Activation of cAMP-Dependent Protein Kinase Is Required for Optimal α-Melanocyte-Stimulating Hormone-Induced Pigmentation

EXPERIMENTAL CELL RESEARCH ARTICLE NO.

244, 117–124 (1998)

EX984086

Activation of cAMP-Dependent Protein Kinase Is Required for Optimal a-Melanocyte-Stimulating Hormone-Induced Pigmentation Yi Ao, Hee-Young Park,1 Sylvia Olaizola-Horn, and Barbara A. Gilchrest Department of Dermatology, Boston University School of Medicine, 80 East Concord Street, Boston, Massachusetts 02118

INTRODUCTION The cAMP-dependent pathway has been long presumed to play a critical role in mediating a-melanocyte-stimulating hormone (a-MSH)-induced pigmentation, but it has never been demonstrated that this pathway is obligatory. In order to determine whether the cAMP-dependent pathway is required for a a-MSH-induced pigmentation, we inhibited the activity of cAMP-dependent protein kinase (PKA), the main kinase mediating in this pathway, by introducing a physiologic cAMP-dependent protein kinase inhibitor (PKI) into S91 murine melanoma cells and then measuring pigment response after a-MSH stimulation. Cells were stably transfected either with the pMXX-PKI expression vector that encodes the active part of PKI (the amino terminal 1–31 amino acids) under a metallothionein-inducible promoter and the pSV2-Neo expression vector alone. As expected, treatment of transfected cells with 1 mM CdCl2 for 24 h induced the expression of PKI mRNA in cells transfected with both vectors, but not in cells transfected with the pSV2-Neo expression vector alone. Subsequent treatment of these transfected cells with a-MSH for 5– 6 days in the continual presence of 1 mM CdCl2 resulted in inhibition of PKA activity by 30 – 40% in cells expressing PKI. Parallel measurements revealed that a-MSH-increased melanin content five- to six-fold in control cells transfected with pSV2-Neo alone, while there was only a two-fold increase in PKI-expressing cells, a 40 –50% inhibition in a-MSH-induced total melanin content. a-MSH-induced tyrosinase activity and tyrosinase mRNA and protein levels measured in parallel were also inhibited by 40 –50% in PKI-expressing cells compared to control cells transfected with pSV2-Neo alone. Together, these results demonstrate for the first time that activation of PKA through the cAMPdependent pathway is required for optimal a-MSHinduced pigmentation. © 1998 Academic Press

1 To whom the correspondence and reprint requests should be addressed at Department of Dermatology, J205, Boston University School of Medicine, 80 East Concord Street, Boston, MA 02118. Fax: (617) 638-5515. E-mail: [email protected].

Skin pigmentation, the consequence of production and dispersion of melanin in the epidermis, is the main physiological defense against sun-related injuries, including photocarcinogenesis. Melanin pigment is synthesized in epidermal melanocytes within a subcellular organelle, the melanosome [1], in which the precursor amino acid tyrosine is sequentially oxidized into L-dihydroxyphenylalanine and dopaquinone by the enzyme tyrosinase (EC 1.14.18.1), the key and ratelimiting enzyme in melanin biosynthesis [2] that was initially identified in pigment cells in the 1940s [3]. To date little is known about the intracellular pathways regulating melanogenesis generally and tyrosinase activity specifically. Attention has focused particularly on a-melanocyte-stimulating hormone (a-MSH), known for decades to be a major physiologic stimulus for murine pigmentation [4, 5] and more recently shown to affect melanogenesis in human melanocytes [6, 7] confirming decades-old clinical observations [8, 9]. Early studies using murine melanoma cells suggested that the cAMP-dependent pathway plays a critical role [10 –15] in a-MSH-induced pigmentation. This peptide is known to act at least in part through cAMP [4, 5] and treatment with other agents known to increase the intracellular cAMP level, such as dibutyryl cAMP and isobutylmethylxanthine, was also associated with increased pigmentation in murine melanoma cells [14 –16] Subsequent studies revealed that these increases in pigmentation resulted mainly from increasing tyrosinase protein and mRNA levels [17, 18], ultimately increasing tyrosinase activity [19]. Despite the strong associations between increased cAMP levels and increased melanogenesis, however, a causal relationship was never established. The cAMP-dependent pathway is one of the major intracellular signal transduction pathways. It is well established that this pathway is activated by binding of ligands to their cognate receptors on the cell surface. Binding of a-MSH, for example, to the recently cloned melanocortin-1 receptor [20, 21] activates adenylate cyclase [22–24], leading to an elevation of the intracellular cAMP level [11, 16]. cAMP-dependent

117

0014-4827/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.

118

AO ET AL.

protein kinase (PKA), shown to mediate most if not all the biological actions of cAMP [25], is a serine/ threonine kinase that exists as an inactive tetramer consisting of two regulatory subunits and two catalytic subunits. It is activated by binding of cAMP to its regulatory subunits and thus releasing its catalytic subunits from the regulatory subunits. The activity of PKA can be inhibited by cAMP-dependent protein kinase inhibitor (PKI), a 75 amino acid protein, first isolated from rabbit skeleton muscle [26]. PKI is a highly specific physiological inhibitor that inactivates PKA by acting as a pseudo-substrate for the catalytic subunits, binding the kinase within its amino terminal 31 amino acids [27]. Recently, our laboratory has shown that protein kinase C-b (PKC-b) activates tyrosinase in human melanocytes [28]. Moreover, depletion of PKC in S91 cells by chronic treatment with phorbol esters completely blocks induction of pigmentation by a-MSH, dibutyryl cAMP, or isobutylmethylxanthine [29]. Increases in tyrosinase activity, protein, and mRNA otherwise induced by a-MSH in S91 cells are also completely blocked by depletion of PKC, but increases in intracellular cAMP are unaffected [29]. Furthermore, although increases in intracellular cAMP levels are transient, continual presence of a-MSH for 3– 4 days is required to maximally induce pigmentation [29]. These results raise a question whether the cAMP plays a role at all in mediating a-MSH-induced pigmentation. In this paper, we demonstrate for the first time an obligatory role for the cAMP-dependent pathway in mediating a-MSH-induced pigmentation. METHODS Tissue culture. Cloudman S91 mouse melanoma cells (S91 cells) purchased from American Type Culture Collection (ATCC) were maintained in Dulbecco’s modified Eagle’s medium (DME) (Gibco BRL Life Technologies, Inc.) supplemented with 10% bovine calf serum (CS) (Hyclone Laboratories, Inc.). In each experiment, S91 cells were plated at 5– 8 3 105 cells per 100-mm dish and treated with 1027 M a-MSH (Sigma Chemical Co.) or vehicle 24 h after plating. S91 cells transfected with either pMXX-PKI plus pSV2-Neo (S91-PKI) or pSV2-Neo alone (S91-control) were maintained in DME supplemented with 10% CS containing 500 mg/ml geneticin (G418) (Gibco BRL Life Technologies, Inc.). Construction of pMXX-PKI expression vectors. To inhibit the activity of PKA in S91 cells, an expression vector encoding the active part of PKI was constructed. PKI cDNA was subcloned into the pMXX expression vector which contains a mouse metallothioneininducible promoter (obtained from Dr. L. Ercolani) [30]. PKI cDNA encoding for the active part of PKI (the first 31 amino acids from the N-terminus) was initially generated by polymerase chain reaction (PCR). As a template, pLXX-PKI expression vector (obtained from Dr. J. Russell Grove), shown to express functional PKI [31] was used. Primer sequences were primer 1 of 59GGGGGGAATTCGGGATCCCACCATGACAGAC39 and primer 2 of 59AAAGATCCTCTAGAGAATTC 39. An EcoRI restriction site was added to the 59 end of the PCR fragment and the amplified cDNA fragment was subcloned into the EcoRI restriction site of the pMXX vector, generating pMXX-

FIG. 1. Subcloning of PKI cDNA into the pMXX expression vector. PKI cDNA encoding the active part of PKI was subcloned into the pMXX expression vector at the EcoRI site. Final subcloned product pMXX-PKI was transformed into JM109 competent cells and DNA from six colonies was purified. Digestion with restriction enzyme EcoRI generated the PKI insert (119 bp) and pMXX vector backbone (4.9 kb). pMXX-PKI DNA from each colony was sequenced to identify the orientation, sense or antisense, as well as to confirm the sequence of the PKI insert.

PKI (;5.0 kb) (Fig. 1). The orientation and sequence of the subcloned PKI cDNA fragment were confirmed by DNA sequencing. Transfections. Stable transfections of pMXX-PKI into S91 cells were performed as previously described. Paired cultures of S91 cells were plated at ;0.8 3 106 cells per 60-mm dish. Sixteen to 24 h after plating, each plate was exposed to either 10 mg of pMXX-PKI plus 1 mg of pSV2-Neo (;5.0 kb) or 10 mg of pSV2-Neo alone in serum-free DME for 6 h. Prior to addition to the cells, both pMXX-PKI and pSV2-Neo vectors were treated with Lipofectin reagent (Gibco BRL Life Technologies, Inc.) with the ratio of 1:1 (10 mg Lipofectin:10 mg DNA) to enhance the delivery of DNA into the cells. At the end of incubation, medium containing DNA was removed and replaced with fresh DME supplemented with 10% CS. The transfected cells were selected using G418 (500 mg/ml DME). Each cell colony formed from individual cell resistant to G418 was picked and expanded separately. Northern blot analysis. Total RNA was isolated from S91 cells by TRIzol reagent (Gibco BRL Life Technologies, Inc.) according to the procedure recommended by the manufacturer [32]. In brief, cells were lysed by adding 1 ml of TRIzol reagent per 60-mm dish. RNA was separated by adding chloroform to the cell lysate (0.2 ml chloroform/1 ml TRIzol reagent) and then spinning the mixture at 12,000g for 15 min at 4°C. The aqueous phase was removed into a fresh tube and incubated with isopropyl alcohol (0.5 ml/1 m. TRIzol reagent) for 10 min at room temperature to precipitate RNA. RNA was then pelleted by spinning at 12,000g for 10 min at 4°C. Then the RNA pellet was briefly washed with 75% ethanol, air-dried, and dissolved in RNase-free H2O. Routinely, 20 –30 mg of total RNA per lane was size-fractionated through a 1% agarose-gel-containing 6% formaldehyde. Then RNA was transferred to a Hybond-N nylon membrane (Amersham) and immobilized by a short ultraviolet light illumination (80 s). The membrane was prehybridized in prehybridization solution (53 Denhardts, 50% deionized formamide, 50 mM Tris (pH 7.5), 0.8 M NaCl, 0.1% PPi, 10% dextran sulfate, 75 mg/ml salmon sperm DNA, and 0.1% SDS) at 45°C for 18 –24 h and then hybridized with radiolabeled specific cDNA probes (1–2 3 106 cpm/ml prehybridization solution) by directly adding the probe into the prehybridization mixture. This was then incubated for 24 h at 45°C. Then the membrane was washed twice in 23 SCC at 65°C for

a-MSH-INDUCED PIGMENTATION 30 min as previously described by Park and Campisi [33]. The membrane was then exposed to Kodak X-Omat film at 270°C for approximately 2– 4 days. Each band on the autoradiogram was quantitated using a densitometer. To assess equal loading of total RNA in each lane, the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was determined. Probes. The cDNA probe specific for PKI was generated by either PCR or purifying PKI cDNA from pMXX-PKI by EcoRI restriction digestion. The specific probe for GAPDH was generated by PCR using plasmid pHcGAP (ATCC) as a template and primers of 59GCCAAAAGGGTCATCATCTC 39 and 59ACACGGAAGGCCATGCCAGT39 [29]. A specific cDNA probe for tyrosinase was generated by restriction digestion of mouse tyrosinase plasmid MTY811C (ATCC) with EcoRI and HindIII. For Northern blot analysis, cDNA probes were radiolabeled with [a-32P]dCTP (3000 Ci/mmol, New England Nuclear), using a commercially available oligolabeling kit (Pharmacia LKB Biotechnology). cAMP-dependent protein kinase activity. The activity of PKA was measured as previously described [33]. Cells were briefly sonicated in lysis buffer (50 mM PO54 (pH 6.8), 5 mg/ml aprotinin, and 500 mM phenylmethylsulfornyl fluoride) and the lysate was clarified by spinning at 12,000g for 15 min at 4°C. The supernatant was used to assay PKA activity. Five to 6 mg of cell lysate was reacted in the reaction mixture of 10 mM MgCl2, 40 mM ATP, 10 mM cAMP, 100 mM isobutylmethylxanthine (Sigma Chemical Co.), 50 mg histone (Sigma Chemical Co.), and 2 mCi [g-32P]ATP (10 –50 Ci/mmol, New England Nuclear) for 10 min at 37°C. To determine the nonspecific background kinase activity, purified PKI inhibitor (Sigma Chemical Co.) (10 mg/reaction) was added to parallel tubes. The reaction was stopped by spotting the entire reaction mixture onto P81-phosphocellulose filters (Whatman Inc.). The filters were then washed extensively in 0.2% phosphoric acid and counted as Cerenkov. The activity of PKA was expressed as cpm of incorporated radioactivity per microgram of protein per minute minus the background. Protein kinase C activity. Cell lysate, containing both cytosolicand membrane-associated PKC, was prepared according to Park and Campisi [33]. In brief, cells were scraped in lysis buffer (13 DEAE buffer, 1% Triton X-100, 5 mM dithiothreitol, 10 mg/ml aprotinin, 1 mM phenylmethylsulfornyl fluoride), and the lysate was clarified by spinning at 100,000g for 60 min at 4°C. Fifty microliters of supernatant containing 2–5 mg of protein was incubated with reaction mixture of 10 mM MgCl2, 1 mM CaCl2, 100 mM ATP, 0.32 mg/ml phosphatidylserine (Sigma Chemical Co.), 0.8 mM phorbol 12,13dibutyrate (Sigma Chemical Co.), 800 mg/ml histone, and 2 mCi [g-32P]ATP (10 –50 Ci/mmol, New England Nuclear) for 10 min at 37°C. The reaction was stopped by spotting the reaction mixture on P81-phosphocellulose filters. The filters were washed in 0.2% phosphoric acid and counted as Cerenkov. Nonspecific kinase activity (background) was determined in parallel reaction tubes in the absence of phosphatidylserine and phorbol 12,13-dibutyrate. The final PKC activity was expressed as cpm of incorporated radioactivity per microgram of protein per minute in the presence of phosphatidylserine and phorbol 12,13-dibutyrate minus the background. Melanin content. Two to 5 3 105 cells were used to measure the level of melanin content. S91 cells were washed twice with phosphate-buffered saline and trypsinized, and cells were pelleted by spinning at 2,500 rpm for 5 min. The cell pellet was dissolved in 1 N NaOH 1 ml/2–5 3 105 cells). Melanin was detected at OD475 by spectrophotometer and calculated according to a standard curve of synthetic melanin (Sigma Chemical Co.) (1 to 40 mg), as previously described [34]. Tyrosinase activity. Tyrosinase activity was measured according to Pomerantz et al. [35]. Cells were scraped in 80 mM phosphate buffer (pH 6.8) containing 1% Triton X-100 and briefly sonicated and tyrosinase was extracted for 2 h at 4°C. Then the cell lysate was clarified by spinning at 12,000g for 15 min at 4°C and the superna-

119

tant was used. Twenty micrograms of cell lysate was incubated with reaction mixture containing 2.3 mM L-tyrosine, 23 mM L-dihydroxyphenylalanine, 5 mCi L-[3,5- 3H]tyrosine (59.7 Ci/mmol, New England Nuclear), and 80 mM phosphate buffer (pH 6.8) at 37°C for 1–2 h. The reaction was stopped by adding 250 ml of 0.2% BSA and 500 ml of cold 10% TCA. TCA-precipitable proteins were pelleted by spinning the mixture at 12,000g for 15 min at 4°C. The supernatant was reacted with activated charcoal (Sigma Chemical Co.) (50 mg/ ml) to remove nonincorporated [3H]tyrosine. Then the remaining total radioactivity was counted using a liquid scintillation counter. Background activity was determined by using cell lysate which was boiled for 30 min at 100°C. Background activity was usually approximately 20 –25% of the total activity. The activity of tyrosinase was expressed as cpm of radioactivity released per microgram of protein per hour minus the nonspecific incorporation of radioactivity (background). Immunoblot analysis. Tyrosinase protein level was determined by immunoblot analysis as described by Jimenez et al. [36]. Lysates from S91 cells were enriched for tyrosinase by briefly sonicating cells in 80 mM phosphate buffer (pH 6.8) containing 1% Triton X-100 and extracting for 4 h at 4°C. Then the cell lysate was clarified by spinning at 12,000g for 15 min at 4°C and the supernatant was used. Eighty to 100 mg of total protein was separated on 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis as described by Laemmli [37] and electrophoretically transferred to a nitrocellulose membrane (Micron Separation Inc.) at room temperature. Then the membrane was preincubated with 5% milk in PBS for 1 h at room temperature with shaking, followed by incubation with PEP-7 (1–2 mg/ml in 1% milk), a polyclonal antibody against tyrosinase (Obtained from Dr. V. J. Hearing), at 4°C overnight. At the end of the incubation, the membrane was washed extensively with phosphatebuffered saline containing 0.5% Tween 20, and then 125I-protein A (70 –100 mCi/mg, New England Nuclear) (2–5 3 105 cpm/ml in 5% bovine serum albumin) was added to the membrane for 1 h at room temperature. The membrane was washed extensively in PBS containing 0.5% Tween 20, dried, and exposed to Kodak X-Omat film at 270°C for 3–7 days. The bands on the autoradiogram were quantitated using a densitometer. Equal loading of each lane was verified by staining the lower part of the membrane (cut after transfer) with 1% Amido black (Sigma Chemical Co.).

RESULTS

Generation of S91 cells expressing PKI. To determine if the cAMP-dependent pathway is required for a-MSH-induced pigmentation in S91 cells, the activity of PKA was inhibited by transfecting S91 cells with the pMXX-PKI metallothionein-inducible expression vector encoding PKI. S91 cells were first cotransfected with pMXX-PKI and pSV2-Neo expression vectors and then exposed to the antibiotic G418 (500 mg/ml). Individual cells resistant to G418 were allowed to grow and then each resulting colony was picked and expanded separately. Because stable transfections required multiple passages of the cells, a condition which may cause the transfected S91 cells to gradually lose their basal pigmentation and their responsiveness to a-MSH [38], both S91-PKI and S91-control cells were transfected and passaged similarly, allowing a similar number of passages or population doublings in both groups. In addition, the basal pigment level in S91-PKI and S91control cells was measured in each experiment and found to be comparable (7– 8 pg/cell). Therefore, any

120

AO ET AL.

FIG. 2. Induction of PKI mRNA expression after treatment of S91-PKI or S91-control cells with 1 mM CdCl2. Paired cultures of S91-PKI and S91-control cells were treated with 1 mM CdCl2 for 24 h. Total RNA was isolated and the level of PKI mRNA was determined by Northern blot analysis. PKI mRNA of ;1.4 kb [30] was easily detected in S91-PKI cells, while it was undetectable in S91-control cells.

differences observed in a-MSH-induced pigmentation between S91-PKI and S91-control cells would not be due to the differences in their basal melanogenic activity. The inducible level of PKI mRNA expression after treating the cell with 1 mM CdCl2 was determined in each colony and the colony with the highest inducible level of PKI mRNA expression compatible with normal cell morphology and continued growth was used for all the experiments (Fig. 2). The transfected S91 cells expressing PKI mRNA are termed S91-PKI cells. S91 cells transfected with only the pSV2-Neo expression vector (S91-control cells) have undetecteable PKI mRNA levels, like nontranfected parental S91 cells. S91-PKI cells were treated with the maximal tolerated concentration of CdCl2 (1 mM) to induce the expression of PKI. However, 1 mM CdCl2 reduced growth rate in cells treated for 5– 6 days; therefore, both S91-

PKI and S91-control cells were treated with 1 mM CdCl2 to eliminate the possibility that inhibition of a-MSH-induced pigmentation in S91-PKI cells by 1 mM CdCl2 treatment is secondary to its nonspecific effects of metal ions on cells. When paired cultures of S91control and S91-PKI cells were treated with 1 mM CdCl2 for 24 h, followed by introduction of 1027 M a-MSH or vehicle for 6 days in the continuous presence of 1 mM CdCl2, the resulting yields for S91-control and S91-PKI cells after 7 days were similar (Fig. 3A). In contrast, parallel measurement of melanin content revealed that treatment with 1 mM CdCl2 selectively inhibits a-MSH-induced melanin in S91-PKI cells compared to S91-control cells (Fig. 3B). Expression of PKI specifically inhibits PKA activity. To determine whether expression of PKI inhibits PKA activity, paired cultures of S91-PKI and S91control cells were treated with 1 mM CdCl2 for 6 days and total PKA activity was then measured. In parallel, the activity of PKC, a second kinase shown to be required for a-MSH-induced pigmentation [29], was also measured to rule out the possibility that the effect on pigmentation of PKI expression is due to nonspecific inhibition of PKC activity by PKI. Expression of PKI in S91-PKI cells inhibited total PKA activity by 30 – 40% when compared to the parallel S91-control cells (372.1 6 67.1 and 635.4 6 73.8 cpm/mg/min, respectively), demonstrating that expressed PKI is functional (Fig. 4A) and consistent with degrees of inhibition previously observed in PKI transfected cells [39]. PKC activity was not affected by expressing PKI in S91-PKI cells when compared to S91-control cells (486.7 6 69.8 vs 502.3 6 19.2 cpm/mg/minute, respectively) (Fig. 4B), confirming previous reports that PKI is a specific inhibitor of PKA. [26].

FIG. 3. Effects of 1 mM CdCl2 on total cell number and a-MSH-induced pigmentation in S91-control and S91-PKI cells. Paired cultures of S91-control and S91-PKI cells were treated with 1 mM CdCl2 for 24 h and then treated with either vehicle or 1027 M a-MSH for 6 days in the continuous presence of CdCl2. At the end of treatment, (A) total cell number and (B) total melanin content were then determined. Total melanin content was lower in a-MSH-treated S91-PKI cells then in controls (P , 0.05, Student’s paired t test). Results from one representative of three independent experiments are presented.

a-MSH-INDUCED PIGMENTATION

121

FIG. 4. Expression of PKI specifically inhibits PKA activity in S91-PKI cells. Paired cultures of S91-PKI and S91-control cells were treated with 1 mM CdCl2 for 6 days. At the end of treatment, for each condition (A) total PKA activity was measured using 5– 6 mg of cell lysate protein and (B) PKC activity was measured in parallel using 2–5 mg of cell lysate protein. PKA activity was less in S91-PKI cells than in controls (P , 0.01, Student’s paired t test). Results from one representative of five independent experiments are presented.

Inhibition of PKA activity by PKI reduces a-MSHinduced melanin content and tyrosinase activity. To investigate if inhibition of PKA activity by PKI influences a-MSH-induced pigmentation, paired cultures of S91-PKI and S91-control cells were first treated with 1 mM CdCl2 for 24 h and then treated with either 1027 M a-MSH or vehicle in the continuous presence of 1 mM CdCl2 for 5– 6 days. At the end of a-MSH treatment, total melanin content and tyrosinase activity, as well as total PKA activity, were measured. Expression of PKI inhibited PKA activity by 30 – 40% as previously observed in both a-MSH- and vehicle-treated S91-PKI cells when compared to S91-control cells (Fig. 5A). a-MSH treatment did not affect PKA activity in either S91-PKI or S91-control cells (621.2 6 19.4 cpm/mg/min in vehicle-treated group vs 675.7 6 23 cpm/mg/min in a-MSH-treated group for S91-control cells and 487.4 6 3.8 cpm/mg/min in vehicle-treated group vs 453.7 6 2.7 cpm/mg/min in a-MSH-treated group for S91-PKI cells). Inhibition of PKA activity by 30 – 40% resulted in

a parallel inhibition of a-MSH-induced increases in total melanin content. In S91-control cells, a-MSH increased total melanin content by four- to five-fold, from 8.2 6 2 to 39 6 4 pg/cell (Fig. 5B), consistent with previous reports [29]. In contrast, total melanin content was increased by only two- to three-fold in a-MSHtreated S91-PKI cells, from 8 6 1 to 18 6 2 pg/cell (Fig. 5B). Tyrosinase activity, reflective of melanin synthesis rate, also showed a parallel inhibition in a-MSHtreated S91-PKI cells. Tyrosinase activity was barely detectable in either vehicle-treated S91-control and S91-PKI, as expected. After 5– 6 days, in S91-control cells, a-MSH increased tyrosinase activity to 5362.6 6 144.2 cpm/mg/h, whereas smaller increases in tyrosinase activity (3106.1 6 189.8 cpm/mg/h) were observed in a-MSH-treated S91-PKI cells (Fig. 5C). These results demonstrate that inhibition of PKA activity by PKI causes a parallel inhibition in a-MSH-induced melanin content and tyrosinase activity.

FIG. 5. Effects of PKI on a-MSH-induced melanin content and tyrosinase activity. Paired cultures of S91-control and S91-PKI cells were first treated with 1 mM CdCl2 for 24 h and then treated with either 1027 M a-MSH or vehicle alone for 5– 6 days in the continuous presence of CdCl2. Cells were then harvested and (A) PKA activity (B) total melanin content, and (C) tyrosinase activity were measured as described under Materials and Methods. Values were less for S91-PKI cells than for controls (P , 0.01, student’s paired t test). Results of one representative of four independent experiments are presented.

122

AO ET AL.

mined. Northern blot analysis showed that a-MSH increased 2.2-kb tyrosinase mRNA five-fold in S91-control cells (Fig. 7). However, in S91-PKI cells tyrosinase mRNA increased only three-fold with the a-MSH treatment, a 40% of inhibition of the a-MSH induction. Therefore, PKI proportionally inhibits a-MSH-induced tyrosinase activity and the levels of tyrosinase mRNA and protein. DISCUSSION FIG. 6. Effect of PKI on a-MSH-induced tyrosinase protein. Paired cultures of S91-PKI and S91-control cells were first treated with 1 mM CdCl2 for 24 h, and then 1027 M a-MSH or vehicle alone was introduced for 6 days in the continuous presence of CdCl2. Cells were harvested and the level of tyrosinase protein was determined by immunoblot analysis. Equal loading of protein in each lane was confirmed by staining the membrane with Amido black. The level of tyrosinase protein in the vehicle-treated group of both S91-control and S91-PKI cells was undetectable. Densitometry indicated that a-MSH-induced tyrosinase protein in S91-PKI cells was 30 – 40% less than in S91-control cells. Results of one representative of four independent experiments are presented.

a-MSH-induced tyrosinase protein is inhibited in S91-PKI cells. Our previous studies have shown that a-MSH-induced tyrosinase activity in S91 cells is associated with an increase in tyrosinase protein level [29]. To determine whether inhibition of PKA activity blocks a-MSH-induced tyrosinase protein as well, paired cultures of S91-PKI and S91-control cells were first treated with 1 mM CdCl2 for 24 h and then additionally with a-MSH or vehicle alone for 6 days in the continuous presence of 1 mM CdCl2. At day 6, total PKA activity and the level of tyrosinase protein were then measured. Expression of PKI inhibited total PKA activity by 30 – 40% in S91-PKI cells compared to S91control cells (898.2 6 81.6 cpm/mg/min in S91-control cells vs 577.8 6 9.8 cpm/mg/min in S91-PKI cells). Immunoblot analysis using the specific polyclonal antibody against mouse tyrosinase revealed a large tyrosinase protein induction by a-MSH in S91-control cells, as previously reported [29]. Inhibition of PKA activity in S91-PKI cells inhibited a-MSH-induced increases in tyrosinase protein by 30 – 40%, in parallel with the inhibition in tyrosinase activity (Fig. 6). a-MSH-induced tyrosinase mRNA is inhibited in S91-PKI cells. Because increases in tyrosinase protein induced by a-MSH are attributable in part to the increases in tyrosinase mRNA level [17, 29], the effects of PKI on a-MSH-induced tyrosinase mRNA was examined. Paired cultures of S91-PKI and S91-control cells were first treated with 1 mM CdCl2 for 24 h and then additionally with either a-MSH or vehicle alone for 6 days in the continuous presence of 1 mM CdCl2. The levels of tyrosinase and mRNA were then deter-

The cAMP-dependent pathway has been widely accepted as mediating a-MSH-induced pigmentation, but supporting evidence is circumstantial. The key support for this hypothesis comes from two separate observations: (i) one of the initial events after exposure of murine melanoma cells to a-MSH is an increased intracellular level of cAMP, and (ii) agents known to increase the intracellular level of cAMP, such as isobutylmethylxanthine and dibutyryl cAMP, are potent inducers of murine pigmentation. However, other data suggest that an increase in the intracellular level of cAMP is not sufficient to induce pigmentation. For example, we have reported that depletion of PKC in S91 cells completely blocks a-MSH or dibutyryl cAMPinduced pigmentation, while the initial increases in cAMP level remain unaffected [29]. In addition, during a-MSH-induced pigmentation in S91 cells, although

FIG. 7. Effect of PKI on a-MSH-induced tyrosinase mRNA. Paired cultures of S91-PKI and S91-control cells were first treated with 1 mM CdCl2 for 24 h and then with either 1027 M a-MSH or vehicle alone for 6 days in continuous presence of CdCl2. Tyrosinase mRNA was then measured by Northern blot analysis using 20 mg of total RNA for each condition, quantified by densitometry, and normalized against the corresponding level of GAPDH mRNA, a control for equal loading of RNA in each lane.. The relative OD units for tyrosinase mRNA was 1.0 in vehicle-treated vs 4.9 in a-MSH-treated S91-control cell cultures and 1.0 in vehicle-treated vs 3.0 in a-MSHtreated in S91-PKI cell cultures. Results from one representative of three independent experiments are presented.

a-MSH-INDUCED PIGMENTATION

the intracellular level of cAMP is rapidly induced and returns to the basal level within 2– 4 h of a-MSH treatment [11, 40], at least 4 –5 days of continual exposure to a a-MSH is required for the maximal induction in pigmentation [29]. One way to critically examine the role of cAMP and the cAMP-dependent pathway during a-MSH-induced pigmentation is to block this pathway. Because PKA is known to be the key kinase in the cAMP-dependent pathway and to mediate most of the biological responses of cAMP, we chose to inhibit of PKA activity using the physiologic inhibitor PKI. Maximally achievable PKI expression in S91 cells transfected with CdCl2-inducible PKI inhibited total PKA activity by 30 – 40% compared to control cells, a level of inhibition comparable to that reported by others using transiently PKI-transfected cells [39]. It is not clear whether higher expression of PKI in S91 cells would further inhibit PKA activity. Although others report up to 80% inhibition of PKA activity when using cells transiently transfected with constitutively expressed PKI [41], these investigators employed a nonconventional PKA heat-inactivation assay that may not be comparable to the histone phosphorylation assay in which lesser degrees of inhibition are observed. Concentrations of CdCl2 up to 10 mM have been used with other cell types to induce the expression of the pMXX vector [30], but concentrations above 1 mM were not tolerated by the S91 cells for the required period of 5– 6 days in our a-MSH experiments. S91-PKI cells with reduced PKA activity exhibited a quantitatively identical reduced responsiveness to a-MSH, in that induction of tyrosinase activity, tyrosinase protein, and mRNA levels, as well as PKA activity, were reduced by PKI by 30 – 40%. Taken together, these results strongly suggest that activation of PKA is not only required by the fact that in our experiments, PKA activity was measured by in vitro assay and that measures the total activatable PKA and may not reflect the actual level of PKA activity in vivo. Others have determined the inhibition of PKA activity by PKI in vivo by cotransfecting a reporter gene under the control of cAMP-inducible promoter [42], but it was not feasible to cotransfect the S91-PKI cells for each of our experiments. To determine the level of PKA inhibition by PKI in vivo, we also attempted to identify a gene in S91 cells whose expression is primarily induced through the cAMP-dependent pathway, but those known to be induced by cAMP, such as prolactin gene transcription [39], were not detected in S91 cells. As well, in our study the activity of PKA was determined only on day 5 or day 6 after a-MSH treatment and may have been lower or higher early in the treatment period. In the present study, basal pigment level and tyrosinase activity were similar in S91-control and S91-PKI cells, suggesting that the basal melanogenic activity is

123

independent of PKA and regulated by a different pathway from that of a-MSH-induced pigmentation. However, because the PKA activity was inhibited by PKI only 30 – 40% in this study, it is also possible the amount of PKA activity required to maintain basal pigmentation is simply lower than that for a-MSHinduced pigmentation, so that no significant inhibition occurs at this level of PKA activity. The mechanism by which PKA mediates a-MSHinduced increases in the expression and activity of tyrosinase is unclear. Partially purified PKA has been reported to activate tyrosinase when added directly to S91 lysate in vitro [12]. However, the fact that expression of PKI in S91 cells inhibited a-MSH-induced tyrosinase mRNA suggests the pathway involves nuclear events. Recently, Bertolotto et al. [43] reported that microphthalmia, a transcription factor regulating the expression of tyrosinase at least in mice, is involved in cAMP-induced tyrosinase gene expression in that cAMP stimulated the binding of microphthalmia to the tyrosinase gene promoter region in B16 melanoma cells. In combination with earlier work [11–16, 29], the present data demonstrate that both PKA and PKC are required for a-MSH-induced pigmentation. PKC and PKA are unlikely to regulate pigmentation independent of each other because depletion of PKC completely blocks a-MSH-induced pigmentation even though the initial increasing in intracellular level of cAMP by a-MSH is unaffected [29]. Furthermore, induction of pigmentation by dibutyryl cAMP in S91 cells is also completely blocked in PKC-depleted cells [29]. It is therefore likely that the PKC and PKA pathways interact during pigment induction such that inhibition of either pathway blocks a-MSH action. Such an interaction between PKC and PKA pathways is consistent with prior reports, for example, that increases in the intracellular level of cAMP cause PKC to translocate to the nucleus in B lymphocytes [44] and phosphorylation on voltage-gated sodium channel by both PKA and PKC is required for the reduction of peak sodium currents in brain neurons [45]. Depletion of PKC has no effect on total PKA activity during the 6-day treatment of S91 cells with a-MSH leading to increased pigmentation [29], suggesting that PKC does not regulate the expression and/or activity of PKA. Alternatively, PKA may upregulate the expression of one or more PKC isoforms involved in mediating a-MSH-induced pigmentation, for example, PKC-b, required for phosphorylation (activation) of tyrosinase in human melanocytes [28] and shown to be lacking in serially passaged S91 cells no longer capable of responding to a-MSH [38]. Of note, these several postulated mechanisms are not mutually exclusive. In summary, the present study demonstrates for the first time that the cAMP-dependent pathway, through

124

AO ET AL.

activation of PKA, is required for optimal a-MSH-induced pigmentation. This demonstration and the availability of instructive probes should now allow a more critical examination of signal transduction involved in a-MSH-induced pigmentation.

21.

Mountjoy, K. G., Bird, I. M., Rainey, W. E., and Cone, R. D (1994) Mol. Cell. Endocrinol. 99, R17–R20.

22.

Varga, J. M., DiPasquale, A., Pawelek, J., McGuire, J., and Lerner, A. (1974) Proc. Natl. Acad. Sci. USA 71, 1590 –1593.

23.

Lambert, D. T., and Lerner, A. B. (1983) J. Chromatogr. 266, 567–576.

This work was supported in part by grants from the Charlotte Greyer Foundation (to H.Y.P.) and the National Cancer Institute (to H.Y.P., R01CA72763 01A1).

24.

Chhajlani, V., and Wikberg, J. E. S. (1992) FEBS Lett. 309, 417– 420.

25.

Edelman, A. M., Blumenthal, D. K., and Krebs, E. G. (1987) Annu. Rev. Biochem. 56, 567– 613.

REFERENCES

26.

Walsh, D. A., Ashby, C. D, gonzalez, C., Calkins, D., Fischer, E. H., and Krebs, E. G. (1971) J. Biol. Chem. 246, 1977–1985.

27.

Scott, J. D., Fischer, E. H., Demaille, J. G., and Krebs, E. G. (1985) Proc. Natl. Acad. Sci. USA 82, 4379 – 4383.

28.

Park, H. Y., Russakovsky, V., Ohno, S., and Gilchrest, B. A. (1993) J. Biol. Chem. 268, 11742–11749.

29.

Park, H. Y., Russakovsky, V., Ao, Y., Fernandez, E., and Gilchrest, B. A. (1996) Exp. Cell Res. 227, 70 –79.

30.

Ercolani, L., Stow, J. L., Boyle, J. F., Holtzman, E. J., Lin, H., Grove, J. R., and Ausiello, D. A. (1990) Proc. Natl. Acad. Sci. USA 87, 4635– 4639.

31.

Grove, J. R., Price, D. J., Goodman, H. M., and Avruch, J. (1987) Science 238, 530 –533.

32.

Gibco BRL. Protocol of RNA Isolation by TRIzol Reagent. Gibco BRL, Life Technologies, Grand Island, NY

33.

Park, H. Y., and Campisi, J. (1990) Cancer Res. 50, 7145–7152.

34.

Gordon, P. R., and Gilchrest, B. A. (1989) J. Invest. Dermatol. 93, 700 –702.

35.

Pomerantz, S. H. (1966) J. Biol. Chem. 241, 161–168.

36.

Jimenez, M., Maloy, W. L., and Hearing, V. J. (1988) J. Biol. Chem. 264, 3397–3403.

37.

Laemmlli, U. K. (1970) Nature 277, 680 – 685.

38.

Park, H. Y., and Gilchrest, B. A. (1996) J. Cutane. Med. Surg. 1, 4 –9.

39.

Day, R. N., Walder, J. A., and Maurer, R. A. (1989) J. Biol. Chem. 264, 431– 436.

40.

Freedman, P. S., and Gilchrest, B. A. (1987) J. Cell. Physiol. 133, 88 –94.

41.

Olsen, S. R., and Uhler, M. D. (1991) Mol. Endocrinol. 5, 1246 – 1256.

42.

Grove, J. R., Deutsch, P. J., Price, D. J., Habener, J. F., and Avruch, J. (1989) J. Biol. Chem. 264, 19506 –19513.

43.

Bertolotto, C., Bille, K., Ortonne, J., and Balloti, R. (1996) J. Cell. Biol. 134, 747–755.

44.

Cambier, J. C., Newell, M. K., Justement, L. B., McGuire, J. C., Leach, K. L., and Chen, Z. Z. (1987) Nature 327, 629 – 632.

45.

Li, M., West, J. W., Numann, R., Murphy, B. J., Scheuer, T., and Catterall, W. A. (1993) Science 261, 1439 –1442.

1.

2. 3. 4. 5. 6. 7.

8.

9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.

20.

Bleehen, S. S., and Ebling, F. J. G. (1986) in “Textbook of Dermatology” (Rook, A., Wilknson, D. S., Ebling, F. J. G., Champion, R. H., and Burton, J. L., Eds.), 4th ed., Vol. 2, pp. 1543–1604, Blackwell Sci., Oxford. Prota, G. (1992) in “Melanins and Melanogenesis” (Prota, G., Ed.), pp. 27–33, Academic Press, San Diego. Lerner, A. B., Fitzpatrick, T. B., Calkins, E., and Summerson, W. H., (1949) J. Biol. Chem. 178, 185–195. Pawelek, J. M. (1985) Yale J. Biol. Med. 58, 571–578. Kreiner, P. W., Gold, C. J., Keirns, J. J., Brock, W. A., and Bitensky, M. W. (1973) Yale J. Biol. Med. 46, 583–591. DeLuca, M., Siegrist, W., Bondanza, S., Mathor, M., Cancedda, R., and Eberle, A. N. J. Cell. Sci. 105, 1079 –1084. Abdel-Malek, Z., Swope, V. B., Suzuki, I., Akcali, C., Harriger, M. D., boyce, S. T., Urabe, K., and Hearing, V. J. (1994) Proc. Natl. Acad. Sci. USA 92, 1789 –1793. Leivine, N., Sheffel, S. N., Eytan, T., Dorr, R. T., Hadley, M. E., Weinrach, J. C., Ertl, G. A., Toth, K., McGee, D. L., and Hruby, V. J. (1991) JAMA 2730 –2736. Lerner, A. B., and McGuire, J. S. (1961) Nature 189, 176 –179. Korner, A. M., and Pawelek, J. (1982) Science 217, 1163–1165. Fuller, B. B., Lunsford, J. B., and Iman, D. S. (1987) J. Biol. Chem. 262, 4024 – 4033. Korner, A., and Pawelek, J. (1977) Nature 267, 444 – 447. Wong, G., and Pawelek, J. M. (1975) Nature 255, 644 – 646. Wong, G., and Pawelek, J. M. (1973) Nature 241, 213–215. Pawelek, J. M. (1976) J. Invest. Dermatol. 66, 201–209. Pawelek, J. M., Wong, G., Samsone, M., and Morowitz, J. (1973) Yale J. Biol. Med. 46, 430 – 443. Hoganson, G. E., Ledwitz-Rigby, F., Davidson, R. L., and Fuller, B. B. (1989) Somatic Cell Mol. Genet. 15, 255–263. Halaban, R., Pomerantz, S., Marshall, S., and Lerner, A. b. (1984) Arch. Biochem. Biophys. 230, 383–387. Pawelek, J., Sansome, M., Kech, N., Christic, G., Halaban, R., Hendee, J., Lerner, A., and Varga, J. (1975) Proc. Natl. Acad. Sci. USA 72, 951–956. Chhajlani, V., and Wikberg, J. E. S. (1992) FEBS Lett. 309, 417– 420.

Received December 23, 1997 Revised version received March 11, 1998