Advantageous toxicity profile of inhaled antisense oligonucleotides following chronic dosing in non-human primates

ARTICLE IN PRESS Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

Contents lists available at ScienceDirect

Pulmonary Pharmacology & Therapeutics journal homepage: www.elsevier.com/locate/ypupt

Advantageous toxicity profile of inhaled antisense oligonucleotides following chronic dosing in non-human primates Alain Guimond, Elisabeth Viau, Pame´la Aube´, Paolo M. Renzi 1, Luc Paquet 2, Nicolay Ferrari  Topigen Pharmaceuticals Inc., 2901 East Rachel Street, Suite 13, Montreal, Quebec, Canada H1W 4A4

a r t i c l e in fo

abstract

Article history: Received 20 May 2008 Accepted 9 August 2008

TPI ASM8 and TPI 1100 are two products containing modified phosphorothioate antisense oligonucleotides (AONs), which are undergoing development for the treatment of asthma and chronic obstructive pulmonary disease (COPD), respectively. TPI ASM8 is comprised of two AONs, one targeting the human chemokine receptor 3 (CCR3) and the other targeting the common beta-chain of the IL-3/IL-5/GM-CSF receptors. TPI 1100 is also a dual-AON compound targeting the phosphodiesterase (PDE) 4 and 7 isotypes. For both products, the AONs are present in a 1:1 ratio by weight. Both products will be administered by inhalation to patients, and TPI ASM8 is currently undergoing Phase 2 clinical trials. As part of the safety assessment of both products, the toxicity and disposition (i.e., pharmacokinetics of the AON components in plasma and tissues) were investigated in 14-day inhalation studies in monkeys at doses ranging from 0.05 to 2.5 mg/kg/day. Results indicated that both products were safe and well tolerated at all dose levels. Reversible treatment-related alterations were only observed at the high dose levels tested and were limited to changes in the respiratory tract which were characterized primarily by the presence of alveolar macrophages in the absence of a generalized inflammatory response. Plasma pharmacokinetic profiles showed very low plasma concentrations, and no plasma accumulation was observed after repeated doses. While significant amounts of the AONs of both TPI ASM8 and TPI 1100 were measured in trachea and lung, only limited amounts of the AONs could be measured in kidney and liver, which, in combination with the low plasma level data, is indicative of very low systemic exposure. Taken together, these results demonstrate that these two new AON-based products are safe and that delivery via the inhaled route achieves localized deposition in the pulmonary tract with very limited systemic exposure and reduced toxicity compared to other routes of AON administration. & 2008 Elsevier Ltd. All rights reserved.

Keywords: Antisense Oligonucleotides Inhalation FANA Lung Pharmacokinetics Monkey Asthma COPD

1. Introduction The notion of using antisense oligonucleotide (AON) molecules, which modulate expression of a target gene by binding to its mRNA and preventing translation, was first proposed by Zamecnik and Stephenson [1]. From its original conception, an array of options for RNA-targeting approaches has expanded to include small-interfering RNA, ribozymes and micro RNA [2]. While antisense technology is most advanced, its development has been hampered by issues of AON instability, limited distribution and uptake by the cellular targets, limited efficacy, and chemical class toxicity in systemic applications [2–4]. During the past decade, much has been learned about basic mechanisms of action, optimal medicinal chemistry, and the pharmacologic,

 Corresponding author. Tel.: +1 514 868 0077; fax: +1 514 868 0011.

E-mail address: [email protected] (N. Ferrari). Current address: CHUM Research Center, Notre-Dame Hospital, 1560 Sherbrooke Street East, Room M-5210, Montreal, Quebec, Canada H2L 4M1. 2 Current address: Institut de Recherche en Pharmacologie, Universite´ de Sherbrooke, 3001 12e Avenue Nord, Sherbrooke, Quebec, Canada J1H 5N4. 1

1094-5539/$ - see front matter & 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.pupt.2008.08.001

pharmacokinetic, and toxicologic properties of AON molecules [3,5–9]. This recent progress has brought one drug on the market, fomivirsen (marketed as Vitravene), and more than 40 AON drugs in clinical development. We have developed innovative RNA-targeting drugs as therapies for respiratory diseases. With the aforementioned challenges in mind, our approach in developing AON-based drugs is characterized by (1) the use of combinations of AONs targeting multiple gene products, to achieve improved pharmacological activity; (2) incorporation of chemical modifications for increased stability and improved safety profiles, and (3) delivery directly to the site of action (in the lung), which affords increased uptake by the target cells with lower systemic exposure. In pre-clinical airways disease models, the combination of two AONs directed against different molecular targets was shown to be more efficacious than the single agents [10]. TPI ASM8 is a new inhaled RNA-targeting drug designed to treat asthma. TPI ASM8 consists of two phosphorothioate AONs: TOP004, a 19-mer oligonucleotide that targets the mRNA for the human common beta-chain (bc) of the IL-3, IL-5, and GM-CSF receptors; and TOP005, a 21-mer specific for the human

ARTICLE IN PRESS 846

A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

chemokine receptor 3 (CCR3) [10–13]. These two AONs are present in a 1:1 ratio by weight in TPI ASM8. The AON constituents of TPI ASM8 inhibit the expression of receptors that function in two distinct, but overlapping, cellular pathways involved in the initiation, maturation, and persistence of allergic inflammation and asthma. Amongst other roles, CCR3 is involved in eosinophil recruitment, proliferation, and differentiation from progenitor cells into the sites of allergic or asthmatic inflammation [14–16], while signaling through the bc affects proliferation and survival of eosinophils, mast cells, and macrophages [17–20]. Another key feature of the TPI ASM8 AONs is the chemical modifications. In addition to a conventional full-length phosphorothioate backbone, the adenosines in the AON sequences are replaced with the 2-amino-20 -deoxyadenosine. This modification has been shown to reduce the potential pro-inflammatory effect and bronchial hyper-response of adenosine when given by intratracheal administration to rats [10,21]. In addition to pre-clinical data in support of the efficacy of TPI ASM8, it is the first dual RNAtargeting drug product which has shown efficacy in a clinical study in asthma [22]. TPI 1100 is a second-generation combination AON product, consisting of two phosphorothioate AONs (also present in a 1:1 ratio by weight) that selectively inhibit expression of phosphodiesterase (PDE) 4 (subtypes B and D) and PDE7 (subtype A). The product is undergoing development for the treatment of chronic obstructive pulmonary disease (COPD). The two AON constituents have a chimeric structure wherein 20 -deoxy-20 -fluoro-b-D-arabinonucleic acid (FANA) wings flank a middle portion of DNA. The specific AONs are TOP1572, a 19-mer targeting the human PDE4B and PDE4D isotypes, and TOP1731, a 21-mer specific for the human PDE7A mRNA. The drug is designed to inhibit multiple gene expression pathways known to be linked to progressive airway inflammation and remodeling in COPD and asthma [23–28]. Delivered via aerosol to the lungs, TPI 1100 represents a novel RNA-antagonist therapy with selective mechanisms of action for reducing lung inflammation without the dose-limiting systemic side effects widely associated with known orally administered small-molecule inhibitors of PDE4 [29–31]. Most of the antisense drugs currently in development are delivered systemically, by injection typically via intravenous or subcutaneous routes. While the pharmacokinetic and toxicity profiles of phosphorothioate AONs following intravenous administration have been well established in animals [4,32–37] and in human [38,39], very few reports on the pharmacokinetics and toxicity of phosphorothioate AON after inhalation delivery have been published. The authors are aware of one study each in mice and rabbits [36,40]. Here we report for the first time the preclinical evaluation of two dual RNA-targeting AON compounds administered by inhalation in non-human primates.

2. Material and methods 2.1. Synthesis and purity of TPI ASM8 and TPI 1100 All AONs comprising TPI ASM8 and TPI 1100 were synthesized and purified under GMP specifications by Dow Chemical Company (Midland, MI). The specific sequences, chemical modifications, and purity for each of the AON are outlined in Fig. 1 and Table 1, respectively. 2.2. Study design All studies were performed at ITR Laboratories Canada (Baie d’Urfe, QC) in compliance with GLP regulations, and their design is

Fig. 1. Chemical structures of 2-amino-20 -deoxyadenosine analog (DAP, left panel), and of 20 -deoxy-20 -fluoro-b-D-arabinonucleic acid (FANA, right panel).

Table 1 List of AONs comprising TPI ASM8 and TPI 1100 used in these studies Name

Length

Target

Sequence 50 –30

Purity (%)

TPI ASM8 TOP004 TOP005

19 21

Hu bc Hu CCR3

GGGTCTGCDGCGGGDTGGT GTTDCTDCTTCCDCCTGCCTG

86.8 80.9

TPI 1100 TOP1572 TOP1731

19 21

Hu PDE4B/4D Hu PDE7A

GGTTGCTCAGITCTGCACA TCATGAGTGGCAGCTGCAATT

92.6 91.1

All phosphorothioate linkages. Uppercase letters ¼ DNA; bold letters ¼ FANA; I ¼ Inosine; D ¼ 2-amino-20 -deoxyadenosine.

Table 2 Summary of treatment groups for the 14-day inhalation toxicity studies of TPI ASM8 and TPI 1100 in monkeys Group no.

Dose level (mg/kg)a

Number of animals in toxicology groups Mainb

1 2 3 4

0 0.05 0.25 2.5

Recoveryc

Male

Female

Male

Female

3 3 3 3

3 3 3 3

1 – – 1 or 2d

1 – – 1 or 2d

a Target dose levels, based on 100% deposition within the respiratory tract tissues. b Main study animals were terminated on Day 15, 1 day after the last dose. c For the TPI ASM8 study, recovery animals were terminated on Day 29, 2 weeks after the last dose. For the TPI 1100 study, recovery animals were terminated on Day 42, 4 weeks after the last dose. d There were one male and one female in the high-dose recovery subgroup for the TPI ASM8 study, and 2/sex in high-dose recovery subgroup for the TPI 1100 study.

summarized in Table 2. Briefly, male and female cynomolgus monkeys (weighing 1.5–2.5 kg) received 14 consecutive doses of vehicle or 0.05, 0.25, or 2.5 mg/kg of TPI ASM8 (in saline) or TPI 1100 (in phosphate-buffered saline) administered daily as aerosols using an inhalation exposure system. The animals were examined once or twice daily for clinical signs including a qualitative assessment of food consumption, and body weight was measured weekly. Electrocardiographic activity was recorded and ophthalmic examinations were conducted for animals pre-study and on Day 14. Blood and urine samples for clinical pathology evaluations

ARTICLE IN PRESS A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

847

representative port of the exposure chamber, with a collection sample flow rate of 1 L/min. The sample flow rates were precisely controlled using variable area flowmeters that were calibrated before use using a DryCal DC-2 primary airflow calibrator. The absolute volume of each aerosol concentration sample was measured with a wet-type gas meter.

(hematology, coagulation, serum chemistry, and urinalysis parameters) were obtained from all animals during the pre-study period, at the end of the treatment phase, and at the end of the recovery period. In addition, timed samples (citrated plasma) were collected on Day 1 for analysis of activated partial thromboplastin time (APTT) and prothrombin time (PT; TPI 1100 study only); the sampling times for the TPI ASM8 study were prestudy and 0.5 and 6 h after the end of exposure on Day 1, and the sampling times for the TPI 1100 study were pre-study and 0.25 and 6 h after the end of exposure on Days 1 and 14. Additional blood samples were also collected at these same time points for analysis of plasma Bb concentration (a specific marker for activation of the alternative complement pathway). Blood sampling times for pharmacokinetics were pre-dose, and at 5 min (TPI 1100 only), 0.5, 1, 3, 6, and 24 h after inhalation of the first dose on Day 1 (Dose 1) and after administration of the last dose on Day 14 (Dose 14). To assess possible hypersensitivity to the repeated administration of the AONs, recovery animals were given a small intradermal injection of 0.1 mg of TPI ASM8 or TPI 1100 near the end of the recovery period for the TPI ASM8 study or at the midpoint of the recovery period (approximately Day 28) for the TPI 1100 study, following which the skin injection sites were examined at 24 and 48 h post-injection, using a standard Draize scoring system. One day after the last dose (Day 15), 24 monkeys (3/sex/group) were euthanized. All remaining animals were euthanized upon completion of the recovery period (14 days after the last dose for the TPI ASM8 study or 28 days after the last dose for the TPI 1100 study). Terminal procedures included complete gross necropsy examination, collection, and preservation of approximately 40 tissues, and measurement of the weights of all major organs. Respiratory tract tissues (nasal cavity, nasopharynx, larynx, pharynx, trachea, bronchi, lungs including carina and bronchial lymph nodes) from all animals were examined by light microscopy, and all collected tissues was examined for all high-dose and control group animals. In addition, portions of the trachea, lung, liver, and kidney were collected for analysis of AON content.

where DL is the achieved dose level (mg/kg/day); Ec the actual concentration delivered to the animals (mg/L air); RMV the respiratory minute volume (L/min) according to the method of Bide et al. [41]: RMV (L) ¼ 0.499  BW (kg)0.809; T the time, i.e., duration of daily exposure (min); and BW the mean body weight (kg) during exposure period. This estimation of total inhaled dose assumed 100% deposition within the respiratory tract.

2.3. Inhalation exposure system

2.7. Bioanalytical methods

The aerosol was produced using clinical nebulizers and discharged through a 40-mm diameter tube into a flow-past inhalation exposure system. The airflow rate through the exposure system was monitored and recorded manually during each generation period. Airflow to the exposure system was controlled using variable area flowmeters. Control of the aerosol exhaust flow from the animal exposure system was achieved using a diaphragm valve. The system provided a minimum of 2 L/min of aerosol to each animal exposure position, and the inlet and outlet airflows were balanced to ensure that there was no dilution of the generated aerosol by air drawn from the environment. Any minor variation in flow was buffered by a balloon reservoir. An equal delivery of aerosol to each animal was achieved by employing a distribution network that was identical for each individual exposure position attached to the system.

The analysis of plasma and tissue concentrations of the individual AONs in TPI ASM8 and TPI 1100 was performed using quantitative hybridization ELISA methods. For the quantification of TPI ASM8 constituents (full-length and 50 -end n-1 derivatives), a hybridization–ligation ELISA (HL-ELISA) method adapted from

2.4. Exposure system monitoring During each generation period, the aerosol production from the nebulizers was monitored by direct observation of the circulating formulation in the reservoir of each device. Determinations of aerosol concentration (UV absorption), particle size distribution, oxygen concentration, relative humidity, and temperature were measured on samples collected from a

2.5. Particle size distribution and mass median aerodynamic diameter (MMAD) The distribution of particle size in the generated aerosols was measured at least once weekly by collecting samples into a 7-Stage Mercer Cascade Impactor (Model 02-130 InTox, Inc., Albuquerque, NM, USA) for determination of TPI ASM8 or TPI 1100 content using a validated analytical method based on UV absorption. The sample substrates from the cascade impactors collected from Group 1 (control animals) were analyzed gravimetrically only. The MMAD and the Geometric Standard Deviation was calculated for each group on the basis of the results obtained from the Impactor, using a log-probit transformation. Particle size distribution measurements are summarized in Table 3. 2.6. Estimation of achieved dose levels Achieved dose levels during the exposure period were estimated using the following formula: DL ¼

Ec  RMV  T BW

Table 3 Exposure aerosol particle size distribution analysis for TPI ASM8 and TPI 1100 Dose level (mg/kg)

MMAD (mm)

GSD

TPI ASM8 0a 0.05 0.25 2.5

n.d. 1.8 1.8 1.7

n.d. 2.22 2.18 2.12

TPI 1100 0b 0.05 0.25 2.5

1.2 1.3 1.5 1.9

2.60 1.82 1.89 1.96

MMAD ¼ mass median aerodynamic diameter; GSD ¼ geometric standard deviation; n.d. ¼ not determined. a The distribution of particle size (vehicle control) was not measured in error. b The distribution of particle size (vehicle control) was determined gravimetrically.

ARTICLE IN PRESS 848

A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

Yu et al. [42] was used. A variation of the hybridization ELISA method described by Efler et al. [43] was used for the quantification of TPI 1100 full length only constituents in plasma and tissues. Both methods were validated for precision, accuracy, selectivity, sensitivity, and stability for TPI ASM8 and TPI 1100 quantitation before analysis of study samples.

3. Results 3.1. Toxicity evaluation The toxicity profile of TPI ASM8 and TPI 1100 was assessed in monkeys as this species has been recommended by various regulatory authorities. Prior to start, the pharmacologic activity, i.e., downregulation of target mRNA, of TPI ASM8 and TPI 1100 was confirmed in monkey PBMC [10] and in monkey fibroblast CYNOM-K1 cells (data not shown), respectively, indicating that AONs would have pharmacologic activity in monkeys. During the inhalation studies with TPI ASM8 and TPI 1100, no deaths were reported, and the monkeys tolerated the administered dosages well. No effects on body weight, food consumption, electrocardiography, ophthalmoscopy or clinical pathology parameters were observed. Moreover, hypersensitivity testing revealed no effect of drug administration. Analysis of the plasma levels of Bb, a split complement product that serves as a marker for alternative pathway activation, revealed no AON-related elevations in any animals. In addition, the timed samples for analysis of coagulation parameters (APTT and PT) did not reveal any treatment-related changes (data not shown). At Day 15 necropsy for the TPI ASM8 study, there were sporadic observations in the lungs of the monkeys, including dark areas and adhesions (see Table 4). Although the incidence of these miscellaneous findings was slightly greater in the high-dose group, no clear treatment-related pattern was evident. The only other macroscopic change noted in the TPI ASM8 study that was considered to be possibly treatment-related was a pale discoloration of the kidneys in some of the high-dose animals terminated on Day 15 (data not shown). However, in the absence of corroboratory microscopic alterations, clinical pathology findings, or kidney weight changes, this finding was considered of little toxicological significance and of questionable relationship to TPI ASM8 administration. Moreover, these changes regressed following the 14-day recovery period. All other macroscopic findings in the TPI ASM8 study were similar between all groups and were considered to reflect normal background incidences. In the TPI 1100 study, there were no necropsy findings that were regarded as treatment-related.

No treatment-related effects on organ weight including lung plus trachea were evident in both TPI ASM8 and TPI 1100 studies. Some treatment-related microscopic changes were observed in the respiratory system and were very similar for both TPI ASM8 and TPI 1100. The principal findings in the lung and bronchial lymph node are summarized in Table 5. For the animals terminated on Day 15 in the TPI ASM8 study, ‘‘foamy’’ alveolar macrophages were observed in animals that received the highest dose level of 2.5 mg/kg/day (graded minimal to mild) and in half of the animals treated with the mid-dose level of 0.25 mg/kg/day (graded minimal). In the high-dose group, there were also a few animals with intra-alveolar granulocytic inflammation, two with focal hemorrhage and one with focal bronchiolar metaplasia. Foamy macrophages were also present in bronchial lymph nodes of animals that received the high-dose level of TPI ASM8 (2.5 mg/kg/day). The severity of the changes observed in the lungs of mid- and high-dose animals were generally minor and were not accompanied by evidence of local damage to the lung parenchyma. Moreover, the presence of these alveolar macrophages in the lung was observed only in 3 of 6 mid-dose (0.25 mg/kg/day) monkeys, and this change received the lowest severity grade (i.e., minimal). The foamy appearance of macrophages in the lungs was consistent with normal pulmonary mechanisms associated with phagocytosis and clearance of an inhaled test material. Similarly, the presence of foamy macrophages in the bronchial lymph nodes in high-dose animals was consistent with clearance of the test material by lymphatic drainage from the lungs. Importantly, there were no treatmentrelated findings of inflammatory cellular infiltrate. The incidence of this key microscopic finding was comparable in control and TPI ASM8-treated animals. Following the 14-day recovery period, a few foamy alveolar macrophages were still present in one of the two monkeys treated with the high dose of TPI ASM8, but again there was no sign of inflammation. This observation was consistent with reduced pulmonary clearance at this time point and indicated that there was no progressive or persistent alteration to the lung parenchyma. In addition, there was no evidence of parenchymal damage, and the lymph nodes did not appear to be in a reactive state. In the TPI 1100 study, changes in the lungs and bronchial lymph nodes were observed only in high-dose animals on Day 15, with no changes observed in the mid- or low-dose groups. The lungs of animals treated with the high-dose level of TPI 1100 (2.5 mg/kg/day) only had minimal to mild accumulation of macrophages in alveolar lumens, while bronchial lymph nodes had minimal to mild sinus histiocytosis (increases in the macrophage population). Again, the findings in lung and bronchial lymph node most likely reflected clearance of the inhaled test article. Following 28 days of recovery, complete reversal of the

Table 4 Summary of treatment-related macroscopic changes in the lungs TPI ASM8 (mg/kg/day)

TPI 1100 (mg/kg/day)

Main (Day 15) 0 Non-collapsing Dark area (s) Pale area (s) Adhesion (s) Cyst (s) Gelatinous material Mottled

0.05

0.25

2.5

Recovery (Day 29)

Main (Day 15)

0

0

2.5

0.05

1/6 2/6

1/6 1/6 1/6

0.25

2.5

1/6 1/1

1/6

Recovery (Day 42)

1/6

1/6

1/6 1/6

Values represent number of animals in which change was observed per number of animals examined.

0

2.5

ARTICLE IN PRESS A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

849

Table 5 Summary of primary treatment-related histopathologic changes in the lungs TPI ASM8 (mg/kg/day)

TPI 1100 (mg/kg/day)

Main (Day 15)

Lung Pigment Minimal Moderate

Recovery (Day 29)

Main (Day 15)

Recovery (Day 42)

0

0.05

0.25

2.5

0

2.5

0

0.05

0.25

2.5

0

2.5

6/6

6/6

5/6 1/6

6/6

2/2

2/2

5/6 1/6

3/6

5/6

6/6

2/2

4/4

3/6

2/6 4/6

Accumulation of macrophages, foamy Minimal Mild

1/2

3/6 3/6

Macrophage accumulation, alveolar, non-foamy Minimal Mild Infiltrate, mixed cell/inflammation Minimal 2/6 4/6

2/6

3/6 3/6

3/6

1/1

3/6

Fibrosis Mild

2/6

Metaplasia, bronchilar Minimal

1/6

Haemorrhage, focal Minimal Mild

1/6 1/6

5/6

Accumulation of macrophages, foamy Minimal Histiocytosis, sinus Minimal 1/6 Mild

1/6

3/6

1/2

3/4

5/6

3/6

2/2

4/4

1/6

Inflammation, intra-alveolar, granulocytic Minimal

Lymph node, bronchial Pigment Minimal 4/6 Moderate 1/6

2/6

5/6

5/6 1/6

6/6

1/2

2/2

5/6 1/6

2/2

4/6

1/6

1/6

2/6 4/6

2/4 1/4

Values represent number of animals in which change was observed per number of animals examined.

lung alterations was noted in all high-dose animals, and there was an indication of ongoing reversal of alterations in the bronchial lymph nodes. The difference in the terminology used to describe the macrophage response between the two studies (i.e., ‘‘foamy’’ appearance in the TPI ASM8 study and ‘‘accumulation’’ in the TPI 1100 study) most likely reflects the fact that different pathologists were involved in the two studies. There may also have been a difference in staining of the tissue sections that tended to reveal a more foamy appearance to the macrophages in the TPI ASM8 study. However, it is clear that the response is qualitatively similar between the two AON-containing products and generally reflects ongoing macrophage-mediated clearance of the inhaled material.

3.2. Plasma pharmacokinetics Plasma levels of TPI ASM8 AONs (TOP004 and TOP005) could only be measured in the high-dose (2.5 mg/kg/day) animals. In these animals, the plasma pharmacokinetics of TOP004 and TOP005 exhibited similar profiles, with mean peak plasma concentrations (Cmax) reaching only 6.2 and 9.9 ng/mL, respectively, at 30 min post-dosing before declining in a monoexponential manner (Fig. 2A, Table 6). The proximal metabolites

of TOP004 and TOP005 formed by presumed exonucleasemediated cleavage of a terminal nucleotide (referred to as ‘‘n-1’’) were detected at the first sampling time of 30 min post-dose (Fig. 2A), but the concentrations were very low. The plasma concentration profile of the n-1 metabolites followed that of their parent AON, with a continuous decline at all subsequent sampling times. Consistent with relatively rapid distribution from plasma, Day 14 data did not show any evidence of measurable accumulation of the AONs in plasma (Fig. 2B, Table 6). Similar to TPI ASM8, plasma concentrations of TPI 1100 AONs (TOP1572 and TOP1731) after a single exposure by inhalation could only be measured in monkeys from the high-dose group (2.5 mg/kg) (Fig. 3, Tables 7 and 8). As observed with TPI ASM8, maximal plasma concentration of the TPI 1100 AON constituents (full length) was achieved at 30 min following a single exposure by inhalation (high-dose mean Cmax of 5.1 ng/mL for TOP1572 and 7.7 ng/mL for TOP1731). Again, Day 14 data indicated that there was no evidence of accumulation (Table 8).

3.3. Tissue distribution The concentrations of the AON constituents of TPI ASM8 and of TPI 1100 were determined in various organs 24 h after last dose

ARTICLE IN PRESS 850

A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

Table 6 Summary of pharmacokinetic analysis for TPI ASM8 constituents TOP004 and TOP005 in monkey plasma samples

TOP004 Dose 1

Dose 14

TOP005 Dose 1

Dose 14

Dose (mg/kg)

Cmax (ng/mL)

0.05 0.25 2.5

0 0 6.2 (1.6)

0 0 30

0.05 0.25 2.5

0 0 2.8 (2.7)

0 0 360

0.05 0.25 2.5

0 0 9.9 (4.3)

0 0 30

0.05 0.25 2.5

0 0 6.7 (1.9)

0 0 30

Tmax (min)

Data are mean values (SEM). Zero values were oLLOQ.

Fig. 2. Pharmacokinetic profiles of TPI ASM8 AON constituents TOP004 and TOP005, and their proximal 50 -end n-1 metabolites, in plasma of cynomolgus monkeys. Concentrations were measured using a hybridization–ligation ELISA after a single exposure by inhalation (A) or after exposure for 14 consecutive days (B) (LLOQ: 1.2 ng/mL for TOP004 and 0.12 ng/mL for TOP005). Each data point is the average of 8 animals7SEM.

(Day 15) and at the end of the recovery period (Day 29 for TPI ASM8 and Day 42 for TPI 1100). For the TPI ASM8 study, the analysis was limited to trachea samples collected from the highest dose group (2.5 mg/kg/day) (Table 7). At the end of the dosing period (Day 15), appreciable quantities of the intact AON components of TPI ASM8 (TOP004 and TOP005) as well as their proximal n-1 metabolites were detected in the trachea of the high-dose animals. In this group, the total amount of TPI ASM8 (combined amounts of TOP004 and TOP005) measured in the whole organ was 2.5 mg, which represents a very low percentage of the administered dose. At the end of the 14-day recovery period (Day 29), the levels of TOP004 had diminished only to a minor extent, relative to Day 15 levels. In contrast, no TOP005 could be quantified in the trachea of the recovery animals, which suggests a possible difference in tissue stability between the AONs. Although tissue half-life was not determined in monkey, studies in mice indicated slight differences in tissue stability between TOP004 and TOP005 which could explain in part the differences in the levels quantified in monkey. In addition, difference in the sensitivity of the hybridization assay used to quantify each AON could also explain some of the differences. For the TPI 1100 study, analysis for the presence of the AON constituents was performed in the lung, liver, and kidney

Fig. 3. Pharmacokinetic profiles of TPI 1100 AON constituents TOP1572 and TOP1731 in the plasma of cynomolgus monkeys. Concentrations were measured using a hybridization ELISA after a single exposure by inhalation (LLOQ: 9.2 ng/mL for TOP1572 and 5.62 ng/mL for TOP1731). Each data point is the average of 10 animals7SEM.

(Table 9). As expected, the results indicated the presence of intact AON constituents in the lungs of monkeys at the end of the 14-day treatment period. Moreover, the amounts of TPI 1100s AON constituents present in the lungs exhibited a dose–response, with the highest amounts measured in the high-dose group (2.5 mg/kg/day) (Fig. 4). In the latter group, the combined amount of the TPI 1100 AON constituents measured in the whole lung was 1.27 mg/organ, compared to 0.100 and 0.018 mg/organ in the mid- and low-dose groups, respectively. Assuming an average body weight for the monkeys of 2.5 kg, the average total daily dose administered to the high-dose animals was 6.25 mg; hence, the amount of AON present in lungs of high-dose TPI 1100-treated animals 1 day after the last dose was only approximately 20% of the daily dosage, which suggests that the AONs did not accumulate in lung tissue over the 14-day dosing period. The analysis of the kidney tissues samples revealed that measurable amounts of TPI 1100s AONs could only be observed in high-dose animals (Table 9). On average, the combined amount of the TPI 1100 AONs measured in the kidney was 0.023 mg/organ. In the

ARTICLE IN PRESS A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

851

Table 7 Summary of analysis of TPI ASM8 constituents in trachea samples (high-dose monkeys; target dose level of 2.5 mg/kg/day) Sacrifice time (Day)

TOP004 (ng/mg)

TOP004 n-1 (ng/mg)

TOP005 (ng/mg)

TOP005 n-1 (ng/mg)

15 29

6.8 (2.0) 4.3 (0.3)

0.9 (0.2) 0.5 (0.0)

1.9 (1.2) 0

1.0 (0.5) 0

Data are mean values (SEM). Zero values were oLLOQ.

Table 8 Summary of pharmacokinetic analysis for TPI 1100 constituents TOP1572 and TOP1731 in monkey plasma samples

TOP1572 Dose 1

Dose 14

TOP1731 Dose 1

Dose 14

Dose (mg/kg)

Cmax (ng/mL)

Tmax (min)

0.05 0.25 2.5

0 0 5.1 (2.7)

– – 30

0.05 0.25 2.5

0 0 0

– – –

0.05 0.25 2.5

0 0 7.7 (2.5)

– – 30

0.05 0.25 2.5

0 0 0

– – –

Data are mean values (SEM). Zero values were oLLOQ.

4. Discussion

Table 9 Summary of analysis of TPI 1100 constituents in tissue samples Tissue

Day

Dose (mg/kg)

TOP1572 (ng/mg)

TOP1731 (ng/mg)

Lung

15

0.05 0.25 2.5 2.5

0.5 (0.1) 1.2 (0.2) 15.7 (4.4) 1.0 (0.1)

1.0 (0.2) 7.0 (1.7) 88.4 (29.2) 2.0 (0.1)

0.05 0.25 2.5 2.5

0.2a 0 0.8 (0.2) 0

0 0 1.3 (0.4) 0

0.05 0.25 2.5 2.5

0 0 0 0

0 0 0.2 (0.1) 0

42 Kidney

15

42 Liver

15

42

Fig. 4. Concentration of TPI 1100 AON constituents TOP1572 and TOP1731 in the lung of cynomolgus monkeys. Concentrations were measured using hybridization ELISA after exposure by inhalation for 14 consecutive days (LLOQ: 9.2 ng/mL for TOP1572 and 5.62 ng/mL for TOP1731). Each data point is the average of 6 animals7SEM.

Data are mean values (SEM). Zero values were oLLOQ. a Quantification could only be achieved in one sample.

liver, only one of the two constituents of TPI 1100 and TOP1731 could be quantified in the high-dose animals. Again, the difference between the levels of TPI 1100 AONs in lung, liver, and kidney may be due in part to differences in tissue half-life of TOP1572 and TOP1731, and a difference in the sensitivity and selectivity of the hybridization method used to quantify each AON. While the hybridization assay used was developed specifically for the full-length AON, the assay for TOP1731 could partially detect its 50 n-1 metabolite which could account for the higher amounts measured (data not shown). Finally, as expected, only minimal amounts of the TPI 1100 AON constituents could be measured in the lung samples collected after a 28-day recovery period, and no measurable amounts were present in the kidney and liver (Table 9).

A major impediment to the development of antisense therapeutics is the difficulty of non-invasive and targeted delivery and in turn achieving effective tissue concentrations without eliciting adverse effects. Most oligonucleotides are highly charged (polyanionic) and non-specifically reactive molecules, and they must additionally withstand the rigors of transport via the bloodstream and uptake into target cells or various other matrices, all of which are laden with nuclease enzymes capable of rapidly degrading natural nucleic acid structures. During the last two decades, the most common strategy for imparting drug-like properties to AONs is to introduce chemical modifications that afford dramatically increased nuclease resistance, which effectively achieves greater stability in blood and tissues. The most common chemical modification that is present in the majority of AON drugs is the substitution of a sulfur atom for one of the non-bonding oxygens in each internucleotide linkage of the phosphodiester backbone (i.e., the phosphorothioate chemistry). This modification (and other related backbone alterations) typically strengthen the polyanionic character of the molecule and renders it more reactive. This, in addition to the greater tissue persistence, translates into more pronounced non-specific effects, such that systemic administration of phosphorothioate AONs results in various forms of toxicity that are largely class effects and unrelated to the mechanism of action, i.e., hybridization-independent. Manifestations of toxicity that are most commonly observed following systemic delivery of phosphorothioate oligonucleotides include thrombocytopenia, activation of the alternative complement pathway (and possible downstream sequelae, including hypotension), inhibition of the intrinsic coagulation cascade (reflected by prolongation of APTT), and various changes in tissues (observed in animal studies), which are typically most

ARTICLE IN PRESS 852

A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

prominent in the major organs of uptake such as kidneys, liver, and spleen [2,4]. Another practical limitation is that parenteral administration of AONs is by its nature not targeted and therefore requires high doses in order to achieve concentrations in target tissues sufficient for efficacy. In contrast, the lung represents a unique target organ for AON therapy, as it is readily accessible by direct and non-invasive delivery to the site of action (via inhalation), whilst minimizing systemic exposure and virtually eliminating the risk for adverse effects on internal organs as well as the known blood-levelrelated toxicities noted above. Indeed, our results show that significant amounts of TPI ASM8 and TPI 1100 AONs were measured in the trachea and lung of monkeys following inhalation for 14 consecutive days whereas very low levels of AON were measured in plasma, kidney, and liver (less than 2% of the amount measured in the lung). Utilizing a highly sensitive hybridization assay (ELISA format), the presence of intact TPI 1100 AONs in the kidney and liver could only be detected in the high-dose group. These two organs are the major tissues of uptake of AONs when given by systemic administration [44]. Therefore, the absence of detectable AON in these organs suggests that, at low doses, the AONs were effectively confined to the lung or that any systemic AON was cleared effectively. The limited amounts of AON found in the liver and kidney are consistent with the very low plasma levels of TPI ASM8 and TPI 1100 AONs. Plasma AON levels were quantifiable only in high-dose animals, and the levels were generally less than 10 ng/mL, which is orders of magnitude below the mg/mL levels that are measured in animals given intravenous doses of AONs [33,45]. Migration of the AONs into the systemic circulation was relatively slow, with a Tmax at 30 min after inhalation exposure, in accordance with previous reports of plasma pharmacokinetics following pulmonary delivery in mice [36] and rabbits [40]. This absorption phase differs significantly from the typical pharmacokinetic profiles seen with intravenous administration, which is characterized by rapid clearance from plasma following injection or infusion [33,37,46]. As would be expected from the low systemic uptake, repeated doses did not result in accumulation of the AONs in plasma. Although tissue accumulation was not evaluated in these studies, data from a 14-day inhalation study of TPI 1100 in mice demonstrated accumulation of AON in the lung between the first and last doses. Despite this local accumulation, there was no accumulation in plasma and other tissues such as liver and kidney (data not shown). Finally, treatment-related microscopic changes following inhalation of TPI ASM8 or TPI 1100 for 14 consecutives days at doses up to 2.5 mg/kg/day were restricted to the respiratory tract, which attests to the absence of significant systemic exposure. While studies were not designed to assess the pharmacologic activity of the drugs, an attempt was made at measuring the relative levels of the target mRNAs in the trachea of TPI ASM8 treated animals. Using semi-quantitative RT-PCR, a decrease in bc and CCR3 mRNA levels, 20% and 16%, respectively, was measured in TPI ASM8 treated animals compared to controls confirming the pharmacologic activity of TPI ASM8 in monkeys. These results suggest that the alterations observed in the respiratory tract may not be solely due to the delivery of the AON but also include the functional consequence (target mRNA knockdown) of administering the drug. As mentioned above, a primary concern about systemic delivery of AONs is the occurrence of non-specific toxicity attributable to the chemical structure of the AON. In particular, the blood-level-related class effects of phosphorothioate oligonucleotides have been a major issue with intravenous dosing, and non-human primates have been shown to be an appropriate model for investigating these toxicities. The two primary effects in this category are: (1) activation of the alternative complement

pathway, which is typically assessed by monitoring plasma levels of the alternative pathway split product, Bb, and (2) inhibition of the intrinsic coagulation cascade, which is reflected by prolongation of APTT [4,45]. It is well recognized that these effects are closely related to the oligonucleotide blood levels. Hence, it was not surprising that these effects were absent in the inhalation studies conducted with TPI ASM8 and TPI 1100, as the plasma AON concentrations measured in the monkeys were orders of magnitude below the range that has been reported to induce these effects [34,47,48]. In addition, apart from changes in the pulmonary tract, there were no histomorphologic alterations in any of the numerous tissues examined microscopically in both studies, and no changes in clinical pathology parameters were noted. Therefore, effects of the inhaled AONs were limited to the respiratory tract. Delivery by inhalation of TPI ASM8 or of TPI 1100 for 14 consecutive days was associated with relatively benign alterations in the respiratory tract which were principally characterized by accumulation of foamy macrophages and histiocytosis (an increased number of macrophages). The macrophages and histiocytes contained intracytoplasmic basophilic granular material, which most likely reflects the clearance of the inhaled AONs. While today there are no other reports in the open literature describing the effects of inhaled oligonucleotides on alveolar macrophages, basophilic granulation has been reported to be observed in various tissues of animals administered with oligonucleotides systemically, and the organs exhibiting basophilic granulation are typically those that are major sites of deposition of the oligonucleotide [49]. It is well recognized that this granular material reflects deposition and clearance of the oligonucleotide in the cell type(s) in which this is observed. For systemically administered oligonucleotides, the granulation is commonly seen in resident macrophages of the spleen, lymph nodes, and liver (Kupffer cells), in addition to the proximal tubule cells in the kidney. The uptake of oligonucleotide by resident macrophages is often accompanied by increases in the number of macrophages (histiocytosis), which reflects an induced clearance process for the oligonucleotide. Reasor et al. [50] showed that the foamy appearance of macrophages does not impair pulmonary host defense processes. The presence of foamy macrophages is not limited to a response to oligonucleotides as there is a growing body of evidence of inhaled and non-inhaled small-molecule drugs, many of which are marketed, that have been associated with the presence and accumulation of foamy macrophages [51] including Tobramycin [52] which is currently used as an inhaled antibiotic in both adults and pediatrics and has been shown to be safe and well tolerated in patients with cystic fibrosis [53]. As such, the changes observed with the inhaled oligonucleotides are considered relatively benign and not a distinct or isolated response to AON therapy. Furthermore, in accordance with previous reports on foamy macrophages [54], withdrawal of treatment resulted with complete or ongoing reversal of alterations after a 14- or 28-day recovery period. Most importantly, there was no evidence of progressive or persistent alterations in the lung parenchyma and there was no evidence of a generalized inflammatory response in the lung as evidenced by a lack of cellular infiltrate. Indeed, human data support a reduction (not an increase) in key inflammatory as well as total cells in sputum of asthmatic patients following treatment with TPI ASM8 [22]. And these findings are consistent with data from pre-clinical studies with both TPI ASM8 and TPI 1100. Moreover, the efficacy of TPI ASM8 in the Phase 2 trial was achieved at an estimated delivered dose 3-logs lower than the highest achieved dose in the monkey study demonstrating a wide margin of safety of the drug. In summary, inhalation administration of TPI ASM8 and TPI 1100 for 14 consecutive days at doses up to 2.5 mg/kg/day was

ARTICLE IN PRESS A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

well tolerated and produced no significant manifestations of toxicity. Thus, local delivery of AON directly to the target tissue (lung) presents key advantages over systemic delivery, as it achieves appreciable local concentrations of AONs at lower administered doses that show pharmacologic activity with limited systemic exposure and no systemic toxicity. The favorable safety and pharmacokinetic profiles of TPI ASM8 and TPI 1100 established with inhalation administration bode well for further development of these products for the treatment of asthma and COPD.

[20]

[21] [22]

[23]

[24]

Acknowledgment [25]

The authors are grateful to Drs. Doug Kornbrust (Preclinsight), Mark Parry-Billings, and Rosanne Seguin for critical reading of the manuscript.

[26]

[27]

References [1] Zamecnik PC, Stephenson ML. Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. Proc Natl Acad Sci USA 1978;75(1):280–4. [2] Jason TLH, Koropatnick J, Berg RW. Toxicology of antisense therapeutics. Toxicol Appl Pharmacol 2004;201(1):66–83. [3] Kurreck J. Antisense technologies: improvement through novel chemical modifications. Eur J Biochem 2003;270(8):1628–44. [4] Levin AA. A review of the issues in the pharmacokinetics and toxicology of phosphorothioate antisense oligonucleotides. Biochim Biophys Acta 1999; 1489(1):69–84. [5] Ferrari N, Bergeron D, Tedeschi A-L, Mangos MM, Paquet L, Renzi PM, et al. Characterization of antisense oligonucleotides comprising 20 -deoxy-20 -fluorobeta-D-arabinonucleic acid (FANA): specificity, potency, and duration of activity. Ann NY Acad Sci 2006;1082(1):91–102. [6] McKay RA, Miraglia LJ, Cummins LL, Owens SR, Sasmor H, Dean NM. Characterization of a potent and specific class of antisense oligonucleotide inhibitor of human protein kinase C-alpha expression. J Biol Chem 1999; 274(3):1715–22. [7] Sternberger M, Schmiedeknecht A, Kretschmer A, Gebhardt F, Leenders F, Czauderna F, et al. GeneBlocs are powerful tools to study and delineate signal transduction processes that regulate cell growth and transformation. Antisense Nucleic Acid Drug Dev 2002;12(3):131–43. [8] Wahlestedt C, Salmi P, Good L, Kela J, Johnsson T, Hokfelt T, et al. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. PNAS 2000;97(10):5633–8. [9] Yoo BH, Bochkareva E, Bochkarev A, Mou T-C, Gray DM. 20 -O-methyl-modified phosphorothioate antisense oligonucleotides have reduced non-specific effects in vitro. Nucleic Acids Res 2004;32(6):2008–16. [10] Allakhverdi Z, Allam M, Guimond A, Ferrari N, Zemzoumi K, Seguin R, et al. Multitargeted approach using antisense oligonucleotides for the treatment of asthma. Ann NY Acad Sci 2006;1082(1):62–73. [11] Allakhverdi Z, Allam M, Renzi PM. Inhibition of antigen-induced eosinophilia and airway hyperresponsiveness by antisense oligonucleotides directed against the common beta chain of IL-3, IL-5, GM-CSF receptors in a rat model of allergic asthma. Am J Respir Crit Care Med 2002;165(7):1015–21. [12] Allam M, Renzi PM. Inhibition of GM-CSF/IL-3/IL-5 signaling by antisense oligodeoxynucleotides targeting the common beta chain of their receptors. Antisense Nucleic Acid Drug Dev 2001;11(5):289–300. [13] Fortin M, Ferrari N, Higgins M-E, Seguin S, Allam M, Allakhverdi Z, et al. Effects of antisense oligodeoxynucleotides targeting CCR3 on the airway response to antigen in rats. Oligonucleotides 2006;16(3):203–12. [14] Combadiere C, Ahuja SK, Murphy PM. Cloning and functional expression of a human eosinophil CC chemokine receptor. J Biol Chem 1995;270(28): 16491–4. [15] Griffiths-Johnson D, Collins P, Rossi A, Jose P, Williams T. The chemokine, eotaxin, activates guinea-pig eosinophils in vitro and causes their accumulation into the lung in vivo. Biochem Biophys Res Commun 1993;197(3): 1167–72. [16] Jose PJ, Griffiths-Johnson DA, Collins PD, Walsh DT, Moqbel R, Totty NF, et al. Eotaxin: a potent eosinophil chemoattractant cytokine detected in a guinea pig model of allergic airways inflammation. J Exp Med 1994;179(3):881–7. [17] Allen JS, Eisma R, Leonard G, Kreutzer D. Interleukin-3 interleukin-5, and granulocyte-macrophage colony-stimulating factor expression in nasal polyps. Am J Otolaryngol 1997;18(4):239–46. [18] Lantero S, Sacco O, Scala C, Rossi GA. Stimulation of blood mononuclear cells of atopic children with the relevant allergen induces the release of eosinophil chemotaxins such as IL-3, IL-5, and GM-CSF. J Asthma 1997;34(2):141–52. [19] Robb L, Drinkwater CC, Metcalf D, Li R, Kontgen F, Nicola NA, et al. Hematopoietic and lung abnormalities in mice with a null mutation of the

[28]

[29] [30] [31] [32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

853

common {beta} subunit of the receptors for granulocyte-macrophage colonystimulating factor and Interleukins 3 and 5. PNAS 1995;92(21):9565–9. Shearer WT, Rosenwasser LJ, Bochner BS, Martinez-Moczygemba M, Huston DP. Biology of common [beta] receptor-signaling cytokines: IL-3, IL-5, and GM-CSF. J Allergy Clin Immunol 2003;112(4):653–65. Spicuzza L, Di Maria G, Polosa R. Adenosine in the airways: implications and applications. Eur J Pharmacol 2006;533(1–3):77–88. Gauvreau GM, Boulet LP, Cockcroft DW, Baatjes A, Cote J, Deschesnes F, et al. Antisense therapy against CCR3 and the common beta chain attenuates allergen-induced responses. Am J Respir Crit Care Med 2008; 200708201251OC. Ariga M, Neitzert B, Nakae S, Mottin G, Bertrand C, Pruniaux MP, et al. Nonredundant function of phosphodiesterases 4D and 4B in neutrophil recruitment to the site of inflammation. J Immunol 2004;173(12):7531–8. Jin SLC, Lan L, Zoudilova M, Conti M. Specific role of phosphodiesterase 4B in lipopolysaccharide-induced signaling in mouse macrophages. J Immunol 2005;175(3):1523–31. Lee R, Wolda S, Moon E, Esselstyn J, Hertel C, Lerner A. PDE7A is expressed in human B-lymphocytes and is up-regulated by elevation of intracellular cAMP. Cell Signal 2002;14(3):277–84. Nakata A, Ogawa K, Sasaki T, Koyama N, Wada K, Kotera J, et al. Potential role of phosphodiesterase 7 in human T cell function: comparative effects of two phosphodiesterase inhibitors. Clin Exp Immunol 2002;128(3):460–6. Spina D, Landells L, Page C. The role of phosphodiesterase enzymes in allergy and asthma. Adv Pharmacol 1998;44:33–89. Tang H-F, Chen J-Q, Xie Q-M, Zheng X-Y, Zhu Y-L, Adcock I, et al. The role of PDE4 in pulmonary inflammation and goblet cell hyperplasia in allergic rats. Biochim Biophys Acta 2006;1762(5):525–32. Fan Chung K. Phosphodiesterase inhibitors in airways disease. Eur J Pharmacol 2006;533(1–3):110–7. Giembycz MA, Smith SJ. Phosphodiesterase 7A: a new therapeutic target for alleviating chronic inflammation? Curr Pharm Des 2006;12(25):3207–20. Huang Z, Mancini JA. Phosphodiesterase 4 inhibitors for the treatment of asthma and COPD. Curr Med Chem 2006;13(27):3253–62. Danahay H, Giddings J, Christian RA, Moser HE, Phillips JA. Distribution of a 20-Mer phosphorothioate oligonucleotide, CGP69846A (ISIS 5132), into airway leukocytes and epithelial cells following intratracheal delivery to Brown–Norway rats. Pharm Res 1999;16(10):1542–9. Geary R, Yu R, Watanabe T, Henry S, Hardee G, Chappell A, et al. Pharmacokinetics of a tumor necrosis factor-{alpha} phosphorothioate 20 -o(2-methoxyethyl) modified antisense oligonucleotide: comparison across species. Drug Metab Dispos 2003;31(11):1419–28. Geary RS, Leeds JM, Fitchett J, Burckin T, Truong L, Spainhour C, et al. Pharmacokinetics and metabolism in mice of a phosphorothioate oligonucleotide antisense inhibitor of C-raf-1 kinase expression. Drug Metab Dispos 1997;25(11):1272–81. Geary RS, Watanabe TA, Truong L, Freier S, Lesnik EA, Sioufi NB, et al. Pharmacokinetic properties of 20 -O-(2-methoxyethyl)-modified oligonucleotide analogs in rats. J Pharmacol Exp Ther 2001;296(3):890–7. Templin M, Levin A, Graham M, Aberg P, Axelsson B, Butler M, et al. Pharmacokinetic and toxicity profile of a phosphorothioate oligonucleotide following inhalation delivery to lung in mice. Antisense Nucleic Acid Drug Dev 2000;10(5):359–68. Yu RZ, Geary RS, Leeds JL, Watanabe T, Moore MD, Fitchett J, et al. Comparison of pharmacokinetics and tissue disposition of an antisense phosphorothioate oligonucleotide targeting human Ha-ras mRNA in mouse and monkey. J Pharm Sci 2001;90(2):182–93. Chi KN, Eisenhauer E, Fazli L, Jones EC, Goldenberg SL, Powers J, et al. A phase I pharmacokinetic and pharmacodynamic study of OGX-011, a 20 -methoxyethyl antisense oligonucleotide to clusterin, in patients with localized prostate cancer. J Natl Cancer Inst 2005;97(17):1287–96. Tolcher AW, Chi K, Kuhn J, Gleave M, Patnaik A, Takimoto C, et al. A phase II, pharmacokinetic, and biological correlative study of oblimersen sodium and docetaxel in patients with hormone-refractory prostate cancer. Clin Cancer Res 2005;11(10):3854–61. Ali S, Leonard SA, Kukoly CA, James Metzger W, Wooles WR, McGinty JF, et al. Absorption, distribution, metabolism, and excretion of a respirable Antisense Oligonucleotide for asthma. Am J Respir Crit Care Med 2001;163(4):989–93. Bide RW, Armour SJ, Yee E. Allometric respiration/body mass data for animals to be used for estimates of inhalation toxicity to young adult humans. J Appl Toxicol 2000;20(4):273–90. Yu RZ, Baker BF, Chappell A, Geary RS, Cheung E, Levin AA. Development of an ultrasensitive noncompetitive hybridization–ligation enzyme-linked immunosorbent assay for the determination of phosphorothioate oligodeoxynucleotide in plasma. Anal Biochem 2002;304(1):19–25. Efler SM, Zhang L, Noll BO, Uhlmann E, Davis HL. Quantification of oligodeoxynucleotides in human plasma with a novel hybridization assay offers greatly enhanced sensitivity over capillary gel electrophoresis. Oligonucleotides 2005;15(2):119–31. Geary RS, Leeds JM, Henry SP, Monteith DK, Levin AA. Antisense oligonucleotide inhibitors for the treatment of cancer: 1. Pharmacokinetic properties of phosphorothioate oligodeoxynucleotides. Anticancer Drug Des 1997;12(5): 383–93. Yu RZ, Geary RS, Monteith DK, Matson J, Truong L, Fitchett J, et al. Tissue disposition of 20 -O-(2-methoxy) ethyl modified antisense oligonucleotides in monkeys. J Pharm Sci 2004;93(1):48–59.

ARTICLE IN PRESS 854

A. Guimond et al. / Pulmonary Pharmacology & Therapeutics 21 (2008) 845–854

[46] Geary RS, Leeds JM, Fitchett J, Burckin T, Truong L, Spainhour C, et al. Pharmacokinetics and metabolism in mice of a phosphorothioate oligonucleotide antisense inhibitor of C-raf-1 kinase expression. Drug Metab Dispos 1997;25(11):1272–81. [47] Henry SP, Beattie G, Yeh G, Chappel A, Giclas P, Mortari A, et al. Complement activation is responsible for acute toxicities in rhesus monkeys treated with a phosphorothioate oligodeoxynucleotide. Int Immunopharmacol 2002;2(12): 1657–66. [48] Henry SP, Novotny W, Leeds J, Auletta C, Kornbrust DJ. Inhibition of coagulation by a phosphorothioate oligonucleotide. Antisense Nucleic Acid Drug Dev 1997;7(5):503–10. [49] Levin AA, Monteith DK, Leeds JM, Nicklin PL, Geary RS, Butler M, et al. Toxicity of oligonucleotide therapeutic agents. In: Born GVR, et al., editors. Handbook of experimental pharmacology. Berlin: Springer; 1998. p. 169–215.

[50] Reasor MJ, McCloud CM, DiMatteo M, Schafer R, Ima A, Lemaire I. Effects of amiodarone-induced phospholipidosis on pulmonary host defense functions in rats. Proc Soc Exp Biol Med 1996;211(4):346–52. [51] Reasor MJ, Hastings KL, Ulrich RG. Drug-induced phospholipidosis: issues and future directions. Expert Opin Drug Saf 2006;5(4):567–83. [52] De Broe ME, Paulus GJ, Verpooten GA, Roels F, Buyssens N, Wedeen R, et al. Early effects of gentamicin, tobramycin, and amikacin on the human kidney. Kidney Int 1984;25(4):643–52. [53] Lenoir G, Antypkin YG, Miano A, Moretti P, Zanda M, Varoli G, et al. Efficacy, safety, and local pharmacokinetics of highly concentrated nebulized tobramycin in patients with cystic fibrosis colonized with Pseudomonas aeruginosa. Paediatr Drugs 2007;9:11–20. [54] McCloud CM, Beard TL, Kacew S, Reasor MJ. In vivo and in vitro reversibility of chlorphentermine-induced phospholipidosis in rat alveolar macrophages. Exp Mol Pathol 1995;62(1):12–21.