- Email: [email protected]
Adjuvant effects of chicken interleukin-18 in avian Newcastle disease vaccine
Vaccine 28 (2010) 1148–1155
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Adjuvant effects of chicken interleukin-18 in avian Newcastle disease vaccine Li-Hsiang Hung a,b , Hsin-Pei Li c , Yi-Yang Lien a , Mei-Li Wu c , Hso-Chi Chaung a,∗ a
Department of Veterinary Medicine, National Pingtung University of Science & Technology, 1, Hseuh Fu Road, Neipu, Pingtung 912, Taiwan, ROC Kaohsiung Biological Product Co. Ltd., Kaohsiung 800, Taiwan, ROC c Graduate Institute of Biotechnology, National Pingtung University of Science & Technology, Pingtung 912, Taiwan, ROC b
a r t i c l e
i n f o
Article history: Received 23 July 2009 Received in revised form 21 October 2009 Accepted 11 November 2009 Available online 28 November 2009 Keywords: Newcastle disease Interleukin-18 Interferon-␥ Nitric mono-oxide Hemagglutination inhibition Chicken
a b s t r a c t Interleukin-18 (IL-18) can induce interferon-␥ (IFN-␥) production and promote Th1 immunity, and hence, it modulates immune functions. In the present study, the in vitro and in vivo immunomodulatory activities of full length or mature chicken IL-18 expressed in a prokaryotic expression system (pCHIL18-F and pCHIL18-M, respectively) and chicken IL-18 expressed in a eukaryotic expression system (euCHIL18) were examined. Results showed that pCHIL18-F, pCHIL18-M and euCHIL18 significantly enhanced IFN-␥ mRNA expression in chicken splenocytes, which successfully increased IFN-␥-induced nitric oxide (NO) synthesis by macrophages. Vaccination with cell-cultured Newcastle disease vaccine (NDTC) co-administrated with pCHIL18-F, pCHIL18-M or euCHIL18 resulted in significant increments of hemagglutination inhibition (HI) titers, cell proliferation of peripheral blood mononuclear cells (PBMC), and ratios of CD8+ to CD4+ in chickens compared with inoculation of PBS or NDTC alone. Thus, full length and mature chicken IL-18 expressed using a prokaryotic system and using a eukaryotic system showed equivalent in vitro and in vivo biological activities, and all forms effectively enhanced cell-mediated and humoral immunity, suggesting possible future use as a potential adjuvant in chicken NDTC vaccine production. © 2009 Elsevier Ltd. All rights reserved.
1. Introduction Interleukin-18 (IL-18), originally known as interferon-␥ (IFN␥)-inducing factor, was initially found in Kupffer cells of mice sequentially treated with Propionibacterium acnes and lipopolysaccharides (LPS) in 1995 [1]. IL-18 shares properties with IL-12 and both cytokines act synergistically to promote IFN-␥ production, which plays an important role in inducing Th1 immune responses [2]; thus IL-18 provides an important link between the innate and adaptive immune responses. Early studies have demonstrated that intra-dermal administration of IL-18 in mice results in a marked increase in dendritic cell numbers in lymph nodes [3], and co-administration of IL-18 plasmid as an encoded adjuvant yielded stronger CD4+ and CD8+ T cell responses in immunized mice, thus enabling DNA vaccines to achieve enhanced immune response induction [4]. In addition, IL-18 has been applied as an vaccine adjuvant in several mammalian species including mice [5], feline [6,7], rhesus macaques [8], and pigs, with classical swine fever virus, pseudorabies virus, porcine reproductive and respiratory syndrome virus, and foot and mouth disease virus vaccines [9–13]. Their results indicate that IL-18 not only shortens the cytotoxicity induction time, but it also enhances antigen-specific lympho-proliferative responses and IFN-␥ release; thus, IL-18 is a
∗ Corresponding author. Tel.: +886 8 7740370; fax: +886 8 7740450. E-mail address: [email protected] (H.-C. Chaung). 0264-410X/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2009.11.042
powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. IL-18 is synthesized as a full length precursor molecule which is then cleaved by caspase-1 (IL-1 converting enzyme) into a bioactive cytokine which is the mature form of IL-18. Only this mature IL-18 rather than the full length form of IL-18 is biologically active in mammals [14,15]. Numerous studies have ensured that mammalian IL-18 has been characterized in great detail [2]. However, the properties and application of chicken IL-18 in avian vaccines still remains largely uninvestigated as of yet. The few studies of chicken IL-18 that have been conducted have yielded that the predicted protein sequence of complete chicken IL-18 cDNA bears only around 30% amino acid identity with mammalian IL-18 [16], and the bacterially expressed chicken IL-18 is capable of inducing both the synthesis of chicken IFN-␥ in cultured primary chicken spleen cells and the proliferation of CD4+ T cells [16,17]. In addition, the purified Escherichia coli-expressed recombinant chicken IL-18 significantly enhanced antibody responses to Clostridium perfringens ␣-toxoid and Newcastle disease (ND) virus antigens, to a degree comparable to the aluminum gel or Miglyol/chitosan adjuvants used in vaccination of specific pathogen-free (SPF) chickens [18]. Chicken IL-18 cDNA linked with recombinant encoding sequences of H5-H7 avian influenza virus (AIV) in a fowl pox-based DNA vaccine (rFPV-H5H7-IL18) successfully induces complete protection (100%) in SPF chicken after challenge with H5 AIV, and lymphocyte proliferation induced by the rFPV-H5-H7-IL18 is significantly higher than that induced by rFPV-H5-H7 alone [19].
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
1149
Table 1 Primers for PCR amplification of pCHIL18-F, pCHIL18-M, euCHIL18, IFN-␥ and -actin. Primer name
Primer sequences (5 → 3 )
PCR product (bp)
Accession no.
pCHIL18-F
F5 GTCCATATGAAGATGGAGCTGTG R5 CTGATAAAGCTTATATAGGTTGTGCC
621
AJ277865
pCHIL18-M
F5 CGCGGATCCTGCCTTTTGTAAGG R5 CTGATAAAGCTTATATAGGTTGTGCC
525
AJ277865
euCHIL18
F5 GTCATGCTTAAGATGGCTGTG R5 CTGATAAAGCTTATATAGGTTGTGCC
621
AJ277865
IFN-␥
F5 GACATCTCCCAGAAGCTATCTGAGC R5 GAGCACAGGAGGTCATAAGATGC
571
NM 205518
-actin
F5 GATTTCGAGCAGGAGATGGCCACAG R5 GATCCACATCTGCTGGAAGGTGGAC
408
X99774
Restriction sites of NdeI/HindIII, BamHI/HindIII and AflIII/HindIII were designed in the forward (F)/reverse (R) primer sequences of pCHIL18-F, pCHIL18-M and euCHIL18, respectively.
Although these results have demonstrated that chicken IL-18 has the ability to act as a potent adjuvant in avian vaccines, whether the different forms of recombinant chicken IL-18 function differently in vitro or in vivo is still not well investigated. In the present study, both the full length and mature forms of chicken IL-18 were cloned and expressed using a prokaryotic system, and the full length form of chicken IL-18 was expressed using a eukaryotic system; the in vitro and in vivo biological functions of these three different forms of expressed recombinant proteins will be investigated in order to possibly employ chicken IL-18 as part of a feasible vaccination strategy in the near future. 2. Materials and methods 2.1. Construction, expression and purification of prokaryotic cell-expressed chicken IL-18 The prokaryotic cell-expressed full length and mature chicken IL-18 (pCHIL18-F and pCHIL18-M, respectively) were cloned according to the sequences published as accession numbers of AJ277865 in GenBank. The specific primers for amplification of full length and mature chicken IL-18 cDNA were designed using Expert Sequence Analysis software (Table 1) and applied in polymerase chain reactions (PCR). Templates of chicken cDNA were converted from the extracted RNA of LPS-stimulated splenocytes using a commercially available reverse-transcriptase (RT) kit (Promega Corp.; Madison, WI, USA) (LPS from Escherichia coli serotype 055:B5; Sigma–Aldrich; St. Louis, MO, USA). In the RT reaction, a mixture of 1 g of total RNA and 1 g of Oligo (dT)15 primer (0.5 g/L) was heated at 70 ◦ C for 10 min, after which 0.5 L RNase inhibitor (40 U/L), 4 L MgCl2 (25 mM), 2 L dNTP (10 mM), 2 L 10× PCR buffer, and 1.5 L Avian Myeloblastosis Virus (AMV) reversetranscriptase (10 U/L) were added, and the final volume of the reaction was adjusted to 13 L with the addition of pure water. The reaction was carried out at 42 ◦ C for 15 min and followed with a 5 min reaction at 95 ◦ C using an iCycler Thermocycler (Bio-Rad Laboratories; Hercules, CA, USA). Then, amplification of the full length and mature chicken IL-18 was performed in a mixture containing 0.5 L of each primer for pCHIL18-F/pCHIL18-M, 2.5 L of 10× PCR buffer, 2 L MgCl2 (50 mM), 1 L of dNTP (2.5 mM), 0.25 L of Taq/Pfu polymerase (5 U/L), and 1 L of cDNA; the mixture was adjusted to a final volume of 25 L with pure water and subject to the following cycling parameters for PCR: pre-heat at 94 ◦ C for 5 min, followed by 35 cycles of denaturing at 94 ◦ C for 30 s, annealing at 50 ◦ C for 30 s, and extension at 72 ◦ C for 30 s, and concluding with the last step of final extension at 72 ◦ C for 10 min. The final reaction product was then transferred into the well of a 2% agarose gel stained with 0.05 g/mL ethidium-bromide in 0.5× TBE buffer and subject to electrophoresis at 100 V for 15 min.
The amplified products of pCHIL18-F and pCHIL18-M (621 and 525 bp, respectively) were purified and separately ligated with a TA cloning vector obtained from the pGEM® -T Easy Vector System (Promega Corp.). Then, the constructed plasmids were transformed into E. coli DH5␣ (Stratagene; CA, USA), the colonies containing the pCHIL18-F- or pCHIL18-M-plasmids were selected, and their nucleotide sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer (Applied Biosystems; Foster City, CA, USA). The plasmids containing the encoding sequence of pCHIL18-F were extracted and purified using the Qiagen Plasmid Maxi kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s manual. The purified plasmids were then digested with NdeI and HindIII (Promega Corp.) and inserted into the corresponding sites of the pET21b expression vector to form a sequence encoding a fusion protein of pCHIL18-F. The digestion and ligation of plasmids containing the encoding sequence of pCHIL18-M were performed using similar steps as processing pCHIL18-F except that BamHI (Promega Corp.) instead of NdeI was used due to the designed restriction site in the pCHIL18-M forward primer. The recombinant pCHIL18-F or pCHIL18-M expression plasmids were then transformed into the E. coli BL21, the transformants were selected on ampicillin agar plates, and their nucleotide sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer. The BL21 harboring pCHIL18-F- or pCHIL18-M-expression plasmids were grown at 37 ◦ C to OD600 = 0.8, induced with 1 mM isopropyl--d-thiogalactopyranoside for 4 h at 37 ◦ C and disrupted by sonication on ice (Misconix, Farmingdale, NY). The fusion protein of pCHIL18-F or pCHIL18-M was purified on a nickel chelating agarose affinity column according to the manufacturer’s instructions and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions as previously published [20]. The concentrations of fusion pCHIL18-F and pCHIL18-M were determined using the BCA protein assay reagent kit (Bio-Rad Laboratories). The amounts of endotoxin in the batches of purified pCHIL18-F and pCHIL18-M were checked using the Pyrosate Endotoxin Detection Kit (Associates of Cape Cod, Inc., MA, USA). Endotoxin in the purified pCHIL18-F and pCHIL18-M at the concentration of 200 g/mL was undetectable (<0.25 EU/mL). 2.2. Construction and expression of eukaryotic cell-expressing chicken IL-18 Primers specific for construction of the eukaryotic expression vector containing full length chicken IL-18 (euCHIL18) were designed and applied in the PCR reaction as described above. The amplified products of euCHIL18 (621 bp) were purified and ligated with an expression vector obtained from the pcDNA3.1/V5His TOPO TA Expression Kit® (Invitrogen). Then, the constructed
1150
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
euCHIL18 expression plasmids were transformed into TOP10 E. coli (Invitrogen), colonies containing the euCHIL18 expression plasmids were selected, and their nucleotide sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer. Chinese hamster ovary (CHO) cells (ATCC CCL-61) were then transfected with 5 g of the euCHIL18 expression plasmids using Lipofectamine Plus (Invitrogen) following the manufacturer’s recommended protocol. Then the transfected cells were collected, washed three times with phosphate buffer solution (PBS), and resuspended in D-MEM/F-12 (Gibco) containing 10% FBS, 100 U/mL penicillin and 100 g/mL streptomycin. After 24 h, G418 sulfate (600 g/mL) (Invitrogen) was added to the culture medium and selection was performed for 6 weeks by sequentially replacing the medium containing 800, 1200, and 1600 g/mL G418 sulfate every 3–4 days to a final concentration of 2000 g/mL G418 sulfate. Then, each of the remaining isolated colonies was picked up for continuous culture in D-MEM/F-12 containing 10% FBS, 100 U/mL penicillin and 100 g/mL streptomycin but no G418 sulfate for 14 days. These growing colonies were considered the stable clones expressing euCHIL18. 2.3. Immunoblot analysis The expressed pCHIL18-F, pCHIL18-M and euCHIL18 was separately mixed with SDS-PAGE sample buffer (0.125 M Tris–HCl, pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue), heated at 94 ◦ C for 4 min, applied to a 15% SDS-polyacrylamide gel and electro-blotted onto a hydrophobic polyvinylidene difluoride (Hybond-P PVDF) transfer membrane (Amersham Pharmacia Biosciences; USA). The membrane was blocked in TBS-T (20 mM Tris, 140 mM NaCl, 1 M HCl, 0.1% Tween20, pH 7.6) containing 5% non-fat dry milk at 37 ◦ C for 2 h, incubated with 1:1000 mouse anti-(his)6 -mAb (Invitrogen) at 4 ◦ C for overnight, washed with TBS-T, incubated with 1:2500 HRP-conjugated goat anti-mouse IgG antibody (Amersham Pharmacia Biosciences) at room temperature for 1 h, and finally washed five times with TBS-T. The membrane was developed using Sigma Fast DAB peroxidase substrate (Sigma–Aldrich) following the manufacturer’s protocol. The image was visualized using the ECL Plus Western Blotting (Syngene) enhanced chemiluminescence detection (Amersham Pharmacia Biosciences) and following indications published by the Bio Imaging System manufacturer.
quantified using the Griess assay kit (Promega) according to the manufacturer’s instructions. 2.5. Chicken splenocyte IFN- mRNA quantification by real-time RT-PCR Total RNA was isolated from the IL-18-treated chicken splenocytes using the total RNA Miniprep kit (Qiagen) and RNA concentrations were measured using the Gene Quant II spectrophotometer (Amersham Pharmacia Biosciences). Extracted RNA was then immediately converted into cDNA using the commercially available reverse transcription (RT) kit as described above (Promega Corp.). The resultant cDNA was used in a real-time PCR assay in order to quantify mRNA levels in pCHIL18-F-, pCHIL18-M- and euCHIL18-treated splenocytes using the Sybr Green Kit (Qiagen Inc.) in the Light Cycler II (Roche Diagnostics, Mannheim, Germany). The PCR products of IFN-␥ and -actin cDNA were amplified by PCR using primers specific for chicken IFN-␥ and -actin (as the internal control gene) (Table 1). The resultant PCR products were visualized using ethidium-bromide staining following electrophoresis on a 2% agarose gel and their sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer. Amplification by realtime PCR was carried out in a sealed capillary (Roche Diagnostics, Mannheim, Germany), 10 L final reaction volume containing 1 L of Sybr green master mix, 1.2 L MgCl2 (25 mM), 1 L primers, 5.8 L of diethyl pyrocarbonate (DEPC)-water and 1 L of either sample cDNA, plasmid containing a fragment of IFN-␥ or -actin (as a positive control), or distilled water (as a negative control). The PCR reactions were performed using the Light Cycler II and subjected to the following cycling parameters: denaturation for 10 min at 95 ◦ C, amplification for 35 cycles with denaturation at 95 ◦ C for 10 s, annealing at 65 ◦ C for 10 s, extension at 72 ◦ C for 23 s followed by fluorescence acquisition at 65 ◦ C for 15 s. Melting curve analysis of the PCR products was performed after amplification using the conditions suggested in the Sybr green kit manual. Quantification of cytokine mRNA from sample cDNA was calculated using the following formula [22]: 2−Ct =
2Ct IFN-␥ 2Ct -actin
where Ct IFN-␥ = Ct IFN-␥ of the treated cells − Ct IFN-␥ of the untreated cell; Ct -actin = Ct -actin of the treated cells − Ct actin of the untreated cell.
2.4. Bioassays of pCHIL 18-F, pCHIL18-M and euCHIL18
2.6. Vaccination and ND challenge of chickens
A sensitive bioassay based on the inducible release of IFN␥ by splenocytes in response to treatment with recombinant pCHIL18-F, pCHIL18-M or euCHIL18 was performed as described by Puehler et al. [21] with minor modifications. Splenocytes were isolated from three 4-week-old SPF chickens, seeded at a density of 1 × 107 cells/mL in a 24-well plate, treated with 20 L of different doses (0, 25, 50, 125, 250 and 500 ng/mL) of purified pChIL18-F/pChIL18-M, or with 50 L of cell lysates from a CHO stable clone (100 g/mL), or non-transfected CHO cells as a negative control, and incubated in triplicates per individual animal at 41 ◦ C for 18 h. The IFN-␥ mRNA expressions of pre-treated splenocytes were detected using real-time RT-PCR. After cells were treated with three different forms of recombinant chicken IL-18, the splenocyte supernatants were harvested and transferred for culturing chicken macrophages in order to determine the IFN-␥-induced nitric oxide (NO) synthesis by these macrophages. The chicken macrophages (2 × 105 /100 L/well) isolated from three 4-week-old SPF chickens were incubated with the corresponding pre-treated splenocyte supernatants as described above in a 96-well plate at 37 ◦ C/5% CO2 for 24 h. The NO levels in the culture medium of macrophages were
The NDV strong virulent strain (NDV Clone-Sato) grown in the allantoic cavity of chicken embryos was kindly provided by Kaohsiung Biological Product Co. Ltd. and used as the challenge virus at a dose of 104 minimum lethal dose (MLD). The cell-cultured ND inactivated vaccine was a ND-Ishii virus strain propagated in Baby Hamster Kidney (BHK) cells, harvested at 72 h post-infection, and inactivated by treatment with 0.2% formalin. One dose of cell-cultured ND vaccine (NDTC) contained the equivalent of 108 embryo-infectious dose (EID50 ) before inactivation by formalin. A total of 50 white leghorn SPF birds for the challenge experiments were divided randomly into 5 groups (n = 10 per group). They were hatched and reared in isolation, and allowed food and water ad libitum. Birds in Group 1 were immunized with PBS as the controls and those in groups 2–5 were inoculated with NDTC alone, NDTC plus 100 g pCHIL18-F, NDTC plus 100 g pCHIL18-M, and NDTC plus 100 g euCHIL18, respectively. All birds at 4 weeks of age were immunized intramuscularly (i.m.) in the leg in using a final volume of 1 mL/chicken for the primary vaccination and injected with 1 mL/dose/chicken in the right breast muscle (booster immunization) at 3 weeks following the primary immunization. Identical
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
formulations per group were given for the primary and secondary vaccinations. Chickens were challenged with NDV strong virulent strain (NDV Clone-Sato) at a dose of 104 MLD in 1 mL by i.m. injection at 6 weeks following the primary inoculation. Approval for these animal studies was obtained from the Center for Research Animal Care and Use Committee of the National Pingtung University of Science and Technology. Following vaccine administration and challenge, chickens were observed daily for clinical signs and mortality throughout the duration of the experiment. Prior to the challenge, all chickens were bled from the wing vein every week following the primary inoculation for the detection of antibodies to ND by the hemagglutination inhibition (HI) test. Peripheral blood mononuclear cells (PBMC) were isolated, and cell proliferation and percentages of CD4+ and CD8+ cells were determined by the following procedures. 2.7. Hemagglutination inhibition (HI) assay The HI tests were performed using a standard microtiter plate method described in a previously published article [23]. Briefly, each sample of serum in a twofold series dilution was incubated with four Hemagglutinating Unit (HAU) of NDV Ishii strain at room temperature for 30 min. The HAU of NDV Ishii strain was titrated before each assay was performed. After 25 L of 1% chicken erythrocytes were added at room temperature for 45 min, agglutination was monitored and recorded. The geometric mean of serum HI titers obtained from each group was defined as the reciprocal logarithm in a base of 2 of the highest serum dilution completely inhibiting agglutination. 2.8. Cell proliferation assay PBMC were isolated from heparinized peripheral blood using Ficoll-hypaque (Sigma) density sedimentation. The isolated cells were washed twice in Hanks balanced salt solution (HBSS) with Ca2+ /Mg2+ (Mediatech; Herndon, VA, USA) and resuspended in RPMI 1640 (JRH Biosciences) supplemented with 10% FBS, penicillin, streptomycin, l-glutamine, and 25 mM HEPES buffer (RPMI-10%) in a final concentration of 2 × 106 cells/mL. PBMC cell proliferation was evaluated using the commercially available ELISA-BrdU Kit (Roche Molecular Biochemicals). The assay was performed according to the manufacturer’s instruction. Briefly, 50 L/well of the PBMC (4 × 105 cells/well) was pre-treated with or without 1 g/well of Concanavalin A (ConA; Sigma) in triplicate per 96-well plate at 37 ◦ C/5% CO2 incubator for 48 h. Then, 10 L/well BrdU labelling reagent (10 M final concentration) was added. At 12 h, the cells were harvested by centrifugation at 300 × g for 10 min and were fixed in an ethanol solution, followed by incubation with peroxidase-labeled anti-BrdU for 90 min. After removal of the antibody conjugate and three washes, 100 L/well tetramethylbenzidine (TMB) was added and the mixtures incubated until the appropriate color development was achieved (about 10 min). The optical density of each sample (OD370/492 ) was measured at a wavelength of 370 nm with background subtraction at 492 nm using an ELISA plate reader (Thermo, Multiskan Spectrum; Vantaa, Finland), blanked with culture medium alone to account for nonspecific binding. The stimulation index (SI) was calculated by the following equation: SI =
OD370/492 of ConA-treated cells OD370/492 of untreated cells
1151
FITC (clone CT-4) or anti-CD8-PE (clone CT-8) (Beckman Coulter, Inc., USA). The flow cytometer settings were established for linear amplification of light scatter and logarithmic amplification of fluorescence channels. The threshold was defined in forward scatter with FS 100 to exclude cell debris. Flow cytometric analysis of the percentages of positively stained cells was performed using the BD FACScanTM Flow Cytometer (BD Biosciences; San Diego, CA, USA).
2.10. Statistics Raw SI data in response to vaccination by chicken cells were converted to the fold of increment relative to that of the PBS controls in each experimental animal and were used as the indices of detection. Data were analyzed using the general linear model procedures of the SAS (statistical software package) (SAS Institute Inc.; Cary, NC, USA). Differences between each treatment mean and that of PBS controls in the bioassays were analyzed using the Student’s t-test, and Duncan’s multiple range tests were used to compare the differences of means among groups in the vaccination experiment. Significance was determined at p < 0.05.
3. Results 3.1. Cloning and expression of pCHIL18-F, pCHIL18-M and euCHIL18 PCR products of pCHIL18-F, pCHIL18-M and euCHIL18 separated by gel electrophoresis (621, 525 and 621 bp, respectively) is shown in Fig. 1; their sequences were confirmed to be of 100% homology to the chicken IL-18 cDNA sequence published with an accession number of AJ277865. The estimated molecular weights of pCHIL18-F, pCHIL18-M and euCHIL18 were 23.7, 21.8 and 28.7 kDa as revealed by SDS-PAGE (Figs. 2A and 3A, respectively) and confirmed the expressions of the three different forms of recombinant chicken IL-18 fusion proteins. Although the fusion proteins of pCHIL18F and pCHIL18-M were originally present in the inclusion bodies inside the expressing bacteria but not in the culture medium, soluble forms of these two recombinant proteins were obtained after denaturing in a 6 M urea solution and followed by a procedure of dialysis in 20 mM Tris buffer in a cold room for 12 h. Each of the single bands of purified pCHIL18-F/pCHIL18-M and euCHIL18 in cell lysates obtained from stable clones of CHO cells were present on the Western blotting membrane (Figs. 2B and 3B, respectively). Recombinant euCHIL18 was harvested from the cell lysates rather than from the culture medium of two stable expressing clones of CHO cells (Fig. 3B). Thus, the immunoblotting analysis confirmed the presence of fusion proteins pCHIL18-F, pCHIL18-M and euCHIL18.
.
2.9. Flow cytometric analysis Two aliquots of PBMC (each of 2 × 105 cells/100 L) were stained with the fluorescently labeled monoclonal antibodies anti-CD4-
Fig. 1. Gel electrophoresis of chicken IL-18 PCR products. PCR products of fulllength or mature chicken IL-18 for E. coli expression (pCHIL18-F and pCHIL18-M, respectively) (Lanes 1 and 2) and chicken IL-18 for Chinese hamster ovary (CHO) cell expression (euCHIL18) (Lane3) were subject to electrophoresis on a 2% agarose gel. Lane M: a marker with 100 bp intervals.
1152
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
Fig. 4. IFN-␥ mRNA relative expression in splenocytes stimulated with recombinant chicken IL-18. Splenocytes (1 × 107 cells/mL) isolated from (SPF) chickens at the age of 5 weeks were cultured with 20 L of different concentrations (0, 25, 50, 125, 250 and 500 ng/mL) of pCHIL18-F or pCHIL18-M (A) and 100 g/mL of euCHIL18 in conditioned medium of a CHO stable clone (B) at 41 ◦ C/5% CO2 incubator for 18 h in triplicate. Chicken splenocytes cultured with the conditioned medium collected from the non-transfected CHO cells were used as the control group in (B). Data are presented as mean ± SEM for cells isolated from 3 individual animals. The letters a, b, c and x, y, z indicate that means are considered significantly different (p < 0.05) among groups treated with pCHIL18-F or pCHIL18-M, respectively. The symbol “*” indicates that means are significantly different from those of controls at p < 0.05. Fig. 2. SDS-PAGE and immunoblotting of the recombinant chicken IL-18 proteins for E. coli expression (pCHIL18-F and pCHIL18-M, respectively). The recombinant fusion proteins of pCHIL18-F and pCHIL18-M purified using an affinity column were analyzed in 15% SDS-PAGE electrophoresis (A) and immunoblot analysis (B). Lane M: pre-stained protein marker; Lane p1: purified pCHIL18-F; Lane p2: purified pCHIL18-M.
3.2. Bioassays of pCHIL18-F, pCHIL18-M and euCHIL18
Fig. 3. SDS-PAGE and immunoblotting analysis of the CHO cell-expressed chicken IL-18 (euCHIL18). The recombinant fusion proteins of euCHIL18 were analyzed in 15% SDS-PAGE electrophoresis (A) and immunoblot analysis (B). Lane M: pre-stained protein marker; Lane e1: culture medium, CHO cells without transfection of the euCHIL18 expression vector; Lanes e2 and e3: culture medium, CHO cells with transfection of the euCHIL18 expression vector; Lane e4: cell homogenate of CHO cells without transfection of the euCHIL18 expression vector; Lanes e5 and e6: cell homogenates of two different stable clones of CHO cells expressing euCHIL18.
3.3. Vaccination and ND challenge of chickens
The IFN-␥ mRNA levels in splenocytes were significantly enhanced by stimulation with pCHIL18-F and pCHIL18-M, and peak levels of IFN-␥ mRNA were achieved at the dose of 50 ng/mL pCHIL18-F and 250 ng/mL pCHIL18-M; levels declined as the doses increased thereafter (Fig. 4A). Significantly elevated IFN␥ mRNA expression by splenocytes in response to stimulation with euCHIL18 present in cell lysates of stable clones of CHO cells compared to those treated with CHO cell lysates following transfection with euCHIL18 expression plasmids were also observed (Fig. 4B). The IFN-␥-induced NO production by macrophages was significantly enhanced when cells were cultured with splenocyte supernatants following pre-treatment of at least 25 and 50 ng/mL of pCHIL18-F and pCHIL18-M, respectively, and reached maximal levels following 125 and 500 ng/mL pre-treatment doses, respectively. (Fig. 5A). Supernatants from chicken splenocytes stimulated with increasing amounts of pCHIL18-F or pCHIL18-M (25, 50, 125, 250, and 500 ng/mL) induced dose-dependent NO production by macrophages which did not decline thereafter. Significantly elevated IFN-␥-induced NO production by macrophages was also observed in those cultured with euCHIL18 pre-treated splenocyte supernatants (Fig. 5B). Incubation with untreated splenocyte supernatants did not induce any increased NO release by macrophages. Thus, increased IFN-␥ expression in chicken splenocytes and IFN-␥induced NO production by macrophages confirmed the biological activities of pCHIL18-F, pCHIL18-M and euCHIL 18.
The titer of HI antibodies were slightly increased at 1-week post-primary inoculation and increases continued from the 2 week
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
Fig. 5. IFN-␥-induced nitric oxide (NO) synthesis by macrophages. Chicken macrophages (2 × 105 /100 L/well) isolated from SPF chickens at the age of 5 weeks were cultured with the medium collected from splenocyte-culturing supernatants pre-treated with pCHIL18-F, pCHIL18-M (A) or euCHIL-18 (B) at 41 ◦ C/5% CO2 incubator for 24 h in triplicate. Data are presented as mean ± SEM for cells isolated from three individual animals. The letters a, b, c and x, y, z indicate that means are considered significantly different (p < 0.05) among groups treated with pCHIL18F or pCHIL18-M, respectively. The symbol “*” indicates that means are significantly different from those of controls at p < 0.05.
post-primary inoculation point except in the PBS controls, in which HI titers remained undetectable throughout the period of the vaccination experiment (Fig. 6). Chickens in Groups 3, 4 and 5 immunized with the ND vaccine formulated with pCHIL18-F, pCHIL18-M or euCHIL18 had significantly higher titers than those in the PBS controls and group 2 (vaccination with NDTC alone) (Fig. 6).
1153
Fig. 7. Cell proliferation and CD8+ /CD4+ ratio of chickens. Peripheral blood mononuclear cells (PBMC) (2 × 106 cells/mL) were isolated from the immunized chickens at 6 weeks post-primary inoculation. (A) The stimulation index (SI) of cell proliferation was calculated using the following equation: SI = OD370/492 of ConA-treated cells/OD370/492 of untreated cells. (B) CD8+ /CD4+ ratios were calculated from the number of cells labeled with the fluorescent monoclonal antibodies of anti-CD8 or anti-CD4 analyzed using a flow cytometer. N = 10 in each group. The letters a and b indicate that means are considered significantly different (p < 0.05) among treatment groups.
Chickens of the NDTC-CHIL18-F group had the highest HI titers of the five groups throughout all experimental time points starting at 2nd week post-primary inoculation (p < 0.05). A significantly elevated rate of PBMC cell proliferation in animals vaccinated with pCHIL18-F, pCHIL18-M or euCHIL18 as an adjuvant (presented as SI in Fig. 7A) compared to the PBMC proliferation rate of animals inoculated with PBS or NDTC alone was observed (p < 0.05), and the highest SI was found in PBMC isolated from animals inoculated with NDTC plus pCHIL18-F and NDTC plus pCHIL18-M (Fig. 7A). The ratios of CD8+ /CD4+ in chickens vaccinated with the NDTC vaccine co-administrated with pCHIL18-F or pCHIL18-M were significantly higher than those animals inoculated with PBS, NDTC alone or NDTC plus euCHIL18 (Fig. 7B). Moreover, results regarding the protective efficacy of immunization showed that two chickens in the group receiving NDTC alone exhibited the neuro-pathological syndromes with clinical signs of depression, distress, ruffled feathers, anorexia, diarrhea, trembling, and died 3–5 days after the challenge, whereas a 100% Table 2 The protective efficacy against a virulent NDV in vaccinated chickens.
Fig. 6. The hemagglutinin inhibition (HI) titers in chickens vaccinated with chicken Newcastle disease-cell-cultured vaccine (NDTC) with or without co-administration of pCHIL18-F, pCHIL18-M or euCHIL18 as an adjuvant. SPF chickens were randomized and divided into five groups: Group 1 was inoculated with PBS as a negative control, and the other groups vaccinated with NDTC only, NDTC co-administrated with 100 g/each of either CHIL18-F, pCHIL18-M or euCHIL18, respectively. All chickens were boost-inoculated at 3 weeks post-primary inoculation. The NDspecific HI titers were measured at 1-week intervals post-primary inoculation. N = 10 in each group. The letters a, b, c, and d indicate that means are considered significantly different (p < 0.05) among treatment groups bled at the same time point.
Vaccination Groupa
Morbidityb
Mortalityc
Protection rated
PBS NDTC NDTC-pCHIL18-F NDTC-pCHIL18-M NDTC-euCHIL18
10/10 (100%) 2/10 (20%) 0/10 (0%) 0/10 (0%) 0/10 (0%)
10/10 (100%) 2/10 (20%) 0/10 (0%) 0/10 (0%) 0/10 (0%)
0% 80% 100% 100% 100%
a Chickens were challenged with a virulent NDV (Sato stain) at 6 weeks postprimary vaccination. b The number of chickens with clinical signs/total number of chickens in each group (percentage in parentheses). c The number of dead chickens/total number of chickens in each group. d Percentage of protection rate at 2 weeks post-challenge.
1154
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
protective rate was achieved in those immunized with NDTC plus pCHIL 18-F, pCHIL 18-M or euCHIL18 (Table 2).
4. Discussion Previous reports demonstrated that caspase-1 cleavage facilitates the secretion of mature IL-18 from the cytosol across the cell membrane [24,25], and only the mature IL-18 rather than the full length IL-18 is biologically active in mammals [14,15]. In the chicken, recombinant mature chicken IL-18 also can induce IFN␥ synthesis in vitro [16] and it significantly enhances antibody responses to C. perfringens ␣-toxoid and Newcastle disease virus (NDV) antigens in vivo [18]. However, one recent report has demonstrated that both full length and mature chicken IL-18 recombinant proteins can be expressed in chicken splenic lymphocytes 24 h after transfection with their eukaryotic expression plasmids, and both recombinant proteins are biologically active for inducing NO secretion [26]. In the present study, prokaryotic expressions of either pCHIL18-F or pCHIL18-M recombinant proteins significantly induced IFN-␥ mRNA expression as well as and to the same extent as did the euCHIL-18 recombinant protein expressed in the eukaryotic system. In addition, chickens immunized with ND vaccine formulated with pCHIL18-F exhibited significantly higher HI titers than those in the PBS control group and those vaccinated with NDTC alone or NDTC formulated with pCHIL18-M or euCHIL18. Moreover, maximum IFN-␥ mRNA expressions in splenocytes were achieved with dosages of 50 ng/mL pCHIL18-F and 250 ng/mL pCHIL18-M demonstrates that pCHIL18-F exhibits comparable, if not greater in vitro activities than does mature chicken IL-18. Caspase-1 digestion may not be necessary for the immunostimulatory function of chicken IL-18, and thus, full length chicken IL-18 may act as a biological molecule instead of just an inactive precursor. The available bioassay for chicken IL-18 employs freshly isolated chicken spleen cells which respond to IL-18 by secreting IFN-␥ which can be measured by standard techniques [16]; however, an alternative sensitive bioassay for cells with low or undetectable levels of IFN-␥ secretion that would synthesize NO in response to IL-18-mediated induction of IFN-␥ secretion has been established [21]. It has been confirmed that IFN-␥-mediated upregulation of the inducible NO synthase gene expression in chicken macrophages as a function of nitrite accumulation in the culture medium can be effectively measured using the Griess assay [27,28]. Both prokaryotic and eukaryotic cell-expressed chicken IL-18 significantly stimulated IFN-␥-induced NO production by chicken macrophages in the present study; a concurring result regarding increased NO production by HD-11 cells treated with supernatants harvested from cultured B19-2D8 cells pre-treated with prokaryotic cell-expressed mature chicken IL-18 has been reported [21]. However, our results showed that the increments of NO release by macrophages are not linearly correlated with IFN-␥ mRNA levels in splenocytes. These results indicate that pCHIL18-F and pCHIL18-M regulate IFN-␥ at the transcription level in splenocytes, which is not necessarily correlated to its release in culture media by these cells. The significance of full length IL-18 conversion into mature IL-18 in the chicken still remains somewhat ambiguous; more research investigating the underlying regulation mechanisms of chicken IL18 is clearly still warranted. The plasmid encoding IL-18 or expressed recombinant IL-18 has been used as an adjuvant in mammalian vaccines to enhance Th1 immune responses [29], which may in turn enhance an antigenspecific Th1 type response which consequently promotes high antibody titers [30,31]. Recombinant chicken IL-18 has also been shown to significantly enhance antibody responses to C. perfringens ␣-toxoid and NDV antigens [18]. Consistent results on higher HI titers against ND antigen in chickens immunized with NDTC co-
administrated with pCHIL18-F, pCHIL18-M or euCHIL18 than those vaccinated with PBS or NDTC alone were achieved, further confirming the immunostimulatory activities of chicken IL-18 in vivo. In addition, the highest SI in PBMC isolated from those in groups of NDTC plus pCHIL18-F and NDTC plus pCHIL18-M indicate that the biological activities of purified prokaryotic cell-expressed chicken IL-18 in stimulating immunity might be equivalent to the eukaryotic cell-expressed chicken IL-18 in vivo. In conclusion, the prokaryotic cell- or eukaryotic cell-expressed recombinant chicken IL-18 not only induced IFN-␥ secretion in vitro but it also stimulated higher HI titers and cell proliferation of PBMC in animals vaccinated with pCHIL18-F, pCHIL18-M or euCHIL18, and it also elicited a 100% protective effect when they were used as an adjuvant in NDTC vaccines. These results confirm that chicken IL18 recombinant proteins exert in vivo biological functions through stimulating humoral and cell-mediated immunities in order to enhance the antigen-specific immunity and vaccine efficacy, which likely is suggestive of a more feasible and effective vaccine strategy in developing a new generation of avian vaccines. Acknowledgments This work was supported by research grants (96AS-14.6.1-BQB6, 97AS-14.6.1-BQ-B6 and 98AS-14.6.1-BQ-B5) from the Council of Agriculture in Taiwan. The authors also wish to thank Katherine Carey for her grammatical input and editing work on this paper. Conflict of interest statement: All authors have no financial and personal relationships with other people or organizations that could inappropriately influence (bias) their work. References [1] Okamura H, Tsutsui H, Komatsu T, Yutsudo M, Haruka A, Tanimoto T, et al. Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature 1995;378(6552):88–91. [2] Akira S. The role of IL-18 in innate immunity. Curr Opin Immunol 2000;12(1):59–63. [3] Cumberbatch M, Dearman RJ, Antonopoulos C, Groves RW, Kimber I. Interleukin (IL)-18 induces Langerhans cell migration by a tumour necrosis factor-alphaand IL-1beta-dependent mechanism. Immunology 2001;102(3):323–30. [4] Marshall DJ, Rudnick KA, McCarthy SG, Mateo LR, Harris MC, McCauley C, et al. Interleukin-18 enhances Th1 immunity and tumor protection of a DNA vaccine. Vaccine 2006;24(3):244–53. [5] Eberl M, Beck E, Coulson PS, Okamura H, Wilson RA, Mountford AP. IL18 potentiates the adjuvant properties of IL-12 in the induction of a strong Th1 type immune response against a recombinant antigen. Vaccine 2000;18(19):2002–8. [6] Hanlon L, Argyle D, Bain D, Nicolson L, Dunham S, Golder MC, et al. Feline leukemia virus DNA vaccine efficacy is enhanced by coadministration with interleukin-12 (IL-12) and IL-18 expression vectors. J Virol 2001;75(18):8424–33. [7] Dunham SP, Flynn JN, Rigby MA, Macdonald J, Bruce J, Cannon C, et al. Protection against feline immunodeficiency virus using replication defective proviral DNA vaccines with feline interleukin-12 and -18. Vaccine 2002;20(11–12):1483–96. [8] Kim JJ, Nottingham LK, Tsai A, Lee DJ, Maguire HC, Oh J, et al. Antigen-specific humoral and cellular immune responses can be modulated in rhesus macaques through the use of IFN-gamma, IL-12, or IL-18 gene adjuvants. J Med Primatol 1999;28(4–5):214–23. [9] Daniel W, Elisenda A, Annette M, Christian M, Heiner V, Mathias B, et al. Immunomodulatory effect of plasmids co-expressing cytokines in classical swine fever virus subunit gp55/E2-DNA vaccination. Vet Res 2005;36(4):571–87. [10] Yoon HA, Aleyas AG, George JA, Park SO, Han YW, Lee JH, et al. Modulation of immune responses induced by DNA vaccine expressing glycoprotein B of Pseudorabies Virus via coadministration of IFN-gamma-associated cytokines. J Interferon Cytokine Res 2006;26(10):730–8. [11] Shen G, Jin N, Ma M, Jin K, Zheng M, Zhuang T, et al. Immune responses of pigs inoculated with a recombinant fowlpox virus coexpressing GP5/GP3 of porcine reproductive and respiratory syndrome virus and swine IL-18. Vaccine 2007;25(21):4193–202. [12] Mingxiao M, Ningyi J, Juan LH, Min Z, Guoshun S, Guangze Z, et al. Immunogenicity of plasmids encoding P12A and 3C of FMDV and swine IL-18. Antiviral Res 2007;76(1):59–67. [13] Ma M, Jin N, Shen G, Zhu G, Liu HJ, Zheng M, et al. Immune responses of swine inoculated with a recombinant fowlpox virus co-expressing P12A and 3C of FMDV and swine IL-18. Vet Immunol Immunopathol 2008;121(1–2):1–7.
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155 [14] Liu B, Novick D, Kim SH, Rubinstein M. Production of a biologically active human interleukin 18 requires its prior synthesis as PRO-IL-18. Cytokine 2000;12(10):1519–25. [15] Ghayur T, Banerjee S, Hugunin M, Butler D, Herzog L, Carter A, et al. Caspase-1 processes IFN-gamma-inducing factor and regulates LPS-induced IFN-gamma production. Nature 1997;386(6625):619–23. [16] Schneider K, Puehler F, Baeuerle D, Elvers S, Staeheli P, Kaspers B, et al. cDNA cloning of biologically active chicken interleukin-18. J Interferon Cytokine Res 2000;20(10):879–83. [17] Göbel TW, Schneider K, Schaerer B, Mejri I, Puehler F, Weigend S, et al. IL18 stimulates the proliferation and IFN-gamma release of CD4+ T cells in the chicken: conservation of a Th1-like system in a nonmammalian species. J Immunol 2003;171(4):1809–15. [18] Degen WG, van Zuilekom HI, Scholtes NC, van Daal N, Schijns VE. Potentiation of humoral immune responses to vaccine antigens by recombinant chicken IL-18 (rChIL-18). Vaccine 2005;23(33):4212–8. [19] Mingxiao M, Ningyi J, Zhenguo W, Ruilin W, Dongliang F, Min Z, et al. Construction and immunogenicity of recombinant fowlpox vaccines coexpressing HA of AIV H5N1 and chicken IL18. Vaccine 2006;24(20):4304–11. [20] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227(5259):680–5. [21] Puehler F, Gobel T, Breyer U, Ohnemus A, Staeheli P, Kaspers B. A sensitive bioassay for chicken interleukin-18 based on the inducible release of preformed interferon-gamma. J Immunol Methods 2003;274(1–2):229–32. [22] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29(9):e45–50. [23] Vardaman TH, Deaton JW, Feece FN. Serological responses of broiler-type chickens, with and without Newcastle disease and infectious Bronchitis vaccine,
[24]
[25] [26]
[27]
[28]
[29]
[30]
[31]
1155
to experimental infection with Mycoplasma synoviae by foot pad, air sac and aerosol. Poult Sci 1975;54(3):737–41. Gu Y, Kuida K, Tsutsui H, Ku G, Hsiao K, Fleming MA, et al. Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme. Science 1997;275(5297):206–9. Fantuzzi G, Dinarello CA. Interleukin-18 and interleukin-1 beta: two cytokine substrates for ICE (caspase-1). J Clin Immunol 1999;19(1):1–11. Xu J, Deng TL, Li L, You ZQ, Wan WJ, Yu L. Nitric oxide inducing function and intracellular movement of chicken interleukin-18 in cultured cells. Acta Biochim Biophys Sin (Shanghai) 2005;37(10):688–93. Ding AH, Nathan CF, Stuehr DJ. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J Immunol 1988;141(7):2407–12. Stuehr DJ, Nathan CF. Nitric oxide. A macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. J Exp Med 1989;169(5):1543–55. Billaut MO, Idziorek T, Ban E, Kremer L, Dupre L, Loyens M, et al. Interleukin-18 modulates immune responses induced by HIV-1 Nef DNA prime/protein boost vaccine. Vaccine 2000;19(1):95–102. Nakano H, Tsutsui H, Terada M, Yasuda K, Matsui K, Yumikura FS, et al. Persistent secretion of IL-18 in the skin contributes to IgE response in mice. Int Immunol 2003;15(5):611–21. Pollock KG, Conacher M, Wei XQ, Alexander J, Brewer JM. Interleukin-18 plays a role in both the alum-induced T helper 2 response and the T helper 1 response induced by alum-adsorbed interleukin-12. Immunology 2003;108(2): 137–43.
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Adjuvant effects of chicken interleukin-18 in avian Newcastle disease vaccine Li-Hsiang Hung a,b , Hsin-Pei Li c , Yi-Yang Lien a , Mei-Li Wu c , Hso-Chi Chaung a,∗ a
Department of Veterinary Medicine, National Pingtung University of Science & Technology, 1, Hseuh Fu Road, Neipu, Pingtung 912, Taiwan, ROC Kaohsiung Biological Product Co. Ltd., Kaohsiung 800, Taiwan, ROC c Graduate Institute of Biotechnology, National Pingtung University of Science & Technology, Pingtung 912, Taiwan, ROC b
a r t i c l e
i n f o
Article history: Received 23 July 2009 Received in revised form 21 October 2009 Accepted 11 November 2009 Available online 28 November 2009 Keywords: Newcastle disease Interleukin-18 Interferon-␥ Nitric mono-oxide Hemagglutination inhibition Chicken
a b s t r a c t Interleukin-18 (IL-18) can induce interferon-␥ (IFN-␥) production and promote Th1 immunity, and hence, it modulates immune functions. In the present study, the in vitro and in vivo immunomodulatory activities of full length or mature chicken IL-18 expressed in a prokaryotic expression system (pCHIL18-F and pCHIL18-M, respectively) and chicken IL-18 expressed in a eukaryotic expression system (euCHIL18) were examined. Results showed that pCHIL18-F, pCHIL18-M and euCHIL18 significantly enhanced IFN-␥ mRNA expression in chicken splenocytes, which successfully increased IFN-␥-induced nitric oxide (NO) synthesis by macrophages. Vaccination with cell-cultured Newcastle disease vaccine (NDTC) co-administrated with pCHIL18-F, pCHIL18-M or euCHIL18 resulted in significant increments of hemagglutination inhibition (HI) titers, cell proliferation of peripheral blood mononuclear cells (PBMC), and ratios of CD8+ to CD4+ in chickens compared with inoculation of PBS or NDTC alone. Thus, full length and mature chicken IL-18 expressed using a prokaryotic system and using a eukaryotic system showed equivalent in vitro and in vivo biological activities, and all forms effectively enhanced cell-mediated and humoral immunity, suggesting possible future use as a potential adjuvant in chicken NDTC vaccine production. © 2009 Elsevier Ltd. All rights reserved.
1. Introduction Interleukin-18 (IL-18), originally known as interferon-␥ (IFN␥)-inducing factor, was initially found in Kupffer cells of mice sequentially treated with Propionibacterium acnes and lipopolysaccharides (LPS) in 1995 [1]. IL-18 shares properties with IL-12 and both cytokines act synergistically to promote IFN-␥ production, which plays an important role in inducing Th1 immune responses [2]; thus IL-18 provides an important link between the innate and adaptive immune responses. Early studies have demonstrated that intra-dermal administration of IL-18 in mice results in a marked increase in dendritic cell numbers in lymph nodes [3], and co-administration of IL-18 plasmid as an encoded adjuvant yielded stronger CD4+ and CD8+ T cell responses in immunized mice, thus enabling DNA vaccines to achieve enhanced immune response induction [4]. In addition, IL-18 has been applied as an vaccine adjuvant in several mammalian species including mice [5], feline [6,7], rhesus macaques [8], and pigs, with classical swine fever virus, pseudorabies virus, porcine reproductive and respiratory syndrome virus, and foot and mouth disease virus vaccines [9–13]. Their results indicate that IL-18 not only shortens the cytotoxicity induction time, but it also enhances antigen-specific lympho-proliferative responses and IFN-␥ release; thus, IL-18 is a
∗ Corresponding author. Tel.: +886 8 7740370; fax: +886 8 7740450. E-mail address: [email protected] (H.-C. Chaung). 0264-410X/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2009.11.042
powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. IL-18 is synthesized as a full length precursor molecule which is then cleaved by caspase-1 (IL-1 converting enzyme) into a bioactive cytokine which is the mature form of IL-18. Only this mature IL-18 rather than the full length form of IL-18 is biologically active in mammals [14,15]. Numerous studies have ensured that mammalian IL-18 has been characterized in great detail [2]. However, the properties and application of chicken IL-18 in avian vaccines still remains largely uninvestigated as of yet. The few studies of chicken IL-18 that have been conducted have yielded that the predicted protein sequence of complete chicken IL-18 cDNA bears only around 30% amino acid identity with mammalian IL-18 [16], and the bacterially expressed chicken IL-18 is capable of inducing both the synthesis of chicken IFN-␥ in cultured primary chicken spleen cells and the proliferation of CD4+ T cells [16,17]. In addition, the purified Escherichia coli-expressed recombinant chicken IL-18 significantly enhanced antibody responses to Clostridium perfringens ␣-toxoid and Newcastle disease (ND) virus antigens, to a degree comparable to the aluminum gel or Miglyol/chitosan adjuvants used in vaccination of specific pathogen-free (SPF) chickens [18]. Chicken IL-18 cDNA linked with recombinant encoding sequences of H5-H7 avian influenza virus (AIV) in a fowl pox-based DNA vaccine (rFPV-H5H7-IL18) successfully induces complete protection (100%) in SPF chicken after challenge with H5 AIV, and lymphocyte proliferation induced by the rFPV-H5-H7-IL18 is significantly higher than that induced by rFPV-H5-H7 alone [19].
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
1149
Table 1 Primers for PCR amplification of pCHIL18-F, pCHIL18-M, euCHIL18, IFN-␥ and -actin. Primer name
Primer sequences (5 → 3 )
PCR product (bp)
Accession no.
pCHIL18-F
F5 GTCCATATGAAGATGGAGCTGTG R5 CTGATAAAGCTTATATAGGTTGTGCC
621
AJ277865
pCHIL18-M
F5 CGCGGATCCTGCCTTTTGTAAGG R5 CTGATAAAGCTTATATAGGTTGTGCC
525
AJ277865
euCHIL18
F5 GTCATGCTTAAGATGGCTGTG R5 CTGATAAAGCTTATATAGGTTGTGCC
621
AJ277865
IFN-␥
F5 GACATCTCCCAGAAGCTATCTGAGC R5 GAGCACAGGAGGTCATAAGATGC
571
NM 205518
-actin
F5 GATTTCGAGCAGGAGATGGCCACAG R5 GATCCACATCTGCTGGAAGGTGGAC
408
X99774
Restriction sites of NdeI/HindIII, BamHI/HindIII and AflIII/HindIII were designed in the forward (F)/reverse (R) primer sequences of pCHIL18-F, pCHIL18-M and euCHIL18, respectively.
Although these results have demonstrated that chicken IL-18 has the ability to act as a potent adjuvant in avian vaccines, whether the different forms of recombinant chicken IL-18 function differently in vitro or in vivo is still not well investigated. In the present study, both the full length and mature forms of chicken IL-18 were cloned and expressed using a prokaryotic system, and the full length form of chicken IL-18 was expressed using a eukaryotic system; the in vitro and in vivo biological functions of these three different forms of expressed recombinant proteins will be investigated in order to possibly employ chicken IL-18 as part of a feasible vaccination strategy in the near future. 2. Materials and methods 2.1. Construction, expression and purification of prokaryotic cell-expressed chicken IL-18 The prokaryotic cell-expressed full length and mature chicken IL-18 (pCHIL18-F and pCHIL18-M, respectively) were cloned according to the sequences published as accession numbers of AJ277865 in GenBank. The specific primers for amplification of full length and mature chicken IL-18 cDNA were designed using Expert Sequence Analysis software (Table 1) and applied in polymerase chain reactions (PCR). Templates of chicken cDNA were converted from the extracted RNA of LPS-stimulated splenocytes using a commercially available reverse-transcriptase (RT) kit (Promega Corp.; Madison, WI, USA) (LPS from Escherichia coli serotype 055:B5; Sigma–Aldrich; St. Louis, MO, USA). In the RT reaction, a mixture of 1 g of total RNA and 1 g of Oligo (dT)15 primer (0.5 g/L) was heated at 70 ◦ C for 10 min, after which 0.5 L RNase inhibitor (40 U/L), 4 L MgCl2 (25 mM), 2 L dNTP (10 mM), 2 L 10× PCR buffer, and 1.5 L Avian Myeloblastosis Virus (AMV) reversetranscriptase (10 U/L) were added, and the final volume of the reaction was adjusted to 13 L with the addition of pure water. The reaction was carried out at 42 ◦ C for 15 min and followed with a 5 min reaction at 95 ◦ C using an iCycler Thermocycler (Bio-Rad Laboratories; Hercules, CA, USA). Then, amplification of the full length and mature chicken IL-18 was performed in a mixture containing 0.5 L of each primer for pCHIL18-F/pCHIL18-M, 2.5 L of 10× PCR buffer, 2 L MgCl2 (50 mM), 1 L of dNTP (2.5 mM), 0.25 L of Taq/Pfu polymerase (5 U/L), and 1 L of cDNA; the mixture was adjusted to a final volume of 25 L with pure water and subject to the following cycling parameters for PCR: pre-heat at 94 ◦ C for 5 min, followed by 35 cycles of denaturing at 94 ◦ C for 30 s, annealing at 50 ◦ C for 30 s, and extension at 72 ◦ C for 30 s, and concluding with the last step of final extension at 72 ◦ C for 10 min. The final reaction product was then transferred into the well of a 2% agarose gel stained with 0.05 g/mL ethidium-bromide in 0.5× TBE buffer and subject to electrophoresis at 100 V for 15 min.
The amplified products of pCHIL18-F and pCHIL18-M (621 and 525 bp, respectively) were purified and separately ligated with a TA cloning vector obtained from the pGEM® -T Easy Vector System (Promega Corp.). Then, the constructed plasmids were transformed into E. coli DH5␣ (Stratagene; CA, USA), the colonies containing the pCHIL18-F- or pCHIL18-M-plasmids were selected, and their nucleotide sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer (Applied Biosystems; Foster City, CA, USA). The plasmids containing the encoding sequence of pCHIL18-F were extracted and purified using the Qiagen Plasmid Maxi kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s manual. The purified plasmids were then digested with NdeI and HindIII (Promega Corp.) and inserted into the corresponding sites of the pET21b expression vector to form a sequence encoding a fusion protein of pCHIL18-F. The digestion and ligation of plasmids containing the encoding sequence of pCHIL18-M were performed using similar steps as processing pCHIL18-F except that BamHI (Promega Corp.) instead of NdeI was used due to the designed restriction site in the pCHIL18-M forward primer. The recombinant pCHIL18-F or pCHIL18-M expression plasmids were then transformed into the E. coli BL21, the transformants were selected on ampicillin agar plates, and their nucleotide sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer. The BL21 harboring pCHIL18-F- or pCHIL18-M-expression plasmids were grown at 37 ◦ C to OD600 = 0.8, induced with 1 mM isopropyl--d-thiogalactopyranoside for 4 h at 37 ◦ C and disrupted by sonication on ice (Misconix, Farmingdale, NY). The fusion protein of pCHIL18-F or pCHIL18-M was purified on a nickel chelating agarose affinity column according to the manufacturer’s instructions and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions as previously published [20]. The concentrations of fusion pCHIL18-F and pCHIL18-M were determined using the BCA protein assay reagent kit (Bio-Rad Laboratories). The amounts of endotoxin in the batches of purified pCHIL18-F and pCHIL18-M were checked using the Pyrosate Endotoxin Detection Kit (Associates of Cape Cod, Inc., MA, USA). Endotoxin in the purified pCHIL18-F and pCHIL18-M at the concentration of 200 g/mL was undetectable (<0.25 EU/mL). 2.2. Construction and expression of eukaryotic cell-expressing chicken IL-18 Primers specific for construction of the eukaryotic expression vector containing full length chicken IL-18 (euCHIL18) were designed and applied in the PCR reaction as described above. The amplified products of euCHIL18 (621 bp) were purified and ligated with an expression vector obtained from the pcDNA3.1/V5His TOPO TA Expression Kit® (Invitrogen). Then, the constructed
1150
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
euCHIL18 expression plasmids were transformed into TOP10 E. coli (Invitrogen), colonies containing the euCHIL18 expression plasmids were selected, and their nucleotide sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer. Chinese hamster ovary (CHO) cells (ATCC CCL-61) were then transfected with 5 g of the euCHIL18 expression plasmids using Lipofectamine Plus (Invitrogen) following the manufacturer’s recommended protocol. Then the transfected cells were collected, washed three times with phosphate buffer solution (PBS), and resuspended in D-MEM/F-12 (Gibco) containing 10% FBS, 100 U/mL penicillin and 100 g/mL streptomycin. After 24 h, G418 sulfate (600 g/mL) (Invitrogen) was added to the culture medium and selection was performed for 6 weeks by sequentially replacing the medium containing 800, 1200, and 1600 g/mL G418 sulfate every 3–4 days to a final concentration of 2000 g/mL G418 sulfate. Then, each of the remaining isolated colonies was picked up for continuous culture in D-MEM/F-12 containing 10% FBS, 100 U/mL penicillin and 100 g/mL streptomycin but no G418 sulfate for 14 days. These growing colonies were considered the stable clones expressing euCHIL18. 2.3. Immunoblot analysis The expressed pCHIL18-F, pCHIL18-M and euCHIL18 was separately mixed with SDS-PAGE sample buffer (0.125 M Tris–HCl, pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue), heated at 94 ◦ C for 4 min, applied to a 15% SDS-polyacrylamide gel and electro-blotted onto a hydrophobic polyvinylidene difluoride (Hybond-P PVDF) transfer membrane (Amersham Pharmacia Biosciences; USA). The membrane was blocked in TBS-T (20 mM Tris, 140 mM NaCl, 1 M HCl, 0.1% Tween20, pH 7.6) containing 5% non-fat dry milk at 37 ◦ C for 2 h, incubated with 1:1000 mouse anti-(his)6 -mAb (Invitrogen) at 4 ◦ C for overnight, washed with TBS-T, incubated with 1:2500 HRP-conjugated goat anti-mouse IgG antibody (Amersham Pharmacia Biosciences) at room temperature for 1 h, and finally washed five times with TBS-T. The membrane was developed using Sigma Fast DAB peroxidase substrate (Sigma–Aldrich) following the manufacturer’s protocol. The image was visualized using the ECL Plus Western Blotting (Syngene) enhanced chemiluminescence detection (Amersham Pharmacia Biosciences) and following indications published by the Bio Imaging System manufacturer.
quantified using the Griess assay kit (Promega) according to the manufacturer’s instructions. 2.5. Chicken splenocyte IFN- mRNA quantification by real-time RT-PCR Total RNA was isolated from the IL-18-treated chicken splenocytes using the total RNA Miniprep kit (Qiagen) and RNA concentrations were measured using the Gene Quant II spectrophotometer (Amersham Pharmacia Biosciences). Extracted RNA was then immediately converted into cDNA using the commercially available reverse transcription (RT) kit as described above (Promega Corp.). The resultant cDNA was used in a real-time PCR assay in order to quantify mRNA levels in pCHIL18-F-, pCHIL18-M- and euCHIL18-treated splenocytes using the Sybr Green Kit (Qiagen Inc.) in the Light Cycler II (Roche Diagnostics, Mannheim, Germany). The PCR products of IFN-␥ and -actin cDNA were amplified by PCR using primers specific for chicken IFN-␥ and -actin (as the internal control gene) (Table 1). The resultant PCR products were visualized using ethidium-bromide staining following electrophoresis on a 2% agarose gel and their sequences were confirmed using the ABI PRISMTM 377 automated DNA sequencer. Amplification by realtime PCR was carried out in a sealed capillary (Roche Diagnostics, Mannheim, Germany), 10 L final reaction volume containing 1 L of Sybr green master mix, 1.2 L MgCl2 (25 mM), 1 L primers, 5.8 L of diethyl pyrocarbonate (DEPC)-water and 1 L of either sample cDNA, plasmid containing a fragment of IFN-␥ or -actin (as a positive control), or distilled water (as a negative control). The PCR reactions were performed using the Light Cycler II and subjected to the following cycling parameters: denaturation for 10 min at 95 ◦ C, amplification for 35 cycles with denaturation at 95 ◦ C for 10 s, annealing at 65 ◦ C for 10 s, extension at 72 ◦ C for 23 s followed by fluorescence acquisition at 65 ◦ C for 15 s. Melting curve analysis of the PCR products was performed after amplification using the conditions suggested in the Sybr green kit manual. Quantification of cytokine mRNA from sample cDNA was calculated using the following formula [22]: 2−Ct =
2Ct IFN-␥ 2Ct -actin
where Ct IFN-␥ = Ct IFN-␥ of the treated cells − Ct IFN-␥ of the untreated cell; Ct -actin = Ct -actin of the treated cells − Ct actin of the untreated cell.
2.4. Bioassays of pCHIL 18-F, pCHIL18-M and euCHIL18
2.6. Vaccination and ND challenge of chickens
A sensitive bioassay based on the inducible release of IFN␥ by splenocytes in response to treatment with recombinant pCHIL18-F, pCHIL18-M or euCHIL18 was performed as described by Puehler et al. [21] with minor modifications. Splenocytes were isolated from three 4-week-old SPF chickens, seeded at a density of 1 × 107 cells/mL in a 24-well plate, treated with 20 L of different doses (0, 25, 50, 125, 250 and 500 ng/mL) of purified pChIL18-F/pChIL18-M, or with 50 L of cell lysates from a CHO stable clone (100 g/mL), or non-transfected CHO cells as a negative control, and incubated in triplicates per individual animal at 41 ◦ C for 18 h. The IFN-␥ mRNA expressions of pre-treated splenocytes were detected using real-time RT-PCR. After cells were treated with three different forms of recombinant chicken IL-18, the splenocyte supernatants were harvested and transferred for culturing chicken macrophages in order to determine the IFN-␥-induced nitric oxide (NO) synthesis by these macrophages. The chicken macrophages (2 × 105 /100 L/well) isolated from three 4-week-old SPF chickens were incubated with the corresponding pre-treated splenocyte supernatants as described above in a 96-well plate at 37 ◦ C/5% CO2 for 24 h. The NO levels in the culture medium of macrophages were
The NDV strong virulent strain (NDV Clone-Sato) grown in the allantoic cavity of chicken embryos was kindly provided by Kaohsiung Biological Product Co. Ltd. and used as the challenge virus at a dose of 104 minimum lethal dose (MLD). The cell-cultured ND inactivated vaccine was a ND-Ishii virus strain propagated in Baby Hamster Kidney (BHK) cells, harvested at 72 h post-infection, and inactivated by treatment with 0.2% formalin. One dose of cell-cultured ND vaccine (NDTC) contained the equivalent of 108 embryo-infectious dose (EID50 ) before inactivation by formalin. A total of 50 white leghorn SPF birds for the challenge experiments were divided randomly into 5 groups (n = 10 per group). They were hatched and reared in isolation, and allowed food and water ad libitum. Birds in Group 1 were immunized with PBS as the controls and those in groups 2–5 were inoculated with NDTC alone, NDTC plus 100 g pCHIL18-F, NDTC plus 100 g pCHIL18-M, and NDTC plus 100 g euCHIL18, respectively. All birds at 4 weeks of age were immunized intramuscularly (i.m.) in the leg in using a final volume of 1 mL/chicken for the primary vaccination and injected with 1 mL/dose/chicken in the right breast muscle (booster immunization) at 3 weeks following the primary immunization. Identical
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
formulations per group were given for the primary and secondary vaccinations. Chickens were challenged with NDV strong virulent strain (NDV Clone-Sato) at a dose of 104 MLD in 1 mL by i.m. injection at 6 weeks following the primary inoculation. Approval for these animal studies was obtained from the Center for Research Animal Care and Use Committee of the National Pingtung University of Science and Technology. Following vaccine administration and challenge, chickens were observed daily for clinical signs and mortality throughout the duration of the experiment. Prior to the challenge, all chickens were bled from the wing vein every week following the primary inoculation for the detection of antibodies to ND by the hemagglutination inhibition (HI) test. Peripheral blood mononuclear cells (PBMC) were isolated, and cell proliferation and percentages of CD4+ and CD8+ cells were determined by the following procedures. 2.7. Hemagglutination inhibition (HI) assay The HI tests were performed using a standard microtiter plate method described in a previously published article [23]. Briefly, each sample of serum in a twofold series dilution was incubated with four Hemagglutinating Unit (HAU) of NDV Ishii strain at room temperature for 30 min. The HAU of NDV Ishii strain was titrated before each assay was performed. After 25 L of 1% chicken erythrocytes were added at room temperature for 45 min, agglutination was monitored and recorded. The geometric mean of serum HI titers obtained from each group was defined as the reciprocal logarithm in a base of 2 of the highest serum dilution completely inhibiting agglutination. 2.8. Cell proliferation assay PBMC were isolated from heparinized peripheral blood using Ficoll-hypaque (Sigma) density sedimentation. The isolated cells were washed twice in Hanks balanced salt solution (HBSS) with Ca2+ /Mg2+ (Mediatech; Herndon, VA, USA) and resuspended in RPMI 1640 (JRH Biosciences) supplemented with 10% FBS, penicillin, streptomycin, l-glutamine, and 25 mM HEPES buffer (RPMI-10%) in a final concentration of 2 × 106 cells/mL. PBMC cell proliferation was evaluated using the commercially available ELISA-BrdU Kit (Roche Molecular Biochemicals). The assay was performed according to the manufacturer’s instruction. Briefly, 50 L/well of the PBMC (4 × 105 cells/well) was pre-treated with or without 1 g/well of Concanavalin A (ConA; Sigma) in triplicate per 96-well plate at 37 ◦ C/5% CO2 incubator for 48 h. Then, 10 L/well BrdU labelling reagent (10 M final concentration) was added. At 12 h, the cells were harvested by centrifugation at 300 × g for 10 min and were fixed in an ethanol solution, followed by incubation with peroxidase-labeled anti-BrdU for 90 min. After removal of the antibody conjugate and three washes, 100 L/well tetramethylbenzidine (TMB) was added and the mixtures incubated until the appropriate color development was achieved (about 10 min). The optical density of each sample (OD370/492 ) was measured at a wavelength of 370 nm with background subtraction at 492 nm using an ELISA plate reader (Thermo, Multiskan Spectrum; Vantaa, Finland), blanked with culture medium alone to account for nonspecific binding. The stimulation index (SI) was calculated by the following equation: SI =
OD370/492 of ConA-treated cells OD370/492 of untreated cells
1151
FITC (clone CT-4) or anti-CD8-PE (clone CT-8) (Beckman Coulter, Inc., USA). The flow cytometer settings were established for linear amplification of light scatter and logarithmic amplification of fluorescence channels. The threshold was defined in forward scatter with FS 100 to exclude cell debris. Flow cytometric analysis of the percentages of positively stained cells was performed using the BD FACScanTM Flow Cytometer (BD Biosciences; San Diego, CA, USA).
2.10. Statistics Raw SI data in response to vaccination by chicken cells were converted to the fold of increment relative to that of the PBS controls in each experimental animal and were used as the indices of detection. Data were analyzed using the general linear model procedures of the SAS (statistical software package) (SAS Institute Inc.; Cary, NC, USA). Differences between each treatment mean and that of PBS controls in the bioassays were analyzed using the Student’s t-test, and Duncan’s multiple range tests were used to compare the differences of means among groups in the vaccination experiment. Significance was determined at p < 0.05.
3. Results 3.1. Cloning and expression of pCHIL18-F, pCHIL18-M and euCHIL18 PCR products of pCHIL18-F, pCHIL18-M and euCHIL18 separated by gel electrophoresis (621, 525 and 621 bp, respectively) is shown in Fig. 1; their sequences were confirmed to be of 100% homology to the chicken IL-18 cDNA sequence published with an accession number of AJ277865. The estimated molecular weights of pCHIL18-F, pCHIL18-M and euCHIL18 were 23.7, 21.8 and 28.7 kDa as revealed by SDS-PAGE (Figs. 2A and 3A, respectively) and confirmed the expressions of the three different forms of recombinant chicken IL-18 fusion proteins. Although the fusion proteins of pCHIL18F and pCHIL18-M were originally present in the inclusion bodies inside the expressing bacteria but not in the culture medium, soluble forms of these two recombinant proteins were obtained after denaturing in a 6 M urea solution and followed by a procedure of dialysis in 20 mM Tris buffer in a cold room for 12 h. Each of the single bands of purified pCHIL18-F/pCHIL18-M and euCHIL18 in cell lysates obtained from stable clones of CHO cells were present on the Western blotting membrane (Figs. 2B and 3B, respectively). Recombinant euCHIL18 was harvested from the cell lysates rather than from the culture medium of two stable expressing clones of CHO cells (Fig. 3B). Thus, the immunoblotting analysis confirmed the presence of fusion proteins pCHIL18-F, pCHIL18-M and euCHIL18.
.
2.9. Flow cytometric analysis Two aliquots of PBMC (each of 2 × 105 cells/100 L) were stained with the fluorescently labeled monoclonal antibodies anti-CD4-
Fig. 1. Gel electrophoresis of chicken IL-18 PCR products. PCR products of fulllength or mature chicken IL-18 for E. coli expression (pCHIL18-F and pCHIL18-M, respectively) (Lanes 1 and 2) and chicken IL-18 for Chinese hamster ovary (CHO) cell expression (euCHIL18) (Lane3) were subject to electrophoresis on a 2% agarose gel. Lane M: a marker with 100 bp intervals.
1152
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
Fig. 4. IFN-␥ mRNA relative expression in splenocytes stimulated with recombinant chicken IL-18. Splenocytes (1 × 107 cells/mL) isolated from (SPF) chickens at the age of 5 weeks were cultured with 20 L of different concentrations (0, 25, 50, 125, 250 and 500 ng/mL) of pCHIL18-F or pCHIL18-M (A) and 100 g/mL of euCHIL18 in conditioned medium of a CHO stable clone (B) at 41 ◦ C/5% CO2 incubator for 18 h in triplicate. Chicken splenocytes cultured with the conditioned medium collected from the non-transfected CHO cells were used as the control group in (B). Data are presented as mean ± SEM for cells isolated from 3 individual animals. The letters a, b, c and x, y, z indicate that means are considered significantly different (p < 0.05) among groups treated with pCHIL18-F or pCHIL18-M, respectively. The symbol “*” indicates that means are significantly different from those of controls at p < 0.05. Fig. 2. SDS-PAGE and immunoblotting of the recombinant chicken IL-18 proteins for E. coli expression (pCHIL18-F and pCHIL18-M, respectively). The recombinant fusion proteins of pCHIL18-F and pCHIL18-M purified using an affinity column were analyzed in 15% SDS-PAGE electrophoresis (A) and immunoblot analysis (B). Lane M: pre-stained protein marker; Lane p1: purified pCHIL18-F; Lane p2: purified pCHIL18-M.
3.2. Bioassays of pCHIL18-F, pCHIL18-M and euCHIL18
Fig. 3. SDS-PAGE and immunoblotting analysis of the CHO cell-expressed chicken IL-18 (euCHIL18). The recombinant fusion proteins of euCHIL18 were analyzed in 15% SDS-PAGE electrophoresis (A) and immunoblot analysis (B). Lane M: pre-stained protein marker; Lane e1: culture medium, CHO cells without transfection of the euCHIL18 expression vector; Lanes e2 and e3: culture medium, CHO cells with transfection of the euCHIL18 expression vector; Lane e4: cell homogenate of CHO cells without transfection of the euCHIL18 expression vector; Lanes e5 and e6: cell homogenates of two different stable clones of CHO cells expressing euCHIL18.
3.3. Vaccination and ND challenge of chickens
The IFN-␥ mRNA levels in splenocytes were significantly enhanced by stimulation with pCHIL18-F and pCHIL18-M, and peak levels of IFN-␥ mRNA were achieved at the dose of 50 ng/mL pCHIL18-F and 250 ng/mL pCHIL18-M; levels declined as the doses increased thereafter (Fig. 4A). Significantly elevated IFN␥ mRNA expression by splenocytes in response to stimulation with euCHIL18 present in cell lysates of stable clones of CHO cells compared to those treated with CHO cell lysates following transfection with euCHIL18 expression plasmids were also observed (Fig. 4B). The IFN-␥-induced NO production by macrophages was significantly enhanced when cells were cultured with splenocyte supernatants following pre-treatment of at least 25 and 50 ng/mL of pCHIL18-F and pCHIL18-M, respectively, and reached maximal levels following 125 and 500 ng/mL pre-treatment doses, respectively. (Fig. 5A). Supernatants from chicken splenocytes stimulated with increasing amounts of pCHIL18-F or pCHIL18-M (25, 50, 125, 250, and 500 ng/mL) induced dose-dependent NO production by macrophages which did not decline thereafter. Significantly elevated IFN-␥-induced NO production by macrophages was also observed in those cultured with euCHIL18 pre-treated splenocyte supernatants (Fig. 5B). Incubation with untreated splenocyte supernatants did not induce any increased NO release by macrophages. Thus, increased IFN-␥ expression in chicken splenocytes and IFN-␥induced NO production by macrophages confirmed the biological activities of pCHIL18-F, pCHIL18-M and euCHIL 18.
The titer of HI antibodies were slightly increased at 1-week post-primary inoculation and increases continued from the 2 week
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
Fig. 5. IFN-␥-induced nitric oxide (NO) synthesis by macrophages. Chicken macrophages (2 × 105 /100 L/well) isolated from SPF chickens at the age of 5 weeks were cultured with the medium collected from splenocyte-culturing supernatants pre-treated with pCHIL18-F, pCHIL18-M (A) or euCHIL-18 (B) at 41 ◦ C/5% CO2 incubator for 24 h in triplicate. Data are presented as mean ± SEM for cells isolated from three individual animals. The letters a, b, c and x, y, z indicate that means are considered significantly different (p < 0.05) among groups treated with pCHIL18F or pCHIL18-M, respectively. The symbol “*” indicates that means are significantly different from those of controls at p < 0.05.
post-primary inoculation point except in the PBS controls, in which HI titers remained undetectable throughout the period of the vaccination experiment (Fig. 6). Chickens in Groups 3, 4 and 5 immunized with the ND vaccine formulated with pCHIL18-F, pCHIL18-M or euCHIL18 had significantly higher titers than those in the PBS controls and group 2 (vaccination with NDTC alone) (Fig. 6).
1153
Fig. 7. Cell proliferation and CD8+ /CD4+ ratio of chickens. Peripheral blood mononuclear cells (PBMC) (2 × 106 cells/mL) were isolated from the immunized chickens at 6 weeks post-primary inoculation. (A) The stimulation index (SI) of cell proliferation was calculated using the following equation: SI = OD370/492 of ConA-treated cells/OD370/492 of untreated cells. (B) CD8+ /CD4+ ratios were calculated from the number of cells labeled with the fluorescent monoclonal antibodies of anti-CD8 or anti-CD4 analyzed using a flow cytometer. N = 10 in each group. The letters a and b indicate that means are considered significantly different (p < 0.05) among treatment groups.
Chickens of the NDTC-CHIL18-F group had the highest HI titers of the five groups throughout all experimental time points starting at 2nd week post-primary inoculation (p < 0.05). A significantly elevated rate of PBMC cell proliferation in animals vaccinated with pCHIL18-F, pCHIL18-M or euCHIL18 as an adjuvant (presented as SI in Fig. 7A) compared to the PBMC proliferation rate of animals inoculated with PBS or NDTC alone was observed (p < 0.05), and the highest SI was found in PBMC isolated from animals inoculated with NDTC plus pCHIL18-F and NDTC plus pCHIL18-M (Fig. 7A). The ratios of CD8+ /CD4+ in chickens vaccinated with the NDTC vaccine co-administrated with pCHIL18-F or pCHIL18-M were significantly higher than those animals inoculated with PBS, NDTC alone or NDTC plus euCHIL18 (Fig. 7B). Moreover, results regarding the protective efficacy of immunization showed that two chickens in the group receiving NDTC alone exhibited the neuro-pathological syndromes with clinical signs of depression, distress, ruffled feathers, anorexia, diarrhea, trembling, and died 3–5 days after the challenge, whereas a 100% Table 2 The protective efficacy against a virulent NDV in vaccinated chickens.
Fig. 6. The hemagglutinin inhibition (HI) titers in chickens vaccinated with chicken Newcastle disease-cell-cultured vaccine (NDTC) with or without co-administration of pCHIL18-F, pCHIL18-M or euCHIL18 as an adjuvant. SPF chickens were randomized and divided into five groups: Group 1 was inoculated with PBS as a negative control, and the other groups vaccinated with NDTC only, NDTC co-administrated with 100 g/each of either CHIL18-F, pCHIL18-M or euCHIL18, respectively. All chickens were boost-inoculated at 3 weeks post-primary inoculation. The NDspecific HI titers were measured at 1-week intervals post-primary inoculation. N = 10 in each group. The letters a, b, c, and d indicate that means are considered significantly different (p < 0.05) among treatment groups bled at the same time point.
Vaccination Groupa
Morbidityb
Mortalityc
Protection rated
PBS NDTC NDTC-pCHIL18-F NDTC-pCHIL18-M NDTC-euCHIL18
10/10 (100%) 2/10 (20%) 0/10 (0%) 0/10 (0%) 0/10 (0%)
10/10 (100%) 2/10 (20%) 0/10 (0%) 0/10 (0%) 0/10 (0%)
0% 80% 100% 100% 100%
a Chickens were challenged with a virulent NDV (Sato stain) at 6 weeks postprimary vaccination. b The number of chickens with clinical signs/total number of chickens in each group (percentage in parentheses). c The number of dead chickens/total number of chickens in each group. d Percentage of protection rate at 2 weeks post-challenge.
1154
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155
protective rate was achieved in those immunized with NDTC plus pCHIL 18-F, pCHIL 18-M or euCHIL18 (Table 2).
4. Discussion Previous reports demonstrated that caspase-1 cleavage facilitates the secretion of mature IL-18 from the cytosol across the cell membrane [24,25], and only the mature IL-18 rather than the full length IL-18 is biologically active in mammals [14,15]. In the chicken, recombinant mature chicken IL-18 also can induce IFN␥ synthesis in vitro [16] and it significantly enhances antibody responses to C. perfringens ␣-toxoid and Newcastle disease virus (NDV) antigens in vivo [18]. However, one recent report has demonstrated that both full length and mature chicken IL-18 recombinant proteins can be expressed in chicken splenic lymphocytes 24 h after transfection with their eukaryotic expression plasmids, and both recombinant proteins are biologically active for inducing NO secretion [26]. In the present study, prokaryotic expressions of either pCHIL18-F or pCHIL18-M recombinant proteins significantly induced IFN-␥ mRNA expression as well as and to the same extent as did the euCHIL-18 recombinant protein expressed in the eukaryotic system. In addition, chickens immunized with ND vaccine formulated with pCHIL18-F exhibited significantly higher HI titers than those in the PBS control group and those vaccinated with NDTC alone or NDTC formulated with pCHIL18-M or euCHIL18. Moreover, maximum IFN-␥ mRNA expressions in splenocytes were achieved with dosages of 50 ng/mL pCHIL18-F and 250 ng/mL pCHIL18-M demonstrates that pCHIL18-F exhibits comparable, if not greater in vitro activities than does mature chicken IL-18. Caspase-1 digestion may not be necessary for the immunostimulatory function of chicken IL-18, and thus, full length chicken IL-18 may act as a biological molecule instead of just an inactive precursor. The available bioassay for chicken IL-18 employs freshly isolated chicken spleen cells which respond to IL-18 by secreting IFN-␥ which can be measured by standard techniques [16]; however, an alternative sensitive bioassay for cells with low or undetectable levels of IFN-␥ secretion that would synthesize NO in response to IL-18-mediated induction of IFN-␥ secretion has been established [21]. It has been confirmed that IFN-␥-mediated upregulation of the inducible NO synthase gene expression in chicken macrophages as a function of nitrite accumulation in the culture medium can be effectively measured using the Griess assay [27,28]. Both prokaryotic and eukaryotic cell-expressed chicken IL-18 significantly stimulated IFN-␥-induced NO production by chicken macrophages in the present study; a concurring result regarding increased NO production by HD-11 cells treated with supernatants harvested from cultured B19-2D8 cells pre-treated with prokaryotic cell-expressed mature chicken IL-18 has been reported [21]. However, our results showed that the increments of NO release by macrophages are not linearly correlated with IFN-␥ mRNA levels in splenocytes. These results indicate that pCHIL18-F and pCHIL18-M regulate IFN-␥ at the transcription level in splenocytes, which is not necessarily correlated to its release in culture media by these cells. The significance of full length IL-18 conversion into mature IL-18 in the chicken still remains somewhat ambiguous; more research investigating the underlying regulation mechanisms of chicken IL18 is clearly still warranted. The plasmid encoding IL-18 or expressed recombinant IL-18 has been used as an adjuvant in mammalian vaccines to enhance Th1 immune responses [29], which may in turn enhance an antigenspecific Th1 type response which consequently promotes high antibody titers [30,31]. Recombinant chicken IL-18 has also been shown to significantly enhance antibody responses to C. perfringens ␣-toxoid and NDV antigens [18]. Consistent results on higher HI titers against ND antigen in chickens immunized with NDTC co-
administrated with pCHIL18-F, pCHIL18-M or euCHIL18 than those vaccinated with PBS or NDTC alone were achieved, further confirming the immunostimulatory activities of chicken IL-18 in vivo. In addition, the highest SI in PBMC isolated from those in groups of NDTC plus pCHIL18-F and NDTC plus pCHIL18-M indicate that the biological activities of purified prokaryotic cell-expressed chicken IL-18 in stimulating immunity might be equivalent to the eukaryotic cell-expressed chicken IL-18 in vivo. In conclusion, the prokaryotic cell- or eukaryotic cell-expressed recombinant chicken IL-18 not only induced IFN-␥ secretion in vitro but it also stimulated higher HI titers and cell proliferation of PBMC in animals vaccinated with pCHIL18-F, pCHIL18-M or euCHIL18, and it also elicited a 100% protective effect when they were used as an adjuvant in NDTC vaccines. These results confirm that chicken IL18 recombinant proteins exert in vivo biological functions through stimulating humoral and cell-mediated immunities in order to enhance the antigen-specific immunity and vaccine efficacy, which likely is suggestive of a more feasible and effective vaccine strategy in developing a new generation of avian vaccines. Acknowledgments This work was supported by research grants (96AS-14.6.1-BQB6, 97AS-14.6.1-BQ-B6 and 98AS-14.6.1-BQ-B5) from the Council of Agriculture in Taiwan. The authors also wish to thank Katherine Carey for her grammatical input and editing work on this paper. Conflict of interest statement: All authors have no financial and personal relationships with other people or organizations that could inappropriately influence (bias) their work. References [1] Okamura H, Tsutsui H, Komatsu T, Yutsudo M, Haruka A, Tanimoto T, et al. Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature 1995;378(6552):88–91. [2] Akira S. The role of IL-18 in innate immunity. Curr Opin Immunol 2000;12(1):59–63. [3] Cumberbatch M, Dearman RJ, Antonopoulos C, Groves RW, Kimber I. Interleukin (IL)-18 induces Langerhans cell migration by a tumour necrosis factor-alphaand IL-1beta-dependent mechanism. Immunology 2001;102(3):323–30. [4] Marshall DJ, Rudnick KA, McCarthy SG, Mateo LR, Harris MC, McCauley C, et al. Interleukin-18 enhances Th1 immunity and tumor protection of a DNA vaccine. Vaccine 2006;24(3):244–53. [5] Eberl M, Beck E, Coulson PS, Okamura H, Wilson RA, Mountford AP. IL18 potentiates the adjuvant properties of IL-12 in the induction of a strong Th1 type immune response against a recombinant antigen. Vaccine 2000;18(19):2002–8. [6] Hanlon L, Argyle D, Bain D, Nicolson L, Dunham S, Golder MC, et al. Feline leukemia virus DNA vaccine efficacy is enhanced by coadministration with interleukin-12 (IL-12) and IL-18 expression vectors. J Virol 2001;75(18):8424–33. [7] Dunham SP, Flynn JN, Rigby MA, Macdonald J, Bruce J, Cannon C, et al. Protection against feline immunodeficiency virus using replication defective proviral DNA vaccines with feline interleukin-12 and -18. Vaccine 2002;20(11–12):1483–96. [8] Kim JJ, Nottingham LK, Tsai A, Lee DJ, Maguire HC, Oh J, et al. Antigen-specific humoral and cellular immune responses can be modulated in rhesus macaques through the use of IFN-gamma, IL-12, or IL-18 gene adjuvants. J Med Primatol 1999;28(4–5):214–23. [9] Daniel W, Elisenda A, Annette M, Christian M, Heiner V, Mathias B, et al. Immunomodulatory effect of plasmids co-expressing cytokines in classical swine fever virus subunit gp55/E2-DNA vaccination. Vet Res 2005;36(4):571–87. [10] Yoon HA, Aleyas AG, George JA, Park SO, Han YW, Lee JH, et al. Modulation of immune responses induced by DNA vaccine expressing glycoprotein B of Pseudorabies Virus via coadministration of IFN-gamma-associated cytokines. J Interferon Cytokine Res 2006;26(10):730–8. [11] Shen G, Jin N, Ma M, Jin K, Zheng M, Zhuang T, et al. Immune responses of pigs inoculated with a recombinant fowlpox virus coexpressing GP5/GP3 of porcine reproductive and respiratory syndrome virus and swine IL-18. Vaccine 2007;25(21):4193–202. [12] Mingxiao M, Ningyi J, Juan LH, Min Z, Guoshun S, Guangze Z, et al. Immunogenicity of plasmids encoding P12A and 3C of FMDV and swine IL-18. Antiviral Res 2007;76(1):59–67. [13] Ma M, Jin N, Shen G, Zhu G, Liu HJ, Zheng M, et al. Immune responses of swine inoculated with a recombinant fowlpox virus co-expressing P12A and 3C of FMDV and swine IL-18. Vet Immunol Immunopathol 2008;121(1–2):1–7.
L.-H. Hung et al. / Vaccine 28 (2010) 1148–1155 [14] Liu B, Novick D, Kim SH, Rubinstein M. Production of a biologically active human interleukin 18 requires its prior synthesis as PRO-IL-18. Cytokine 2000;12(10):1519–25. [15] Ghayur T, Banerjee S, Hugunin M, Butler D, Herzog L, Carter A, et al. Caspase-1 processes IFN-gamma-inducing factor and regulates LPS-induced IFN-gamma production. Nature 1997;386(6625):619–23. [16] Schneider K, Puehler F, Baeuerle D, Elvers S, Staeheli P, Kaspers B, et al. cDNA cloning of biologically active chicken interleukin-18. J Interferon Cytokine Res 2000;20(10):879–83. [17] Göbel TW, Schneider K, Schaerer B, Mejri I, Puehler F, Weigend S, et al. IL18 stimulates the proliferation and IFN-gamma release of CD4+ T cells in the chicken: conservation of a Th1-like system in a nonmammalian species. J Immunol 2003;171(4):1809–15. [18] Degen WG, van Zuilekom HI, Scholtes NC, van Daal N, Schijns VE. Potentiation of humoral immune responses to vaccine antigens by recombinant chicken IL-18 (rChIL-18). Vaccine 2005;23(33):4212–8. [19] Mingxiao M, Ningyi J, Zhenguo W, Ruilin W, Dongliang F, Min Z, et al. Construction and immunogenicity of recombinant fowlpox vaccines coexpressing HA of AIV H5N1 and chicken IL18. Vaccine 2006;24(20):4304–11. [20] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227(5259):680–5. [21] Puehler F, Gobel T, Breyer U, Ohnemus A, Staeheli P, Kaspers B. A sensitive bioassay for chicken interleukin-18 based on the inducible release of preformed interferon-gamma. J Immunol Methods 2003;274(1–2):229–32. [22] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29(9):e45–50. [23] Vardaman TH, Deaton JW, Feece FN. Serological responses of broiler-type chickens, with and without Newcastle disease and infectious Bronchitis vaccine,
[24]
[25] [26]
[27]
[28]
[29]
[30]
[31]
1155
to experimental infection with Mycoplasma synoviae by foot pad, air sac and aerosol. Poult Sci 1975;54(3):737–41. Gu Y, Kuida K, Tsutsui H, Ku G, Hsiao K, Fleming MA, et al. Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme. Science 1997;275(5297):206–9. Fantuzzi G, Dinarello CA. Interleukin-18 and interleukin-1 beta: two cytokine substrates for ICE (caspase-1). J Clin Immunol 1999;19(1):1–11. Xu J, Deng TL, Li L, You ZQ, Wan WJ, Yu L. Nitric oxide inducing function and intracellular movement of chicken interleukin-18 in cultured cells. Acta Biochim Biophys Sin (Shanghai) 2005;37(10):688–93. Ding AH, Nathan CF, Stuehr DJ. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J Immunol 1988;141(7):2407–12. Stuehr DJ, Nathan CF. Nitric oxide. A macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. J Exp Med 1989;169(5):1543–55. Billaut MO, Idziorek T, Ban E, Kremer L, Dupre L, Loyens M, et al. Interleukin-18 modulates immune responses induced by HIV-1 Nef DNA prime/protein boost vaccine. Vaccine 2000;19(1):95–102. Nakano H, Tsutsui H, Terada M, Yasuda K, Matsui K, Yumikura FS, et al. Persistent secretion of IL-18 in the skin contributes to IgE response in mice. Int Immunol 2003;15(5):611–21. Pollock KG, Conacher M, Wei XQ, Alexander J, Brewer JM. Interleukin-18 plays a role in both the alum-induced T helper 2 response and the T helper 1 response induced by alum-adsorbed interleukin-12. Immunology 2003;108(2): 137–43.