of different types of Herba Dendrobii greatly compromises the value of traditional medicines in the market place [8]. Thus, the rapid and accurate identification of Herba Dendrobii is very important for quality control, safe use and therapeutic application of Herba Dendrobii. The first task in therapeutic application of the traditional Chinese medicine is to distinguish not only between the various species but with false species also. The general approaches to herbal identification are dependent on morphological [9,10], anatomical [11,12] and chemical analyses [13]. However, these characteristics are often affected by environmental and developmental factors during plant growth. Additionally, medicinal plants are processed for use as crude drugs, causing many morphological and anatomical characteristics as well as some chemical constituents to change. Although many molecular techniques have been developed for species identification by genotypic patterns, including ribotyping [14,15], random amplified polymorphic DNA (RAPD) [16,17], PCR amplification of the internal transcribed spacer 16S–23S (ITS 16–23S PCR) [18], ITSPCR-RFLP [19], PCR-specific identification [20] and mip gene sequencing [21]. Those methods provide possible tools to identify species directly based on their genomic sequences. However, none of them has been applied as a routine and reliable method for species identification possibly due to their inconvenient detection processes or inconsistent results [14]. Among these techniques, molecular techniques mainly based on rRNA ITS were used to identify Herba Dendrobi by several groups [7,8,22]. Unfortunately, the method for sequencing the unique sequence in the ITS region in each experiment are costly. Consequently, it has not been applied as a convenient method for routine identification. There are two possible approaches to improving such methods. One is to find new species-specific probes in the whole genome that are able to distinguish between closely related species, and another is to use multi-species-specific probes to identify the species. In this paper, we successfully identified several closely related Dendrobium species by using multiple species-specific gDNA probes (MSSP). These species-specific gDNA probes were screened from genomic DNAs of five commonly used Dendrobrium species including three of Herba Dendrobii listed in the P.R.C. Pharmacopoeia by the SSH-Array technology that we developed [23]. The construction, validation and the characteristics of

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

113

these specific probes are described. The MSSP were used to fabricate a DNA array for identification of commercial Dendrobrium samples. The RsaI-digested DNAs of tested samples were labeled by PCR reaction with DIG-primer, and then hybridized with the DNA array. The results revealed that MSSP could exactly identify these commercial samples (Herba Dendrobii) and could detect their target sample from a complex material and adulterant of Herba Dendrobii correctly.

2. Materials and methods 2.1. Preparation of the tested samples The tested samples were prepared as follow: the stems of five commercial Dendrobium samples (Herba Dendrobii) were provided by Zhejiang Tianhuang Pharmaceutical Company (Zhejiang, China), and identified by its experienced herbs experts before sending to our laboratory. A mixture of a commercial D. officinale Kimura et Migo and a natural D. nobile Lindl. was used as complex material. P. chinensis Lindl. sample, which is the most commonly used adulterant of Herba Dendrobii, was used as a further assessed experimental material. 2.2. Extraction of genomic DNA The gDNAs were extracted from the tested samples by the method described by Frederick et al. [24]. In brief, 0.3 g sample was powdered and dissolved with DNA extraction buffer (100 mM Tris–HCl pH 8.0, 20 mM EDTA pH 8.0, 1.4 M NaCl, 2% CTAB, 0.2% h-mercaptoethanol). The mixture was incubated at 60 8C for 2 h and then centrifuged at 9000 rpm for 10 min. The supernatant was transferred and extracted with phenol/chloroform/isoamyl alcohol (25:24:1) and chloroform/isoamyl alcohol (24:1), respectively. The gDNAs were then pelletted with cold absolute ethanol from aqueous phase and dissolved in 600 Al TE and 6 Al RNaseA, followed by incubation at 37 8C for 30 min. The gDNAs were precipitated with 300 Al 7.5 M NH4Ac and 2100 Al 100% ethanol, and washed with 70% ethanol. The gDNA pellets were air dried and dissolved in 60 Al of sterile ddH2O. 2.3. Treatment of gDNAs of the tested samples The extracted gDNAs were completely digested with RsaI in the solution of 10 mM Tris–HCl, pH 7.9, containing 50 mM NaCl, 10 mM MgCl2, 1 mM DTT, 0.1 Ag/Al acetylated BSA, 0.05 Ag/Al DNA and 0.25 U/Al RsaI for 4 h at 37 8C. After digestion, the gDNAs were ligated to an adaptor (5V-AGGCAACTGTGCTATCCGAGGGAA-3V) (ShengYou, Shanghai, China) in a 10-Al ligation reaction containing 50 mM Tris–HCl, pH 7.8, 10 mM MgCl2, 2 mM DTT, 0.05 mg/ml BSA, 800 ng RsaI-digested gDNA, 400 units T4 DNA ligase (Promega, USA) and 2 Ag adaptor, respectively. The ligation reaction was performed overnight at 16 8C. The adaptor-ligated gDNAs were amplified with a 50Al PCR reaction containing 20 mM Tris hydrochloride pH 8.4, 50 mM KCl, 1.5 mM

114

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

Table 1 The sequences of 14 species-specific probes of 5 Dendrobrium species Dendrobrium species

Probe code

Size (bp)

Sequence (5VY3V)

D.aurantiacum Kerr

A1

151

A2

179

A3

159

O1

115

O2

149

O3

399

CACACTGCCATCTCCCAGGAGGGAGAAAAAGGAGAAGGTCTGCTGCTGTCACCAGGAGGGTGACATAGCGTTTGGTATTCCGCCACACCGGGGGAGGTGAAAGGGAGTTTTGTAAAGGCTTCTCCGCCTTGCTGTGGGAGCAAAAGGAGAG ATTTACCGCCTGGGACAATTAGACATCCAACCCGTAATCGCAACGACCCAATTGCAAGAGCGGAGCTCTACCAACTGAGCTATATCCCCCCGAGCCGAGTGAAGCATGCATGAAAGAGTCAGATGCTTCTTCTATTCTTTTCCCTGGCGCAGCTGGGCCATCCTGGACTTGAACCAGAG TGCTGAAGAATTGACCGGTTCCTCCTGGGCCAGAAAGAAGCAGGCACATCCCCTTCTCTGTGACACACCCTGTCCACGCCCCTGGTTCTTAGTTCCAGCCCCACTCATAGGACACTCATAGCTCAGGAGGGCTCCGCCTTCAATCCCACCCGCTAAAGT CCTTACTGAGAGTGCACATATGCGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGATTGGCTATTGGCCATTGCATACGTTGTATCCATATCATAATATGT TCGGGTGGGATTGAAGGCGGAGCCCTCCTGCAGCTATTAGTGTCCTATGAGTGGGGCTGGAACTAATAACCAAGGGCGTGGACAGGGTGTGTCTCTGATAAGGGGATGTGCCATGCTTCTTACTGGCCCATGAGGAGCCGGTTCAGTCC TTAATTGATAATAAGCGAAAGGGAGTTTTGGGAGAGTAAGAGAGTTCTTGCAAGTGGAGAGTGTGAAGGGATCACATGGTTAATAAAAGGTAAGAACCTCTTTTTGTGATGTTAATTATCTTTCTTACTTATTTTAGTAATTAGAGAGAATAAATTTAGAGAAGACCTGGTTCTCTGCCAACAACTGGACGGTGTGAAAGGATGGCGGTTCTCTACAGATAACAGGAGGGTGTGAAAGGATGATAGTTCTCTGCCGACACTTAGAGGGTGTGAAAGGTTGACAGTTCTCTATTGAAAGTTAGAGGGTGTGAAAGGATGATGGTTCTCTACCGACACTTAGAGGGCGAGAAATGACAATGATACTCTGCCGACACTTGGAGGGTGTGAAAGGATGATGGT

D. officinale Kimura et Migo

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

115

Table 1 (continued) Dendrobrium species

Probe code

Size (bp)

Sequence (5VY3V)

D. officinale Kimura et Migo

O4

359

D. nobile Lindl.

N1

453

N2

163

C1

83

C2

120

AATACTGCACAGATGCGTAAGGAGAAAATACCGCATCAGATTGGCTATTGGCCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCTCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGT AGACTGAACCAGAGGAAGAGACTACGAATCTGTGTTTTTATGGGAGAAAATCAAAGTGATGAGGAAGAGGTGTGTAAATCAACCTATGATGAGTTGTTTGAAATTTGTGAAAAAATCCATGCATCATACAAAAAACTTAAGAAGACTCATGCTAGTCTAAAATTAGAACATTCAAATCTACAAAAAGAGCATGAAGTTTTTCTCAAAGATCATGCAACGATTGATACAAATCTCATGGCTCTTCTTGATGAATTTGATGAGTTGAACAAAAAGCATTTAGAATTAGTTGATGAACATAATGCATTAAAATATTCACACACCTCACTTAGTTTTGATCTTAAGAAATCTGAAGAGATTGAGAAAAATTTGAGGATTGAGATTGATGCATTAAAAAGAACAAATTTGAGGATTCAAAATGATTTTGATACATATAAGAAAAATCTGATGACTTCT GTGGAGTTGGGGTGGGCAGGCTCATTTGGGATATATATACGAAAGACAAGAAAAACTATTCTGAAATGTCAATTCGCAACGTATGTTGGCCGTGCATCGTCCCGGTCCGATCATGGGTCAGCCAGGAAGAGTCTACTTAATTGCTGTTGAACGGAACCCACTT TAACCGTAGGCACAGCACCTCTTTTGAGATCATTGGATATTCTCGACTCTGACTTTGCGGGGTGTAGGGTGGATAGGAAGAGT CACAATGTCTCCTCTACTGCACCCCGGCATAGTCAGAATCAGAGTATCCAATGATCTCAAAAGAGGTGCTGTGCCTAGGGCACCTCGGCCGCGACCACGCTTAATTATTCCATCTGACGT

D. chrysotoxum Lindl.

(continued on next page)

116

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

Table 1 (continued) Dendrobrium species

Probe code

Size (bp)

Sequence (5VY3V)

D. fimbriatum Hook.

F1

260

F2

251

F3

143

GCCTTCGCTTGGGCTCAGGAATGTCCACCTTCCATTTATTTTACACTAAACCCAAGAAAGTAATTAAGTTCTCCCATCATACTTATTTCGATCTCATCACTCATTATTTTAAAAATTCATCACATACGGTTTTCTTTGAGGATCCAAAAAAGATGTCATCTATATAAATCTAAACAATGAGTATTTCATCTCCTACCTTTTTTAAGAAGAGGGTGGTGTCCATACTATCCTTAACAAAGCCTCTATCTAGCAGGAATGT GATTCACTTAGCAAATTAAACTTGTTCTCCCCTAGACCACATTTGTCCAACTTATGGTCCGTTCAAACAACATCAACACCAGTCGAAACAATTGGCACAGCTTCAGCTAACACCGGGTTAGAGTCATCACTCTTATTGCTATAAGGAGGAGGACCATTAGATTCCAAAATACTGCTAGGATGAGCTTCCTCAATAATCCTAGCAATGTCATGTTTTTGATTCACCTTACGATCCTTATCTATAAAAGAAGT ATGCGGCGGGGATGCCTTATTGCTATCCGAGGATGGAGTGAGTCAATAAAAGATTGATGTAGGAGAGCCACGAAAGGAGAAGAATATTGCACTAAAGGTGTAGGAGTCAAAGAATGATCAATCTGCACCTGAGGATAAGGATG

MgCl2, 200 AM of each dNTP, 2 U of Taq DNA polymerase (Shenergy, Shanghai, China) and 1 AM DIG-primer (5V-DIG-AGGCAACTGTGCTATCCGAGGGAA-3V) (ShengYou). The PCR program includes 75 8C for 5 min, 94 8C for 2 min, 32 cycles of 94 8C for 30 s, 66 8C for 45 s, 72 8C for 1.5 min and final 72 8C for 5 min. The DIG-labeled PCR products were analyzed by gel electrophoresis in 1.0% agarose and stored at 4 8C. 2.4. Fabrication of a DNA array with multiple species-specific gDNA probes MSSP were screened as described previously [23]. Aliquots of 4 Al (0.25 Ag) of each probes was denatured by incubating with same volume of the denaturation solution (0.5 N NaOH, 1.5 M NaCl) at room temperature for 30 min. The denatured species-specific gDNA probes were spotted on a positively charged nylon membrane (Roche, Germany). Each of specific probes was printed in quadruplet format. The spotted nylon membrane was baked at 100 8C for 30 min and kept at 4 8C. 2.5. Hybridization of the DIG-labeled gDNAs to the DNA array The nylon membrane-based DNA array was prehybridized with 1DIG Easy Hyb (Roche) in hybridization oven (Robbins Scientific, USA) for 4 h at 60 8C. Aliquots of

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

117

10 Al (100 ng) of the DIG-labeled gDNA PCR product of each tested sample was denatured for 10 min at 98 8C and mixed with 1.5 ml 1DIG Easy Hyb prewarmed at 65 8C to prepare the hybridization solution. The prehybridization solution was discarded and the nylon membrane-based DNA array was incubated with hybridization solution overnight at 65 8C. After hybridization, the membrane-based DNA array was washed two times with 50 ml of 2SSC/0.1% SDS at room temperature each for 10 min and two times with 50 ml of 0.5SSC/0.1% SDS at 60 8C each for 10 min, respectively. 2.6. Detection and analysis of the hybridization results The chemiluminescent detection of the hybridized DNA arrays was performed as described by instruction of DIG-High Prime DNA Labeling and Detectiong Starter-Kit 1 (Roche, Germany). The hybridization results were analyzed by image processing software Image J (NIH, http://rsb.info.nih.gov/nih-image/index.html).

3. Results and discussion In this work, 14 typical species-specific probes for five Dendrobrium species were screened out. The probes were sequenced in both directions (Shengyou). The sequences of the 14 species-specific gDNA probes are shown in Table 1. The sequences of the probes were analyzed with MegAlign software (http://www.dnastar.com/). The homology not to be found among the MSSP allows the MSSP has advantages over the DNA probes [25,26] for species identification based on hybridization. Due to the DNA probes derived from highly conserved genes coding for rRNA, there are demerits for identifying closely related species with the DNA probes for little variation of the 16S rRNA sequence exists between them [27]. On the contrary, the MSSP are probably derived from the noncoding sequence in whole genome, which are effected by smaller genetic suppression than coding sequences for gene. Therefore, the distinct variation of the sequences benefit that the MSSP are highly specific and require nonstringent hybridization conditions, especially to hybridization temperature. The RsaI-digested gDNA fragments of the tested samples were amplified by using DIG-primer. The DIG-labeled products are shown in Fig. 1. As the restriction sequence

C

Fig. 1. The profile of DIG-labeled gDNA of tested samples in 1.0% agarose gel. Lane M, 100 bp DNA Ladder Plus (MBI. Fermentas); lanes 1–5, samples 1–5, respectively; lane 6, complex material; lane 7, P. chinensis Lindl.; lane C, blank control.

118

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

of RsaI is GTAC, averagely each of 256 bp (44 bp) of gDNAs has one digestion site for RsaI, and the gDNA fragments produced by RsaI should be in size from 100 to 500 bp and dominant about 250 bp. The results appeared as expected. The results also revealed that the RsaI-digested gDNA fragments of each tested sample were effectively labeled by DIG-primer. In view of the MSSP in size from 83 to 453 bp, several different hybridization temperatures (45, 55, 60, 65 and 70 8C) were evaluated to determine the optimal hybridization temperature. We found that the cross-hybridizations were effectually eliminated at 65 8C and the most satisfactory hybridization signals were observed at this temperature. The species-specific probes selected from the intergenic spacer region (IGS) [28] and from 16–23S rDNA intergenic spacer region [29] were restricted in size due to the high level of conservation in the IGS region and 16–23S rDNA intergenic spacer region. In contrast, the MSSP were not restricted in size due to the bulky molecular markers in whole genome, which dictated use of high hybridization temperature to improve hybridization specificity in virtue of long sequences of MSSP. In our experience, while other hybridization conditions would probably work well, the hybridization temperature is the crucial factor to affect the experimental results. We then tested if MSSP could be used for accurate species identification. The DIGlabeled PCR products of each commercial sample (Herba Dendrobii) were hybridized to the DNA array with MSSP. The location of the MSSP on the DNA array is shown in Fig. 2. dBT on the array is blank controls (no DNA). The hybridization and chemiluminescent detection results are shown in Fig. 3, in which A, C, E, G and I are the results of hybridization of DNA array with samples 1–5, respectively. We used image processing software of Image J (NIH, http://rsb.info.nih.gov/nih-image/index.html) to analyze the images and obtained the average signal intensities of quadruplet spots of one probe are shown in Fig. 3B, D, F, H and J. It is clear that the multiple specific probes of one species only hybridized specifically to genomic DNA of the species that they represent but not to the genomic DNA of the other species. Each of these specific probes is capable of detecting its target sample perfectly. From Fig. 3, we determined that the sample 1 to 5 should belong to the species of D. aurantiacum Kerr, D. chrysotoxum Lindl., D. fimbriatum HooK., D. officinale Kimura et Migo and D. nobile Lindl., respectively. This identification result was confirmed by the sample provider. Fig. 3 shows that it is feasible to identify and discriminate closely related Dendrobium species by MSSP hybridization.

Fig. 2. The locations of the species-specific probes on DNA array. Each probe was spotted in quadruplet format. dBT is blank control with no DNA.

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

119

Fig. 3. The membrane-based DNA arrays bearing 14 species-specific probes hybridized with DIG-labeled gDNAs of commercial Dendrobium samples (Herba Dendrobii). Images A, C, E, G and I are the results of DNA array hybridized with samples 1–5, respectively. The signal intensities of different probes were analyzed by using Image J (NIH). Images B, D, F, H and J are the signal intensity of different probes on the arrays of images A, C, E, G and I, respectively.

120

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

Therefore, we can conclude that MSSP is reliable for exact identification of commercial traditional Chinese medicine. The above identification experiments demonstrate that it is feasible to identify Dendrobium species with MSSP. We further validated the specificity and reliability of MSSP by testing the complex commercial samples and adulterant of Herba Dendrobii in hybridization experiments. The hybridization and chemiluminescent detection results are shown in Fig. 4A. Fig. 4B is the signal intensities of different specific probes of Fig. 4A analyzed by Image J. As can be seen from Fig. 4B, the signal intensities of two specific probes (N1 and N2) for D. nobile Lindl. and four specific probes (O1, O2, O3 and O4) for D. officinale Kimura et Migo are greatly significant. From these results, the specific probes could detect their target sample from the complex material correctly, emphasizing the sensitivity of MSSP. Additionally, the validation of MSSP was extended to the gDNA of P. chinensis Lindl. sample, the common adulterant of Herba Dendrobii. No hybridization was detected against the gDNA of P. chinensis Lindl. (Fig. 5), suggesting that the screened specific probes could be unique to genus Dendrobium. In species identification, we used the different amount of species-specific probes to identify one species. As can be seen from Figs. 3 and 4, the different probes standing for one species could always give the hybridization signals for their target species in accordance. No matter how many specific probes for one species were used, we did not found the phenomena that one probe gave the hybridization signal, while the others did not. Therefore, we confirmed that MSSP are associated with gDNA polymorphism in those closely related species. It is very useful for typing species within a genus. We presumed that these species-specific DNA probes most probably come from the noncoding sequence in genome. The further studies should be carried out. In contrast, the use of MSSP screened from the whole genome for species identification has advantages over other commonly used techniques, such as RAPD [16,17] and ITS-

Fig. 4. DIG-labeled DNAs of complex sample hybridized to the DNA array. The image A is the result of DIGlabeled DNAs of complex sample hybridized to the DNA array. The software Image J (NIH) was used to analyze the image A. The image B is the signal intensities of different species-specific probes of the image A. The signal intensities of two D. nobile Lindl.-specific probes (N1 and N2) and four D. officinale Kimura et Migo-specific probes (O1, O2, O3 and O4) are greatly significant. They detected their target species from complex sample correctly.

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

121

Fig. 5. The DIG-labeled DNAs of P. chinensis Lindl. sample which the most common adulterant of Herba Dendrobii hybridized to the DNA array. No signal was detected.

PCR-RFLP [19]. The different reference species were used in ITS 16-23S PCR showing a low number of fragments generated and were sometimes too close to each other to allow this technique to be reliably used routinely. RAPD as an identification tool [30] seems to be the low stringency of the reaction. However, the sufficient variability of MSSP sequences enables MSSP allowing identification between closely related species. In addition, comparison of the sequences with GenBank databases revealed no significant homologies. Compared with a single probe [31,32], MSSP allows the accurate identification for eliminating the false results of identification caused by unstable experimental conditions or other random factors. We focus on setting up a technique for the accurate identification of closely related species, MSSP hybridization just provides the most promising way at this point. The ability of MSSP to distinguish closely related species of the Dendrobium genus and even unrelated P. chinensis Lindl. demonstrates that MSSP is very specific and accurate of Dendrobium species. The MSSP presents another interesting characteristic: there are a large number of polymorphic sequence fragments existing in genomic DNA of higher eukaryotes, especially in the noncoding sequence. We hope to further adapt the technique to the identification of pathogenic prokaryotes, viruses and other higher eukaryotes. This is currently under evaluation in our laboratory, in combination with the discovery and validation of new specific probes for identification of other useful species. In addition, this technique is feasible to be carried out in any laboratory and easy to set up. Furthermore, if we find enough specific probes from more species of some genus, and fabricate a DNA microarray with more multiple species-specific probes, it has potential in efficient species identification including pathogenic prokaryotes, eukaryotes and in diagnostic, taxonomic, epidemiological, medical research areas.

122

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

Acknowledgements This work was supported by Project 30371750 and 60121101 of National Natural Science Foundation of China, and also the grants 2001AA2Z2012 and 2002AA2Z2041 from National High Tech Program and Project.

References [1] Jiangsu New Medical College. Dictionary of Chinese medicines. Shanghai7 Shanghai Scientic and Technologic Press; 1986. [2] Ye QH, Zhao WM. New alloaromadendrane, cadinene and cyclocopacamphane type sesquiterpene derivatives and bibenzyle from Dendrobium nobile. Planta Med 2002;68:723 – 9. [3] Chinese Pharmacopoeia Editorial Committee. Chinese pharmacopoeia, 2000 edn, vol. 1. Beijing7 Chemical Technology Press; 2000. [4] Li MF, Xu GJ, Xu LS, Jin RL. Survey and identification of Herba Dendrobii (I). Chin Tradit Herb Drugs 1986;17:465 – 8. [5] Li MF, Xu GJ, Xu LS, Jin RL. Survey and identification of Herba Dendrobii (II). Chin Tradit Herb Drugs 1991;22:173 – 6. [6] Ma GX, Xu GJ, Xu LS, Li MF. Survey and identification of Herba Dendrobii (III). Chin Tradit Herb Drugs 1995;26:370 – 2. [7] Ding XY, Xu LS, Wang ZT, Zhou KY, Xu H, Wang YQ. Authentication of stems of Dendrobium officinale by rDNA ITS region sequence. Planta Med 2002;68:191 – 2. [8] Lau DT, Shaw PC, Wang J, But PP. Authentication of medicinal Dendrobium species by the internal transcribed spacer of ribosomal DNA. Planta Med 2001;67:456 – 60. [9] Carlsward BS, Stern WL, Judd WS, Lucansky TW. Comparative leaf anatomy and systematics in Dendrobium, sections Aporum and Rhizobium (Orchidaceae). Int J Plant Sci 1997;158:332. [10] Stern WL, Morris MW, Judd WS. Anatomy of the thick leaves in Dendrobium section Rhizobium (Orchidaceae). Int J Plant Sci 1994;155:716 – 29. [11] Namba T, Lin CC. Pharmacognostical studies on the crude drugs of Orchidaceae from Taiwan (IV) on bChioh-hakQ. Shoyakugaku Zasshi 1981;35:221 – 32. [12] Namba T, Lin CC. Pharmacognostical studies on the crude drugs of Orchidaceae from Taiwan (V) on bChioh-hakQ. Shoyakugaku Zasshi 1981;35:233 – 50. [13] Anonymous. Chinese materia medica (Zhong Yao Zhi). Beijing7 People’s Health Publishing House; 1988. [14] Salloum G, Meugnier H, Reyrolle M, Grimont F, Grimont PAD, Etienne J, et al. Identification of Legionella species by ribotyping and other molecular methods. Res Microbiol 2002;153:679 – 86. [15] Regnault B, Grimont F, Grimont PAD. Universal ribotyping method using a chemically labeled oligonucleotide probe mixture. Res Microbiol 1997;148:649 – 59. [16] Bansal NS, McDonell F. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis. J Clin Microbiol 1997;35(9):2310 – 4. [17] LoPresti F, Riffard S, Vandenesch F, Etienne J. Identification of Legionella species by random amplified polymorphic DNA profiles. J Clin Microbiol 1998;36:3193 – 7. [18] Tannock GW, Tilsala-Timisjarvi A, Rodtong S, Ng J, Munro K, Alatossava T. Identification of Lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16S-23S rRNA gene intergenic spacer region sequence comparison. Appl Environ Microbiol 1999;65:4264 – 76. [19] Amelio SD, Mathiopoulos KD, Santos CP, Pugachev ON, Webb SC, Picanco M, et al. Genetic markers in ribosomal DNA for the identification of members of the genus Anisakis (Nematoda: Ascaridoidea) defined by polymerase chain reaction-based restriction fragment length polymorphism. Int J Parasitol 2000;30:223 – 6. [20] Song YL, Kato N, Liu CX, Matsumiya Y, Kato H, Watanabe K. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group and species-specific primers derived

T. Li et al. / J. Biochem. Biophys. Methods 62 (2005) 111–123

[21] [22] [23] [24] [25]

[26] [27] [28]

[29]

[30] [31] [32]

123

from the 16S–23S rRNA intergenic spacer region and its flanking 23S rRNA. FEMS Microbiol Lett 2000; 187:167 – 73. Ratcliff RM, Lanser JA, Manning PA, Heuzenroeder MW. Sequence-based classification scheme for the genus Legionella targeting the mip gene. J Clin Microbiol 1998;36:1560 – 7. Douzery EJP, Pridgeon AM, Kores P, Linder HP, Kurzweu H, Chase MW. Molecular phylogenetics of disease (Orchidaceae): a contribution from nuclear ribosomal ITS sequences. Am J Bot 1999;86:887 – 99. Li TX, Wang JK, Bai YF, Sun XD, Lu ZH. A novel method for screening species-specific gDNA probes for species identification. Nucleic Acids Res 2004;32(4):e45. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al. Shorter protocols in molecular biology. 3rd ed. John Wiley & Sons; 1995. Johansson ML, Molin G, Pettersson BU, Uhoen M, Ahrne S. Charactersation and species recongnization of Lactobacillus planttarum strains by restriction fragment length polymorphism (RFLP) of the 16S rRNA gene. J Appl Bacteriol 1995;79:536 – 41. Rodrigues UM, Aguirre M, Facklam RR, Conllins MD. Specific and intraspecific molecular typing of lactococci based on polymorphism of DNA encoding rRNA. J Appl Bacteriol 1991;71:509 – 16. Schleifer KH, Ehrmann M, Beimfohr C, Brockmann E, Ludwig W, Amann R. Application of molecular methods for the classification and identification of lactic acid bacteria. Int Dairy J 1995;5:1081 – 94. Hodgkinson JE, Love S, Lichtenfels JR, Palfreman S, Ramsey YH, Matthews JB. Evaluation of the specificity of five oligoprobes for identification of cyathostomin species from horses. Int J Parasitol 2001; 31:197 – 204. Lagatolla C, Lavenia A, Tonin E, Monti-Bragadin C, Dolzani L. Characterization of oligonucleotide probes for the identification of Acinetobacter spp., Abaumannii and Acinetobacter genomic species 3. Res Microbiol 1998;149:557 – 66. LoPresti F, Riffard S, Vandenesch F, Etienne J. Identification of Legionella species by random amplified polymorphic DNA profiles. J Clin Microbiol 1998;36:3193 – 7. Picardeau M, Vincent V. Development of a species-specific probe for Mycobacterium xenopi. Res Microbiol 1995;146:237 – 43. Giffel MC, Beumer RR, Lijn NK, Wagendorp AF, Rombouts M. Discrimination between Bacillus cereus and Bacillus thuringiensis using specific DNA probes based on variable regions of 16S rRNA. FEMS Microbiol Lett 1997;146:47 – 51.