Administration of lipopolysaccharide increases specific and non-specific immune parameters and survival in carp (Cyprinus carpio) infected with Aeromonas hydrophila

Aquaculture 286 (2009) 176–183

Contents lists available at ScienceDirect

Aquaculture j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / a q u a - o n l i n e

Administration of lipopolysaccharide increases specific and non-specific immune parameters and survival in carp (Cyprinus carpio) infected with Aeromonas hydrophila V. Selvaraj a, K. Sampath b, Vaithilingam Sekar c,⁎ a b c

Operon Biotech, Research and Development, First Floor, TICEL Bio Park, Taramani Road, Taramani, Chennai 600 113, India Department of Zoology, V.O.C College, Tuticorin 628 008, India 2901 Wessex Drive, Ames, IA 50014, USA

a r t i c l e

i n f o

Article history: Received 26 December 2007 Received in revised form 17 September 2008 Accepted 18 September 2008 Keywords: Macrophage LPS Phagocytosis Opsonin NBT Assay Complement Antibody Interleukin1β mRNA

a b s t r a c t Relative percent survival (RPS) and immunomodulating effect of lipopolysaccharide (LPS) were studied in Cyprinus carpio against the bacterial pathogen, Aeromonas hydrophila. A virulent strain of A. hydrophila was isolated from previously infected fish. LPS was extracted from the virulent A. hydrophila and characterized by SDS-PAGE analysis. Different concentrations of LPS (10, 50 and 100 µg/fish, 15, 75 and 150 µg ml− 1, 0.1, 0.25 and 0.5%) were administered to test animals on days 1, 7 and 14 through intraperitoneal injection (i.p.), bathing and oral routes, respectively. Control and test animals were challenged with LD50 concentration of A. hydrophila by i.p. on day 16, mortality determined and RPS calculated. Intraperitoneal injection of 50 and 100 µg of LPS/fish and 150 µg of LPS ml− 1 through bathing significantly enhanced the RPS; oral administration did not influence the RPS rate. Test animals injected with 100 µg of LPS showed significant increase in total leucocyte count and an increase in the population of monocytes and neutrophils. Superoxide anion production by kidney macrophages and secondary immune response against A. hydrophila following vaccination were also elevated. RT-PCR and northern blot analysis of interleukin-1 mRNA showed elevated expression in kidney macrophages on day 16 in fish injected with 50 and 100 µg of LPS/fish, which presumably aided efficient killing of the bacterial pathogen. However, oral administration of LPS did not protect the animals from A. hydophila infection. Classical and alternative complement pathways were not affected by LPS administration by any of the three routes. LPS administration through injection and bathing effectively stimulates the non-specific cellular as well as secondary immune response and offers protection against A. hydrophila infection in carps. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Fish diseases can be controlled by administration of chemotherapeutics, vaccines and immunostimulants. There are at least 20 different compounds, which have potential use as immunostimulants, adjuvants and vaccine carriers in fish (Anderson, 1992). Non-specific defense (NSD) mechanism includes lysozyme, trypsin, complement factors, granulocytes and monocytes/macrophages in fish play an important role at all stages in infection (Dalmo et al., 1997). Nonspecific defense of fish can be up regulated by administration of various natural or synthetic immunostimulants. Several lines of evidence suggest that the NSD has evolved towards recognition of structurally conserved microbial polymers like yeast cell wall glucan, bacterial lipopolysaccharide (LPS), peptidoglycan, bacterial DNA and viral double standard RNA (Robertsen, 1999). LPS is derived from gramnegative bacteria and it consists of lipid A, core polysaccharide and

⁎ Corresponding author. E-mail address: [email protected] (V. Sekar). 0044-8486/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2008.09.017

O-specific chain. The lipid A portion of an LPS is known as an endotoxin and also is responsible for most of immunomodulatory effect of LPS (Robertsen, 1999). The O-specific chain is responsible for recognition of bacterial strains by specific immune response and has been used frequently as a protective antigen against different pathogens in several fish species such as channel catfish Clarias gariepinus, eels Anguilla japonica, trout Scophthalmus maximus, Atlantic salmon Salmo salar and carp Cyprinus carpio (Saeed and Plumb, 1986; Salati et al., 1987; Al-Harbi and Austin, 1992; Bøgwald et al., 1992; Kozinska and Guz, 2004). Limited information is available to demonstrate in vivo use of LPS in fish as an agent to enhance the non-specific resistance against bacterial pathogens in addition to specific resistance. Kozinska and Guz (2004) have described the stimulatory effect LPS on total leucocyte count and differential blood cell count in carp. Non-specific cellular defense mechanisms including bacterial killing activity and the induction of superoxide anion of macrophages has been demonstrated in rainbow trout and carp after stimulation with LPS in vitro (Solem et al., 1995; Dalmo and Seljelid, 1995; Novoa et al., 1996). Interleukin1, a cytokine mediator, is shown to be produced by macrophages of channel catfish in response to in vitro stimulation with LPS

V. Selvaraj et al. / Aquaculture 286 (2009) 176–183

(Clem et al., 1985). Administration of LPS is found to induce the expression of interleukin1β gene in rainbow trout and carp (Zou et al., 2000; Engelsma et al., 2001) and is also shown to accelerate the specific immune response (Ingram and Alexander, 1980; Saeed and Plumb, 1986; Salati et al., 1987; Baba et al., 1988; Al-Harbi and Austin, 1992; Guttvik et al., 2002). In previous studies, LPS extracted from various bacterial species has been used without sufficient characterization (Salati et al., 1987; Baba et al., 1988; Al-Harbi and Austin, 1992 Kawakami et al., 1997; Guttvik et al., 2002; Kozinska and Guz, 2004). The primary route of administration in these studies has been by i.p. injection (Ingram and Alexander, 1980; Saeed and Plumb, 1986; Salati et al., 1987; Nakhla et al., 1997; Kozinska and Guz, 2004) although some have used bathing (Baba et al., 1988; Al-Harbi and Austin, 1992) and oral incubation (Al-Harbi and Austin, 1992; Guttvik et al., 2002). Surprisingly, while no studies have been published that demonstrate the ability of highly purified preparations of LPS to enhance the non-specific resistance (against bacterial infection) in fish, LPS has frequently been used in studies of specific immune response in fish (Robertsen, 1999). Hence, we felt it was desirable to investigate immostimulatory effect of characterized LPS on non-specific as well as specific disease resistance by intraperitoneal injection, bathing and oral routes. We also attempted to determine the effective route and dosage under controlled laboratory conditions and to assess the impact of LPS administration on relative percent survival (RPS) of carp C. carpio challenged with the pathogen, A. hydrophila. In the present study, the RPS was correlated with hematological studies and with functional assays such as bacterial killing, superoxide anion production, complement (classical and alternative pathway) activity, secondary immune response against A. hydrophila LPS and the levels of expression of interleukin1β mRNA. 2. Materials and methods 2.1. Animals Common carp, C. carpio were purchased from Manimutharu dam, Manimutharu and transported to the laboratory in well-aerated plastic bags. The animals were kept in well water fiberglass aerated tank under the natural conditions of light and temperature for 15 days prior to the start of experiments. The weight of the animals ranged between 25 and 30 g. The experiments were carried out in glass tanks with 250 l capacity. Fresh, non-chlorinated, tap water was changed on alternate days and used for the static experiments. The water temperature in the fish holding tank was not controlled and had a mean ambient temperature of 30 ± 2 °C. The fish were fed with lab made pelleted diet containing 35% crude protein. 2.2. Pathogen Ten infected fish were collected from fish farm at Manimutharu dam, Manimutharu, Tirunelveli District, Tamilnadu, and South India. They were found with characteristic signs of dropsy in the abdomen, blisters and abscesses. All the 10 infected fish were used for pathogen isolation according to Shome and Shome (1999), by taking swabs from gills, liver, heart, kidney and abdominal cavity and streaked unto tryptone soya agar and the plates were incubated at 37 °C for 24 h. Cream colored, mucoid, round, elevated colonies were observed predominantly and were picked out for further biochemical characterization. The present isolates were all identified as A. hydrophila by comparison to known biochemical characteristics of A. hydrophila according to Bergey's Manual of Bacteriology (1994). One of the characterized isolates, designated as A. hydrophilaVS1 was used in all further studies. To fulfill Koch postulate pathogenecity test was conducted by intraperitoneal injection of 0.1 ml of live A. hydrophilaVS1 at a concentration of 2.11 × 107 cfu ml− 1 into 20 carps (size 25 to 30 g) at

177

room temperature using PBS as control. Clinical signs consistent with those described for this disease were observed two days post injection. To determine the LD50 concentration of the pathogen, the bacterium was cultured in the laboratory in Luria–Bertani broth (LB) at 32 °C for 24 h and the cells were separated by centrifugation at 8000 ×g and were used to determine LD50 according to the method of Saeed and Plumb (1986). Acclimated (15 days) experimental animals were divided into 5 groups. Each group contained duplicate sets of 2 × 10 animals. Different concentrations of pathogen in 0.1 ml of PBS were administered intraperitoneally to animals in each group and mortality was observed for 72 h. The bacterial count in each concentration was determined by pour plate method. 2.3. LPS preparation A. hydrophilaVS1 was inoculated into 250 ml of LB broth and incubated for 24 h at 30 °C on a shaker at 250 rpm. The culture was harvested by centrifugation at 8000 ×g for 10 min at 4 °C and the cells were used for the extraction of LPS according to Westphal and Jann (1969) and Kido et al. (1990). LPS was electrophoretically analyzed to test the presence of LPS, form of LPS— whether it is R or S form by subjecting to SDS-PAGE following the method of Laemmli (1970). A 4% stacking gel and a 12.5% separating gel was used. Tris– glycine buffer that consisted of Tris 0.025M ([pH 8.3), glycine 0.192M and SDS 0.1% was used as electrode buffer. The electrophoresis was carried out using Mini Protean II apparatus (Hoefer, USA). LPS (10 μl) sample was mixed with an equal volume of loading buffer which consisted of 0.1 M Tris–HCl (pH7.0), 4% SDS, 40% (W/V) sucrose, 2% (V/V) mercaptoethanol and 0.02% bromophenol blue. The mixture was heated at 100 °C for 5 min and was loaded into a sample well. Electrophoresis was performed at 100 V until the dye front reached the bottom of the gel. Subsequently, the gel was removed and cut into two sections. One was used for silver staining (Tsai and Frasch, 1982; Lee and Ellis, 1989) to investigate the presence of O-side chain and the other was used for silver staining following the method of Merril et al. (1984) to assess protein contamination. The presence of endotoxin was determined using commercial endotoxin detection kit (Cambrics, Walkersville, USA) according to the supplier's instruction. Protein concentration in the LPS extract was determined following method of Bradford (1976). The LPS was suspended in phosphate buffered saline (pH 7.2) and frozen at −20 °C until use. 2.4. Experimental design The experimental design consisted of 3 doses of LPS (10, 50 and 100 µg/fish; 15, 75 and 150 µg ml− 1 and 0.1, 0.25 and 0.5% for injection, bathing and oral administration, respectively), 3 days, and 3 routes of administration (i.p. injection, bathing and oral). Acclimated (for 15 days) carp were taken from the stock and four different groups were established corresponding to 4 different treatments. Among the 4 groups, 3 groups were used for administration of experimental compounds and fourth group was used for control. Each group comprised 2 tanks of 24 fish for each concentration and each mode of administration. Each experiment was conducted in duplicate. 1. Fish were i.p. injected with 10, 50 and 100 µg LPS/fish on days 1, 7 and 14. Control group received 0.1 ml of PBS on the same schedule. 2. Fish were bath immunostimulated in well-aerated, LPS solutioncontaining tank for 90 min at the concentrations of 15, 75 and 150 µg ml− 1 on days 1, 7 and 14. Control fish were immersed in chlorine treated tap water on the same schedule. 3. Fish received 1% of (body weight of animal) LPS containing pellet feed at the concentration of 1 mg, 2.5 mg and 5 mg of LPS twice a day on days 1, 7 and 14; during the rest of treatment periods the

178

V. Selvaraj et al. / Aquaculture 286 (2009) 176–183

animals received normal pelleted diet. Control animals received pellet feed without the test compound. 2.5. Challenge study All the 24 replicate test and 24 control fish from each concentration of each group were challenged with 0.1 ml of LD50 concentration of A. hydrophilaVS1 on day 16 by i.p. injection and mortality was recorded for 14 days and RPS was calculated by following the method of Amend (1981). 2.6. Functional assays Prior to dissection, the carp were anaesthetized in 0.3 g/l tricain methane sulfonate buffered with 0.6 g/l sodium bicarbonate. Blood and kidney was sampled from LPS treated and control groups as described below: 1. Blood was sampled for hematology and complement assay on day 16 (6 animals of each group) 2. Kidney was sampled for bacterial killing and NBT assay on day 16 (6 animals of each group) 3. Kidney was sampled for IL-1β mRNA assay on days 15 and 16 (6 animals of each group) 4. Blood was sampled on day 33 and serum was separated and used for antibody determination (6 animals of each group). 2.6.1. Hematology Total leucocyte count (TLC) and differential count. Total leucocytes counts were determined from 6 animals of each group in a Neubauer counting chamber. Blood smears were stained from 6 animals of each group with May-Grunwald/Giemsa and 100 leucocytes were counted under the microscope and the percentage of different types of leucocytes was calculated following the method of Schaperclaus et al. (1991). 2.6.2. Macrophages isolation Macrophages were isolated from kidney as described by BraunNesje et al. (1981). The kidney of the fish was dissected out and transferred to 7 ml of L-15 medium supplemented with 10% foetal calf serum (FCS). A cell suspension was prepared by pressing the kidney with a glass rod through a stainless steel mesh (diameter 0.3 mm) in a plastic petri dish on ice. Cells were suspended in cell maintaining medium L-15 (HI Media, India) containing 0.33 mg ml− 1 glucose, 100 IU ml− 1 penicillin–streptomycin and 10% FCS. The medium was adjusted to pH 7.6, sterilized by syringe filtration and was supplemented with 10 IU ml− 1 heparin (sterile). Cell suspensions were loaded onto a discontinuous (densities 1.08 and 1.07 g ml− 1) Percoll gradient (Sigma) and centrifuged for 40 min at 400 ×g at 4 °C (Hitachi). The cell lying in the d = 1.06 and d = 1.07 interface were collected. After washing the cell with pure medium, cell viability was examined with trypan blue (0.5%) exclusion and was evaluated to be greater than 90%. The number of cells was adjusted to 1 × 106 cells ml− 1. 2.6.3. Bacterial killing assay This experiment was performed according to Chen and Ainsworth (1992). Approximately 1 × 107 cfu ml− 1 of A. hydrophila was used as a stock. From this, 0.1 ml was taken and mixed with 0.1 ml of macrophage suspension (1 × 106 cell ml− 1) and 0.04 ml of pooled fresh heat inactivated carp serum collected from 10 animals was added, mixed well and incubated for 2 h with occasional shaking in a water bath at 27 °C. After 2 h, 0.1 ml of the bacteria–macrophage mixture was diluted with 9.9 ml of sterile distilled water to release living bacteria from phagocytes. This was serially diluted, plated on LB agar plates, incubated overnight at 37 °C and the number of colonies counted.

2.6.4. Respiratory burst activity This experiment was performed as described by Chung and Secombes, (1988) and Dalmo et al. (1996). Briefly, from the macrophage suspension (~ 1 × 106 cells ml− 1 in L-15 medium), 100 μl was placed into a 96 well micro titer polystyrene plate and allowed to adhere for 2 h at 27 °C. Non-adhered cells were removed by three washes with 100 μl/well of L-15 culture medium supplemented with 10% FCS. To the macrophage monolayer, 100 μl/well of NBT solution (1 mg ml− 1 L-15, 10% FCS) containing serum opsonized Zymosan A (Sigma) at 500 µg ml− 1 was added. After 30 min incubation at 12 °C, the medium was removed and the culture was washed twice with isotonic PBS, fixed with 100 μl/well of 100% methanol for 3 min, washed twice with 70% methanol and the cells were air dried. Formazan was solubilized in 120 μl of KOH (2 M) and 120 μl of dimethyl sulfoxide (DMSO) and the absorbance was read spectrophotometrically (Hitachi) at 620 nm using KOH/DMSO as blank. 2.6.5. RNA extraction and reverse transcription The RNA was prepared from the macrophages of six animals of each group by gradient centrifugation and washed twice with PBS at 400 ×g at 4 °C for 5 min; the macrophages pellet containing (~ 1 × 106 cells ml− 1 in L-15 medium) was lysed with Trireagent (Sigma) and the RNA pellet was prepared according to the manufacturer's protocol. Finally, the RNA pellet was dissolved in 30 μl of diethylpyrocarbonate (DEPC)-treated water. The concentration of the total RNA was assayed spectrophotometrically at 260 nm (Hitachi). RNA (5 μg), 1 μl of oligo dT primer (Promega, USA), 1 μl of 10 mM dNTP mix and 10 μl of DEPC water were mixed and incubated at 65 °C for 5 min and placed on ice for 1 min and then the pellet was collected by centrifugation at 8000 ×g. To this pellet, the following components were then added: 4 μl of 5× first strand buffer, 1 μl of 0.1 M dithiothreitol and 1 μl of RNAsin (40 U μl ml− 1) (Promega, USA) and mixed gently and incubated at 42 °C for 1 min and 1 μl of (200 U) of MMLV reverse transcriptase enzyme (Gibco BRL, USA) was added and incubated at 42 °C for 50 min. The reaction was terminated by keeping the content at 70 °C for 15 min and by placing on ice for 1 min prior to storing at −20 °C until further use. 2.6.6. Polymerase chain reaction (PCR) The synthesized first strand cDNA (2 μg) was taken from each sample. Polymerase chain reaction (PCR) was conducted in 20 μl, which contained 1 µl of the first strand cDNA, 0.8 μl of 5 μM of specific forward and reverse primer, 0.4 μl of 10 mM dNTP mixture, 0.5 μl of Taq polymerase, 0.8 μl of 2 mM MgCl2 and 2 μl of 1 × Buffer and 13.7 μl of sterile milliQ H2O.The PCR reaction was performed in a thermocycler (Minicycler, MJ Research, USA) under the following conditions: 95 °C, 5 min: 40 cycles at (95 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min) and a final extension at 72 °C for 5 min. Oligonuleotides used as PCR primers were as follows: carp 40S ribosomal protein S11 (433 bp) sense primer 5′TACAGAACGAGAGGGCTTATC (13–33) antisense primer 5′TTGGTGACCTTCAGGACATTG (425–445); carp IL-1β (574 bp) sense primer 5′-ACCAGCTGGATTTGTCAGAAG (76–96), antisense primer 5′-ACAGGGGAAGAACCATCTAAC (629–649). An aliquot (10 μl) of the PCR product was electrophoresed on a 1.5% agarose gel containing 0.5 μg ml− 1of ethidium bromide photographed on a UV illuminator and intensity of each band was quantified by alpha image documentation and analysis system (Alpha Innotech Corporation, USA). 2.6.7. Northern blotting Total RNA was extracted and purified. RNA samples were prepared for northern hybridization as described by Sambrook et al. (1989). After electrophoresis, the gel was soaked in DEPC water to remove the formaldehyde and then washed in 20× SSC for 45 min. The RNA in the gel was blotted to a nylon membrane by capillary action. The membrane was removed and washed once in 5× SSC for 5 min at room temperature and the RNA was immobilized unto the membrane by UV

V. Selvaraj et al. / Aquaculture 286 (2009) 176–183

cross-linking. The membrane was wetted in 5× SSC and placed in a heat sealable container and subjected to prehybridization at 42 °C for 2 h. The DNA probe was prepared from RT-PCR amplified specific DNA. The DNA was extracted from an agarose gel by DNA extraction kit (Qiagen). For radio-labeling, 1 μl 50 ng ml− 1 DNA was placed in a clean autoclaved eppendorf tube and 9 μl of MilliQ water was added and boiled for 5 min to denature. Then it was immediately chilled on ice for 5–10 min and centrifuged at 5000 g for 30 s The following reagents were then added: 2.5 μl of 10× labeling buffer, 1 μl of 100 ng μ− 1 of random primer, 2.5 μl of 20 mM DTT solution, 2.5 μl of 20 mM dNTP solution, 3 μl of α[P32] dCTP (sp. Activity N3000 Ci/mMol or 10 μCi/μl), and 3 μl of nuclease free autoclaved water. To this, 1 μl of 3 U/μl of Klenow (large fragment of DNA polymerase I) was added and mixed gently. The mix was incubated at room temperature for at least 2 h. After labeling, the probe was briefly boiled for 5 min and then cooled immediately in ice for 10 min. Then the blot was hybridized at 42 °C overnight in a solution containing 1% SDS, 1 M NaCl and 3 × 105 cpm ml− 1 of DNA probe. After hybridization, the blot was washed twice with 2× SSC containing 0.1% SDS followed by three washings at 68 °C and finally washed with 2× SSC for 30 min at room temperature. The blot was wrapped and autoradiography performed.

179

(U ml− 1), the reciprocal dilution giving 50% hemolysis (y(1 − y) = 1), was read from the graph. 2.6.10.2. Assay of classical complement pathway (CCP) 2.6.10.2.1. Carp anti-SRBC Serum. Three C. carpio (250–300 g) were intraperitoneally injected with 0.25 ml of sheep red blood cells at a concentration of 2 × 108 cells ml− 1 in PBS. One week later, a booster injection was given. After 5 days, blood was collected and the serum separated and carp anti-sheep red blood cells antibody was determined by haemagglutination using anti-serum and sheep red blood cells and incubated the antiserum at 50 °C for 15 min to inactivate the complement as described by (Sakai, 1992) and CCP was assayed as outlined by Selvaraj et al. (2005). 2.6.11. Statistical analysis Data were analyzed by two sample Student's t-test. Results are expressed as mean ± standard deviation (S.D.). Differences between control and compounds treated groups were measured. Measurement were considered statistically significant if p b 0.01 and b0.05. 3. Results

2.6.8. Rabbit anti-carp Ig production Rabbit anti-carp immunoglobulin was prepared according to Selvaraj et al. (2005). A rabbit (with a weight of about 2 kg) was injected twice subcutaneously at two-week interval with 500 μl of purified carp Ig (1 mg ml− 1 PBS) emulsified in an equal volume of Freund's complete adjuvant (FCA). A third injection of carp Ig without FCA was given 4 days later and serum was collected after 4 days. The rabbit antiserum was titrated for anti-carp Ig activity by following the method of Selvaraj et al. (2005). Briefly, purified carp Ig was diluted in carbonate buffer at concentrations of 2.5 and 5 μg protein ml− 1 and was used for coating ELISA plates (50 μl/well). Coated plate was incubated overnight and a standard ELISA was performed. Results from the check broad titration of anti-carp antiserum indicated the optimal dilution was 1: 2048 at a coating concentration of 5 μg protein ml− 1. 2.6.9. Effect of LPS on secondary immune response LPS treated and control fish were injected i.p. with A. hydrophila vaccine in Freund's incomplete adjuvant (FIA) (Sigma) on day 21 and the booster without FIA was given on day 28. On day 33 the blood was drawn; the serum was separated and assayed for antibody titre by ELISA following the method of Selvaraj et al. (2005). 2.6.10. Complement assay Blood was collected from the caudal vessels of 6 animals of each group on day 16 and kept at 30 °C for 60 min and subsequently left in a refrigerator for 2 h. Fresh serum was separated by centrifugation at 400 ×g for 10 min and serum samples pooled, used for complement assay. 2.6.10.1. Assay of alternative complement pathway (ACP). Sheep blood was mixed with an equal volume of Alsevers's solution and stored at 4 °C. Subsequently, cells were centrifuged at 400 ×g for 5 min; the pellet of SRBC was washed twice in 10 mM EGTA–Mg–gelatin veronol buffer (GVB) and suspended in the same buffer at a concentration of 2 × 106 cells ml− 1. Alternative complement pathway activity was assayed according to published methods of (Matsuyama et al., 1988; Yano et al., 1988). Briefly, 0.5 ml of serially 10-fold diluted carp serum in EGTA–Mg–GVB was placed in a set of test tubes and 0.2 ml of sheep red blood cells suspension (2 × 106 cells ml− 1) was added. This mixture was incubated at 15 °C for 90 min. Addition of 2.8 ml of 10 mM EDTA–GVB buffer stopped the hemolytic reaction. After centrifugation, the value y (percent haemolysis / 100) was calculated from the optical density at 414 nm of the supernatant. The value y / (1 − y) and the reciprocal of the serum dilution were plotted on log–log graph paper and the ACH50

3.1. Isolation and characterization of LPS Electrophoretic separation of LPS, when observed by silver staining, exhibited a profile with ladder-like bands, indicates the presence of O-side chain, no bands appeared upon protein silver staining (Fig. 1). The extracted LPS contained the endotoxin and the protein concentration was less than 0.1 mg ml− 1. 3.2. RPS of carp challenged with A. hydrophila The LD50 concentration of A. hydrophilaVS1 was determined to be 2.94 × 107 cfu ml− 1. The control and test group animals were challenged with 0.1 ml of LD50 concentration of A. hydrophilaVS1. The mortality rate for control groups were 58%, 46% and 50% for i.p, bathing and oral administration, respectively. The RPS was significantly increased in fish injected with ≥50 µg LPS/fish. In fish that received LPS by bathing, the survival rate was also significantly higher N75 µg LPS ml− 1 compared with control group (Table 1). No significant difference was observed by oral administration in the survival rate compared with their control groups (data not shown). 3.3. Total leucocyte count (TLC) and differential count LPS treated fish (n = 6) showed significantly increased TLC, which was directly proportionate to the dose of LPS injected. Among the leucocytes, monocytes increased significantly in LPS injected groups and were predominant, followed by neutrophils. Both eosinophils and basophils declined significantly in number. No significant difference

Fig. 1. Detection of O-specific chain and protein contamination by silver staining method. LPS was extracted from A. hydrophila. Replicate samples (lanes 1 to 8 containing 10 µg of LPS extract each) were electrophoresed on 0.1%SDS–12.5% PAGE and visualized by silver staining, A — detection of O-specific chain and B — detection of protein contamination.

180

V. Selvaraj et al. / Aquaculture 286 (2009) 176–183

Table 1 Effect of LPS administration through injection and bathing on relative percent survival (against LD50 concentration of A. hydrophila) and other functional assays Functional assay RPS TLC (no. ×103/mm3) Neutrophil (%) Monocytes (%) Lymphocyte (%) Basophil (%) Esosinophil (%) Bacterial killing assay cfu ml− 1 live bacteria NBT assay OD 620 nm 1×106 cells ml−1

Bathing route (µg ml− 1)

Intraperitoneal injection (µg/fish) Control

10

50

100

Control

15

75

150

– 24 ± 0.471 26.0 ± 0.816 22.66 ± 0.471 23.66 ± 0.942 18.0 ± 0.816 10.66 ± 0.471 268×103 ±10.066

21.4 28 ± 1.20 25.3 ± 3.29 32.6 ± 0.471⁎⁎ 22.0 ± 0.412 10.0 ± 0.816 10.7 ± 0.816 70×103⁎⁎±1.000

100 40 ± 0.942⁎⁎ 28.3 ± 2.49 38.3 ± 2.620⁎⁎ 25.0 ± 4.32 4.1 ± 0.46 4.3 ± 0.47 32×103⁎⁎±6.110

100 42 ± 0.816⁎⁎ 33.7 ± 3.29⁎ 40.3 ± 5.35⁎⁎ 26.0 ± 1.24 0 0 52×102⁎⁎±8.00

– – – – – – – 220 × 103 ± 14.002

14.2 – – – – – – 31×103⁎⁎±15.524

42.2 – – – – – – 34×103⁎⁎±9.165

49.2 – – – – – – 40×103⁎⁎±6.658

0.20 ± 0.015

0.25 ± 0.02

0.28⁎ ± 0. 002

0.27⁎ ± 0.012

0.20 ±0.002

0.22 ± 0.010

0.23⁎ ± 0.007

0.23⁎ ± 0.005

Results are shown for functional assay as mean ± SD, n = 6. ⁎Statistically significant difference (p b 0.05) using Student's t-test to compare control groups and treated group. ⁎⁎Statistically significant difference (p b 0.01) using Student's t-test to compare control and treated groups. For RPS n = 24 without statistical analysis.

was found in lymphocyte count between the control and experimental groups (Table 1). 3.4. Bacterial killing assay A. hydrophila was killed more efficiently by macrophages of fish administered with LPS either by intraperitoneal injection or by bathing. Bacterial counts were significantly reduced (t = 16.22, n = 6; p b 0.01) even at the lowest concentration tested (10 µg/fish by intraperitoneal injection and 15 µg ml− 1 bathing; t = 18.1, n = 6; p b 0.0; Table 1). No significant difference was found (p N 0.05) on bacterial killing activity in fish with oral LPS administration when compared with the control. 3.5. Superoxide anion production/NBT assay Fish treated with LPS by intrperitoneal injection 50 µg/fish showed significant change (t = 6.66 n = 6; p b 0.05) (Table 1); however, after the fish were bathing, the significant change was observed in 75 µg ml− 1 group (t = 2.22, n = 6; p b 0.05). Oral administration did not induce any significant change even at higher concentration (0.5%) (t = 1.552, n = 6; p N 0.05) when compared with control animals. 3.6. RT-PCR assay RT-PCR analysis assay revealed that the expression of IL-1β mRNA in macrophages of LPS treated fish did not show high expression at 24 h subsequent to third booster dose application when compared with control group. Sample taken at 48 h subsequent to third booster

dose application on day 16 all doses showed enhanced expression of IL-1β mRNA over the control. However, the highest expression was found from the fish given 50 and 100 µg of LPS/fish (Fig. 2). 40S ribosomal protein RNA was used as the house-keeping gene to confirm the relative RNA concentration, which indicated that total RNA concentration was almost the same in all samples. 3.7. Northern blot analysis In this experiment, IL-1β mRNA was monitored by using the carp RT-PCR amplified fragment that was radioactively labeled and used as a specific DNA probe. Analysis revealed that IL-1β mRNA signal was detected in fish injected with 50 and 100 µg of LPS/fish, whereas no signal was detected in control fish and fish treated with 10 µg of LPS/ fish (Fig. 3). 3.8. Secondary immune response determination by ELISA Intraperitoneal injection and the bathing of fish with LPS showed higher antibody titre following vaccination with A. hydrophila than the untreated control. The antibody titre of pooled (n = 6) normal control without vaccination, control with vaccination and test animals injected with 10, 50 and 100 μg LPS were 21.33, 53.33, 853.33, 1365.33 and 1706.66. When compared with control group, the antibody titre was slightly increased in animals treated with 75 and 150 μg LPS ml− 1 by bathing. But the antibody titre was almost similar in the test group and control group fish that received the LPS through oral administration (Fig. 4). 3.9. Complement activity assay 3.9.1. Classical pathway Blood samples were taken from 6 animals on day 16. The mean CH 50 U ml− 1 of the control group was 40.3 ± 0.404 and it was not significantly different (p 0.05) in LPS treated animals.

Fig. 2. RT-PCR analysis of IL-1β expression in carp kidney macrophages following stimulation of fish with LPS by i.p. injection. Samples were taken for PCR analysis after 24 h and 48 h subsequent to third booster dose application. Amplified DNA products separated on agarose gels were visualized after ethidium bromide staining. Panel 1: 24 h samples. Lane 1 = non template control; Lane 2 = PBS control and Lanes = 3, 4 and 5 LPS treated (10 µg, 50 µg and 100 µg LPS/fish, respectively). Panel 2: 48 h samples. Lane 1 = non template control; Lane 2 = PBS control and Lanes 3, 4 and 5 LPS treated (10 µg, 50 µg and 100 µg LPS/fish, respectively) and Lane 6 = molecular weight marker. The figure is a representative of three fish for each sampling time (for each treatment). The positions of ‘IL-1β-specific’ and ‘40S-specific’ amplicons are labeled in the left margin and the sizes of the molecular weight markers are shown in right margin.

Fig. 3. Northern blot analysis of IL-1β mRNA expression in carp head kidney macrophages after stimulation of fish with LPS by injection. Northern blot was probed with RT-PCR amplified P32 labeled specific DNA probe. Samples were taken for analysis after 48 h on day 16 after third booster dose application. Lane 1: control, lane 2: 10 μg of LPS, lane 3: 50 μg of LPS, lane 4: 100 μg of LPS/fish and lane 5: molecular weight markers. The sizes of the markers are shown in right margin. RNA isolated from 3 fish (for each treatment) was analyzed.

V. Selvaraj et al. / Aquaculture 286 (2009) 176–183

181

Fig. 4. Secondary immune response of carp pretreated with different modes of administration of LPS. Injection: 1 = normal control without vaccination; 2 = control with vaccination; 3 = 10 μg LPS; 4 = 50 μg LPS; and No 5 = 100 μg LPS/fish following vaccination with A. hydrophila. Bathing: 1 = normal control without vaccination; 2 = control with vaccination; 3 = 15 μg LPS; 4 = 75 μg LPS; 5 = 150 μg LPS ml− 1) following vaccination with A. hydrophila. Oral route: 1 = normal control without vaccination; 2 = control with vaccination; 3 = 0.1% LPS; 4 = 0.25% LPS; and 5 = 0. 5 LPS %) following vaccination with A. hydrophila.

3.9.2. Alternative complement pathway There was no significant (p N 0.05) difference in ACH 50 U ml− 1 between the control animals serum and LPS treated via injection, bathing and oral route. The mean ACH unit ml− 1 of the control group was 590 ± 25.223. 4. Discussion It has been reported that the rough form of LPS does not migrate during electrophoresis as a ladder-like structure due to lack of ‘O’ specific chain containing repeating units of oligosaccharide (Tasi and Frasch, 1982; Hitchcock and Brown, 1983; Hendrick and Sequeira, 1984; Kido et al., 1990). As the LPS preparation from A. hydrophila produced ladderlike bands on SDS-PAGE, it is clear that the LPS used in this study had O-specific chain and endotoxin. Intraperitoneal injection of LPS improved the survival rate of carp C. carpio after an i.p. challenge with A. hydrophila. Administration of 50 and 100 μg of LPS/fish elicited 100% survival in carp. These results differ slightly from previous reports. An increased survival rate has been observed at concentrations of 200,1000, 200 and 1250 μg of crude LPS/fish in channel catfish, eel, turbot and carp against Edwardsiella ictaluri, E. tarta, cytophaga-like bacteria and Aeromonas bestiarum, respectively (Saeed and Plumb,1986; Salati et al.,1987; Al-Harbi and Austin, 1992; Kozinska and Guz, 2004). An elevation in RPS (by 40%) has been reported in fish immunized by bath immunostimualtion at concentrations of 75 and 150 μg ml− 1. Immunization of carp with 10 and 20 μg ml− 1 of LPS solution induced an effective immune protection against A. hydrophila (Baba et al., 1988). However, LPS administration through the oral route did not produce any change in survival even at high LPS concentration (0.5%). Oral administration of LPS in turbot did not induce significant survival against Cytophaga-like bacteria when compared with control (Al-Harbi and Austin, 1992). In contrast, Guttvik et al. (2002) observed high mortality rate in test animals group in all concentrations (0.1%, 0.03 and 0.01%) when compared with control animals. The protective effect of LPS was correlated with several functional assays under in vitro conditions. Total leucocyte count increased in the LPS injected fish— the highest leucocyte number was found at a concentration of 100 µg/fish compared to control fish. Among the leu-

cocytes, the number of monocytes and neutrophils increased significantly. Kozinska and Guz (2004) also reported similar increased total leucocyte count in fish injected with 50 and 1250 µg LPS/fish compared to control group. They also noticed that the neutrophils and monocytes were not increased significantly in these groups. Granulocytes and monocytes/macrophages are key cells involved in the cellular part of the non-specific defense system in fish (Dalmo et al., 1997) and hence their level increases as a response to the administration of the LPS immunostimulant. The ability of macrophages to kill pathogenic microbes is probably one of the most important mechanisms of protection. The present study was performed with macrophages obtained from fish treated with LPS by different modes of administration. Intraperitoneal injection and bathing enhanced the activity of bacterial killing due to enhanced production of superoxide anion that might be involved in the destruction of the pathogen A. hydrophila, whereas animals receiving the compound orally did not show any significant change in the above parameters. Previous in vitro studies have also revealed the similar function of macrophages obtained from other fish species such Atlantic salmon and rainbow trout, at lower concentration 1 to 10 μg of LPS ml− 1 (Solem et al., 1995; Dalmo and Seljelid, 1995; Novoa et al., 1996). The difference here is concentration and the mode of treatment. In fact, in vivo administration required higher concentrations than in vitro. RT-PCR and Northern blot analysis showed that the LPS induced macrophages to express-elevated amounts of 1 L1-β mRNA in 48 h samples (on day 16 sample) not in 24 h at concentrations of 50 and 100 μg of LPS/fish. In contrast, in vitro treatment of rainbow trout leucocytes with various concentrations of LPS enhanced expression of 1 L1-β mRNA quickly 2.5 to 8 h of post stimulation. The amounts of LPS required for marked level of expression of 1 L 1-β mRNA above the concentrations ≥1.5 µg LPS ml− 1 (Zou et al., 2000). Engelsma et al. (2001) also found the highest expression in cultured macrophages and lymphocytes after 2 h post stimulation with 10 μg of LPS ml− 1. The reason why 1 L1-β mRNA is not expressed at elevated amounts at 24 h samples is because the sampling time might be too early and thus sufficient amount of LPS might not have reached the target organs. The present investigation showed that injection of LPS (≥100 µg/ fish) evoked higher secondary immune response in carp against the

182

V. Selvaraj et al. / Aquaculture 286 (2009) 176–183

vaccine constituent of A. hydrophila. Previous researchers have reported enhanced immune response in LPS treated fish. Injection of LPS alone and along with FCS into brown trout, channel catfish, eels, turbot, carp and rainbow trout produced higher antibody titre against S. typhimurium, E. ictaluri, E. tarta, cytophaga-like bacteria, A. bestiarum and F. psychrophilum (Ingram and Alexander, 1980; Saeed and Plumb, 1986; Salati et al., 1987; Baba et al., 1988; Al-Harbi and Austin, 1992; Kozinska and Guz, 2004; Lafrentz et al., 2004). LPS did not induce any change in the classical as well as alternative pathways when compared to the control animals. Intraperitoneal injection and in vitro treatment of rainbow trout with LPS, pronase and zymosan induced a reduction in complement haemolytic activity (Sakai, 1992). The injection method is most effective because it delivers the exact quantity of LPS and injected compounds reach the target organs such as head kidney and spleen readily. In accordance with numerous reports, the effectiveness of the vaccination was dependent on the route of administration, and was significantly higher when vaccination was carried out by injection (Collado et al., 2000; Velji et al., 1990; Loghothetis and Austin, 1994; Palm et al., 1998; Kim et al., 2000). The bath delivery method may not be effective because gills and skin of carp might not take up sufficient quantities of LPS to evoke immunity. A similar conclusion has been derived by Collado et al. (2000), who administered several vaccine formulations and lipopolysaccharides to eels by injection and immersion methods and reported the highest protection against V. vulnificus by injection and not by an immersion. Huising et al. (2003) have reported gills and skin of fish carp in the direct immersion method only marginally took up LPS-DTAE. However, Baba et al. (1988) reported that while bath immunostimulation induced an effective immune protection against A. hydrophila, oral administration did not give any protection. This may be attributed to the possible destruction of much of the LPS during its passage through the digestive tract of the carp. Similar results were also observed in turbot when LPS was administrated by oral route (Al-Harbi and Austin, 1992). Guttvik et al. (2002) reported that Atlantic salmon fry receiving LPS-coated feed did not exhibit any measurable amount of specific antibodies and survival against A. salmonicida. It may be concluded from the present results that LPS administration by intraperitoneal injection and bathing effectively stimulates non-specific cellular as well as secondary immune response as LPS used for this study possessed the endotoxin to stimulate non-specific cellular defense mechanism as well as O-specific chain to stimulate the specific immune response and hence, offers protection against A. hydrophila. However, oral administration did not induce any change in these parameters. Acknowledgements The first author is grateful to SPIC Research and Development Department for permitting him to carry out this research programme. He thanks Dr. R. Palaniappan, Joint General Manager of SPIC R&D for continuous encouragement. References Al-Harbi, A.H., Austin, B., 1992. Immune response of turbot, Scophthalmus maximus (L.), to lipopolysaccharide from a-pathogenic Cytophagea-like bacterium. J. Fish Dis.15, 449–452. Anderson, D.P., 1992. Immunostimulants, adjuvants, and vaccine carriers in fish: application to aquaculture. Annu. Rev. Fish Dis. 2, 281–307. Amend, D.F., 1981. Potency testing of fish vaccine. Dev. Biol. Stand. 49, 447–454. Baba, T., Imamura, J., Izawa, K., 1988. Immune protection in carp, Cyprinus carpio L., after immunization with Aeromonas hydrophila crude lipopolysaccharide. J. Fish Dis. 11, 237–244. Bergey, D.H., Holt, J.G., 1994. Bergey's Manual of Determinative Bacteriology. Lippincott, Williams & Wilkins. Bøgwald, J., Stensvag, K., Hoffman, J., Holm, K.O., Jørgensen, T.O., 1992. Vaccination of Atlantic salmon, Salmo salar L., with particulate lipopolysaccharide antigen from Vibrio salmonicida and Vibrio anguillarum. Fish Shellfish Immunol. 2, 251–261. Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of proteins utilizing the principle of protein dye binding. Anal. Biochem. 72, 248–254.

Braun-Nesje, R., Berteussen, K., Kaplan, G., Seljelid, R., 1981. Salmonid macrophages: separation, in vitro culture and characterization. J. Fish Dis. 4, 141–151. Chen, D., Ainsworth, A.J., 1992. Glucan administration potentiates immune defence mechanisms of channel catfish, Ictalurus punctatus Rafinesque. J. Fish Dis.15, 295–304. Chung, S., Secombes, C.J., 1988. Analysis of events occurring within teleost macropha ges during the respiratory burst. Comp. Biochem. Physiol. 34, 383–390. Clem, L.W., Sizemore, R.C., Elsaesser, E.F., 1985. Monocytes as a accessory cells in fish immune response. Dev. Comp. Immunol. 9, 803–809. Collado, R., Fouz, B., Sanjuan, E., Amaro, C., 2000. Effectiveness of different vaccine formulations against vibriosis caused by Vibrio vulnificus serovarE (biotype 2) in European eels Anguilla anguilla. Dis. Aquat. Org. 43, 91–101. Dalmo, R.A., Seljelid, R., 1995. The immunomodulatory effect of LPS, laminaran and sulphated laminaran (β-(1,3)-D-glucan) on Atlantic salmon, Salmo salar (L.) macrophages in vitro. J. Fish Dis. 18, 175–185. Dalmo, R.A., Bogwald, J., Ingebrigtsen, K., Seljelid, R., 1996. The immunomodulatory effect of laminaran [β(1-3)-D-glucan] on Atlantic salmon, Salmo salar (L.) anterior kidney leucocytes after intraperitoneal, peroral and peranal administration. J. Fish Dis. 19, 449–457. Dalmo, R.A., Ingebrigtsen, K., Bogwald, J., 1997. Non-specific defence mechanisms in fish, with particular reference to the reticuloendothelial system (RES). J. Fish Dis. 241–273. Engelsma, M.Y., Stet, R.J.M., Schipper, H., Verburg-van Kemende, B.M.L., 2001. Regulation of interleukin 1 beta RNA expression in the common carp, Cyprinus carpio L. Dev. Comp. Immunol. 25, 195–203. Guttvik, A., Paulsen, B., Dalmo, R.A., Espelid, S., Lund, V., Bøgwald, J., 2002. Oral administration of lipopolysaccharide to Atlantic salmon (Salmo salar L.) fry. Uptake, distribution, influence on growth and immune stimulation. Aquaculture 214, 35–53. Hendrick, C.A., Sequeira, L., 1984. Lipopolysaccharide defective mutants of the wilt pathogen Pseudomonas solanacearum. Appl. Environ. Microbiol. 48, 94–101. Hitchcock, P.J., Brown, L., 1983. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver staining polyacrylamide gels. J. Bacteriol. 154, 269–277. Huising, M.O., Teun, Guichelaar, Casper, Hoek, Verburg-van Kemenade, B.M.L., Gert, Flik, Savelkoul, H.F.J., Rombout, J.H.W.M., 2003. Increased efficacy of immersion vaccination in fish with hyperosmotic pretreatment. Vaccine 21, 4178–4193. Ingram, G.A., Alexander, J.B., 1980. The immune response of the brown trout Salmo trutta to lipopolysaccharide. J. Fish Biol. 16, 181–197. Kawakami, H., Shinohara, N., Fukuda, Y., Yamashita, H., Kihara, H., Sakai, M., 1997. The efficacy of lipopolysaccharide mixed chloroform-killed cell (LPS-CKC) bacterin of Pasteurella piscicida on yellowtail, Seriola quinqueradiata. Aquaculture 154, 95–105. Kido, N., Ohat, M., Kato, N., 1990. Detection of lipopolysaccharide by ethidium bromide staining after sodium dodecylsulfate-polyacrylamide gel electropharesis. J. Bacteriol. 32, 1145–1147. Kim, K.H., Hwang, Y.J., Cho, J.B., Park II, S., 2000. Immunization of cultured juvenile rockfish Sebastes schlegeli against Microcotyle sebastis (Monogea). Dis. Aquat. Org. 40, 29–32. Kozinska, A., Guz, L., 2004. The effect of various Aeromonas bestiarum vaccines on nonspecific immune parameters and protection of carp (Cyprinus carpio L). Fish Shellfish Immunol. 16, 437–445. Laemmli, U.K., 1970. Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature 227, 680–685 (London). Lafrentz, B.R., Lapatra, S.E., Jones, G.R., Cain, K.D., 2004. Protective immunity in rainbow trout Oncorhynchus mykiss following immunization with distinct molecular mass fractions isolated from Flavobacterium psychrophilum. Dis. Aquat. Org. 59, 17–26. Lee, K.K., Ellis, A.E., 1989. Rapid and sensitive silver-lipopolysaccharide staining using Phast system in fast horizontal polyacrylamide gel electrophoresis. Electrophoresis 10, 729–731. Loghothetis, P.N., Austin, B., 1994. Immunization response of rainbow trout (Oncorwalbaum) to Aeromonas hydrophila. Fish Shellfish Immunol. 4, 239–254. Nakhla, A.N., Szalai, A.J., Banoub, J.H., Keough, K.M.W., 1997. Serum anti-LPS antibody production by rainbow trout (Oncorhynchus mykiss) in response to the administration of free and liposomally-incorporated LPS from Aeromonas salmonicida. Fish Shellfish Immunol. 7, 387–401. Matsuyama, H., Tanaka, K., Nakao, M., Yano, T., 1988. Characterization of the alternative complement pathway of carp. Dev. Comp. Immunol. 12, 403–408. Merril, C.R.D., Goldmen, D., Van keuren, M.L., 1984. Gel protein staining: silver stain. Meth Enzymol, pp. 441–447. Novoa, E., Figueras, H., Ashton, I., Secombes, C.J., 1996. In vitro studies on the regulation of rainbow trout (Oncorhynchus mykiss) macrophage respiratory burst activity. Dev. Comp. Immunol. 20, 207–215. Palm, R.C., Landolt, M.L., Busch, R.A., 1998. Route of vaccine administration: effects on the specific humoral response in rainbow trout Oncorhynchus mykiss. Dis. Aquat. Org. 33, 157–166. Robertsen, B., 1999. Modulation of the non-specific defence of fish by structurally conserved microbial polymers. Fish Shellfish Immunol. 9, 269–290. Saeed, M.O., Plumb, A.J., 1986. Immune response of channel catfish to lipopolysaccharide and whole cell Edwardsiella ictaluri vaccines. Dis. Aquat. Org. 2, 21–25. Salati, F., Ikeda, Y., Kusuda, R., 1987. Effect of Edwardsiella tarda lipopolysaccharide immunization on phagocytosis in the eel. Nippon Suisan Gakkaishi 53, 201–204. Sakai, D.K., 1992. Repertoire of complement in immunological defense mechanisms of fish. Ann. Rev. Fish Dis. 2, 223–247. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: a laboratory manual, Vols 1–3. Cold spring Harbor Press, New York. Schaperclaus, W., Kulow, H., Schreckenbach, K., 1991. Hematological and serological technique, In: Kothekar, V.S. (Ed.), Fish disease, 2nd ed. Connaught circus, Vol. 1. Oxonian press, New Delhi:Gulab primani, pp. 71–108. Pvt.Ltd.

V. Selvaraj et al. / Aquaculture 286 (2009) 176–183 Selvaraj, V., Sampath, K., Sekar, V., 2005. Administration of yeast glucan enhances survival and some non-specific and specific immune parameters in carp (Cyprinus carpio) infected with Aeromonas hydrophila. Fish Shellfish Immunol. 19, 293–306. Shome, R., Shome, B.R., 1999. A typical chronic form of Aeromonas hydrophila infection in Indian major carp, Catla catla from Andaman. Curr. Sci. 76, 1188–1190. Solem, S.T., Jorgensen, J.B., Robertsen, B., 1995. Stimulation of respiratory burst and phogocytic activity in Atlantic salmon (Salmo salar L.) macrophoges by lipopolysaccharide. Fish Shellfish Immunol. 5, 475–491. Tsai, C.M., Frasch, C.E., 1982. A sensitive silver stain for detecting lipopolysacchride in polyacrylamide gels. J. Anal. Biochem. 119, 115–119. Velji, M.I., Albright, L.J., Evelyn, T.P., 1990. Protective immunity in juvenile coho salmo Oncorhynchus kisutch following immunization with Vibrio ordalii lipopolysaccharide or from exposure to live V. ordalii cells. Dis. Aquat. Org. 9, 25–29.

183

Westphal, O., Jann, K., 1969. Bacterial lipopolysaccharide extraction with phenol-water and further application of the procedure. Methods in carbohydrate chemistry, vol. 5. Academic Press, New York, pp. 83–91. Yano, T., Hatayama, Y., Matsuyama, H., Nakao, M., 1988. Titration of alternative complement pathway activity of representative cultured fishes. Nippon Suisan Gakkaishi 54, 1049–1054. Zou, J., Holland, J., Hong, S., Pleguezuelos, O., Cunningham, C., Secombes, C.J., 2000. Factors influencing the expression of interleukin-1β in cultured rainbow trout (Oncorhynchus mykiss) leucocytes. Dev. Comp. Immunol. 24, 575–582.