Aeromonas salmonicida induced immune gene expression in Aloe vera fed steelhead trout, Oncorhynchus mykiss (Walbaum)

Aquaculture 435 (2015) 1–9

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aqua-online

Aeromonas salmonicida induced immune gene expression in Aloe vera fed steelhead trout, Oncorhynchus mykiss (Walbaum) F.S. Zanuzzo a,⁎, E.C. Urbinati a, M.L. Rise b, J.R. Hall b, G.W. Nash b, A.K. Gamperl b a b

Centro de Aquicultura da Unesp, Universidade Estadual Paulista — UNESP, Via de Acesso Prof. Paulo Donato Castelane, 14.884-900 Jaboticabal, SP, Brazil Department of Ocean Sciences, Memorial University of Newfoundland, St. John's, NL A1C 5S7, Canada,

a r t i c l e

i n f o

Article history: Received 8 July 2014 Received in revised form 3 September 2014 Accepted 5 September 2014 Available online 16 September 2014 Keywords: Aloe vera Steelhead trout Immune response Innate immunity Immunostimulant Gene expression

a b s t r a c t Products derived from Aloe vera are popular around the world because of their cosmetic and medicinal properties, including immunostimulatory effects, and may have beneficial uses in aquaculture. Thus, we evaluated how feeding steelhead trout (Oncorhynchus mykiss, Walbaum) A. vera powder affected their basal immune function and immune response to formalin-killed atypical Aeromonas salmonicida (ASAL). Fish were sampled (n = 12) after being fed for 6 weeks with two diets [control and the same diet with 5 g kg−1 A. vera (0.5%) added], and 3 (n = 12) and 24 (n = 12) hours after both groups received an intraperitoneal injection of ASAL or saline (PBS). Parameters measured included growth, spleen-somatic index, respiratory burst of circulating leukocytes, serum lysozyme concentration, complement system activity (alternative pathway), and the transcript expression of several important immune-related genes (interleukin-1 beta, interleukin-8, tumor necrosis factor-alpha 1, tumor necrosis factor-alpha 2, cathelicidin-1, cathelicidin-2, ferritin heavy chain and interferon regulatory factor 1)in the spleen. Neither growth (mass gain) nor spleen-somatic index were affected by six weeks of feeding with A. vera. Similarly, dietary A. vera inclusion had no effect on: 1) the respiratory activity of blood leukocytes, serum lysozyme concentration, or complement system activity; 2) the constitutive expression of the assayed immune-related genes; or 3) ASAL-induced mRNA expression of any of the selected genes. This latter finding was despite the fact that injection of ASAL resulted in a very robust immune response; ~ 3 to 1500 fold increases in the expression of all 8 immune-related genes. These data suggest that the prolonged feeding of salmonids with A. vera in an aquaculture setting will not enhance their ability to resist bacterial infection, or diminish the impact of bacterial diseases once infected. © 2014 Elsevier B.V. All rights reserved.

1. Introduction The immune system of fish has attracted considerable interest over the past decade (Kiron, 2012; Magnadottir, 2006), in large part due to the worldwide growth of the aquaculture sector and the increasing prevalence of diseases associated with intensive aquaculture operations. To prevent/diminish disease outbreaks, and thus, increase the profitability of the aquaculture industry, several approaches have been tested to increase fish immunocompetence. These include vaccination, chemotherapy and immunostimulants (Anderson and Jeney, 1992). However, a single vaccine application is only effective against one type of pathogen (Chandran et al., 2002), and the vaccination of juvenile fish is labor intensive and expensive (Murray et al., 2003). In addition, the use of antibiotics and chemotherapy agents has created issues with regard to drug resistance, toxicity and negative environmental impacts (Lim et al., 2013; Sanderson et al., 2004). These potential

⁎ Corresponding author at: Aquaculture Center, Universidade Estadual Paulista — UNESP, Jaboticabal, SP 14.884-900, Brazil, . Tel.: +55 16 981585958. E-mail address: [email protected] (F.S. Zanuzzo).

http://dx.doi.org/10.1016/j.aquaculture.2014.09.010 0044-8486/© 2014 Elsevier B.V. All rights reserved.

drawbacks suggest that immunostimulants may represent a useful alternative for the control of fish diseases. Immunostimulants are drugs or compounds that promote the activation of specific and/or non-specific defense mechanisms (Anderson and Jeney, 1992; Ganguly et al., 2010), and have been shown to be suitable for use in aquaculture (Sakai, 1999) and to enhance the disease resistance and immune response of fishes (Bricknell and Dalmo, 2005). Recently a number of studies have shown that several herbs have immunostimulant properties (Dugenci et al., 2003; Galina et al., 2009), and suggest that herbal biomedicines can be used in fish aquaculture (Citarasu, 2010) as they can be easily obtained, are inexpensive, and act against a broad spectrum of pathogens (Galina et al., 2009). For example, Yin et al. (2009) demonstrated that the Chinese herbs Astragalus radix and Ganoderma lucidum enhanced the immune response of carp (Cyprinus carpio) and protection against Aeromonas hydrophila, and Ardo et al. (2008) showed that Astragalus membranaceus and Lonicera japonica improve the non-specific immune response of Nile tilapia (Oreochromis niloticus) and resistance against A. hydrophila. The indigenous plants Leucaena leucocephala and Ficus benghalensis enhanced both specific and non-specific immune responses in Clarias gariepinus and provided disease resistance against A. hydrophila

2

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9

(Verma et al., 2013). Among herbal extracts, products derived from Aloe vera are popular around the world, due to their cosmetic and medicinal properties, including immunostimulatory effects (Djeraba and Quere, 2000; Im et al., 2005). However, little information is available about the use of A. vera in aquaculture despite the fact that an extract capable of repairing damage to fish tissues has been patented (Patentstorm, 1985), and rockfish (Sebastes schlegeli) fed a diet supplemented with 0.5% A. vera showed very low mortality (1.7%) following Vibrio alginolyticus infection as compared to 60% in the control group (Kim et al., 1999). Additionally, a recent study with matrinxã (Brycon amazonicus) has shown that the addition of A. vera extract to transport water increases leukocyte respiratory burst activity (Zanuzzo et al., 2012). Given the potential benefits of incorporating A. vera products into aquaculture feeds, this study evaluated whether feeding steelhead trout (Oncorhynchus mykiss) with A. vera powder for 6 weeks affected their growth, basal immunocompetence and immune response to formalin-killed atypical Aeromonas salmonicida (ASAL). ASAL was chosen as the immune stimulus as this pathogen is the causative agent of the disease furunculosis, and this preparation has been shown to elicit a robust anti-bacterial gene expression response in fish (Feng et al., 2009; Hori et al., 2013). 2. Material and methods The experimental procedures were approved by the Institutional Animal Care Committee of Memorial University of Newfoundland (Protocol # 13-50-KG) and performed in accordance with the guidelines of the Canadian Council on Animal Care. 2.1. Experimental animals Steelhead trout (O. mykiss) were obtained from the Marine Institute (Memorial University of Newfoundland; MUN, St. John's, Canada) and initially held at the Dr. Joe Brown Aquatic Research Building (JBARB; Ocean Sciences Centre, MUN) in a 4000 L circular tank for 1 month. During this period, seawater temperature and oxygen levels were 10 ± 1 °C and N 95% saturation, respectively, photoperiod was 12 h light:12 h dark, and the fish were fed a commercial salmonid diet (Optiline MicroBalance, Skretting, St. Andrews, NB, Canada) at a ration of 1.5% biomass daily (bwt day− 1). After acclimation, 246 fish were netted, anesthetized in seawater containing tricaine methanesulfonate (AquaLife TMS, 0.1 g L−1; Syndel Laboratories Ltd, Nanaimo, BC, Canada), weighed, and had a PIT (Passive Integrated Transponder) tag implanted in their peritoneal cavity for identification. The fish (size range 70–110 g) were allowed to recover in a 3000 L tank for 2 weeks after tagging, before being evenly distributed (~40 fish per tank) into six 500 L circular tanks. After acclimating for 1 week to these tanks, all fish were netted, anesthetized (0.1 g L− 1 TMS), and had their initial mass recorded (mean mass 133.9 ± 19.8 g). The fish were then allowed to recover for 1 week under acclimation conditions (10 ± 1 °C; O2 saturation N 95%; 12 h light: 12 h dark; feeding 1.5% bwt day−1) before they were switched to the experimental diets (see below) for 6 weeks; 3 tanks were used for each diet.

Table 1 Composition of the diets used in this experiment. Experimental diet (A. vera)

Control diet

14,700 g commercial salmon diet 1662.5 g wheat 87.5 g A. vera 875.0 g soy protein conc. 175.0 g gelatin Sum = 17,500 g

14,700 g commercial salmon diet 1750.0 g wheat No A. vera 875.0 g soy protein conc. 175.0 g gelatin Sum = 17,500 g

2.3. Preparation of bacterial antigens for injection Formalin-killed atypical ASAL was obtained in the form of a vaccine (Furogen dip, Novartis Canada, Charlottetown, PE, Canada). The vaccine was pelleted by centrifugation (2000 ×g for 10 min at 4 °C) and washed with ice-cold 0.2 μm filtered phosphate buffered saline (PBS) three times. Following the third wash, the pelleted cell debris was resuspended in ice-cold sterile PBS to an optical density of 1.0 at 600 nm wavelength (OD600) (Feng et al., 2009; Hori et al., 2013).

2.4. Sampling and experimental procedures After being fed for 6 weeks with the two diets [control (no A. vera added) and a diet with 5 g kg−1 A. vera (0.5%) added] (3 tanks per diet), 12 fish per diet treatment were quickly sampled to allow for the assessment of basal immune function and constitutive spleen transcript expression (i.e. at time 0). Thereafter, 16 fish per tank (48 fish per diet treatment) were lightly anesthetized in seawater containing 0.1 g L−1 TMS and given a 1 μL g−1 intraperitoneal (IP) injection of ASAL (Feng et al., 2009; Hori et al., 2013) or PBS (sham-injected), and 12 fish per treatment group were placed into 8 individual 500 L tanks at acclimation temperature to allow for subsequent sampling at 3 (n = 12) and 24 (n = 12) hours post-injection (HPI). This resulted in 8 experimental groups, which were: Control 3 HPI PBS, Control 24 HPI PBS, Control 3 HPI ASAL, Control 24 HPI ASAL, Aloe 3 HPI PBS, Aloe 24 HPI PBS, Aloe 3 HPI ASAL and Aloe 24 HPI ASAL. At time 0 (pre-injection) and at 3 and 24 HPI, fish were quickly euthanized (in seawater containing 0.4 g L−1 TMS), measured and weighed, 0.5 mL of blood was collected by caudal puncture, and their spleen were removed and weighed to measure the spleen-somatic index, respectively. One hundred μL of blood was immediately used in the leukocyte respiratory burst assay, whereas the remaining blood was allowed to clot on ice for 2 h, and the serum used to measure complement system (alternative pathway) activity and serum lysozyme concentration. The spleens were quickly weighed and immediately frozen in liquid nitrogen. They were then stored at − 80 °C prior to the determination of the mRNA expression of immune-related genes; interleukin-1beta (IL-1β), interleukin-8 (IL-8), tumor necrosis factor-alpha 1 (TNFα-1), tumor necrosis factor-alpha 2 (TNFα-2), cathelicidin-1 (Cath-1), cathelicidin-2 (Cath-2), ferritin heavy chain and interferon regulatory factor 1 (IRF-1).

2.5. Immunological measurements 2.2. Experimental diets The commercial salmon diet (Optiline MicroBalance: 2 mm; 8% moisture; 47% protein; 28% fat; 21.4 MJ Kg− 1 digestible energy) was ground into a powder using a food processor, and A. vera powder (Swanson Health Products, Fargo, ND, USA) was incorporated into one diet (at 5 g kg−1; 0.5%) using the below feed components (Table 1); the wheat middlings, soy protein and gelatin were included to allow for steam re-pelleting of the diet at 2 mm. These experimental diets had a final digestible energy of approx. 23 MJ kg−1 (control 22.9 MJ kg−1; A. vera 23.4 MJ kg−1).

2.5.1. Leukocyte respiratory burst The production of reactive oxygen species (ROS) was measured using NBT (nitrotetrazolium blue chloride — Sigma — N6876), following the protocol of Sahoo et al. (2005). Immediately after bleeding, 100 μL of heparinized blood was incubated with an equal volume of NBT buffer (0.2%) at room temperature for 30 min. Thereafter, 1 mL of dimethylformamide (DMF, Sigma, St. Louis, MO, USA) was added to the samples, and they were read using a Beckman Coulter spectrophotometer (Model DU® 640; Beckman Coulter Inc., Pasadena, CA, USA) at room temperature and 540 nm.

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9

2.5.2. Lysozyme Serum lysozyme concentration was determined according to Demers and Bayne (1997) based on the lysis of the Gram-positive bacterium Micrococcus lysodeikticus. Briefly, standard solutions (0–10 ng μL−1) of hen egg white lysozyme (Sigma-Aldrich — L6876) were prepared fresh from a frozen aliquot using 66 mM potassium phosphate buffer, pH 6.2. Then, dilutions of the standard and of the test serum (25 μL) were placed into a 96-well plate in triplicate. One hundred and seventy-five microliters of a 0.075% (wt:v) Micrococcus lysodeikticus (Sigma-Aldrich — M3770) suspension prepared in the same buffer was then added to each well. After rapid mixing, absorbance was measured at 450 nm every 20 s for 10 min using a microplate reader (SpectraMax M5; Molecular Devices, Sunnydale, CA, USA) at room temperature (±20 °C). The rate of decrease in absorbance for each sample was then compared to that obtained with the standard curve so that lysozyme concentration could be expressed in ng μL−1. 2.5.3. Complement system (alternative pathway) activity Serum complement hemolytic activity (alternative pathway) was measured according to Ferriani et al. (1990) and Polhill et al. (1978), with modifications for use with trout blood. Initially, a sample of rabbit blood was mixed with an equal volume of Alsever solution (anticoagulant, pH 6.1). Then, an equal volume of TEA-EDTA chelating buffer (triethanolamine ethylenediamine tetraacetic acid; 0.1 M, pH 7.4 and 0.1% gelatin) was added, the solution was incubated for 15 min at 37 °C, and it was subsequently centrifuged at 800 ×g for 10 min at 4 °C to separate the cells [predominantly erythrocytes (RBCs)]. The rabbit RBCs (RaRBCs) were then washed three times in TEA-Mg2+ buffer (2 mM, pH 7.4) with successive centrifugations (at 800 ×g for 10 min at 4 °C), and stored for up to 15 days in Alsever solution at 4 °C. Finally, before use, 1 mL of the RaRBC suspension was washed three times in TEA-EGTA-Mg2 + buffer (triethanolamine ethylene glycol tetraacetic acid; 8 mM, with 2 mM of Mg2+ and 0.1% gelatin, pH 7.4), with successive centrifugations (at 800 ×g for 10 min at 4 °C), and then adjusted using the same buffer to an optical density between 0.7 and 0.8 at 700 nm. To optimize the assay for trout, a series of dilutions (1:24, 1:12, 1:8, 1:6 and 1:4; final volume 200 μL) was made by mixing a pool of all serum samples with TEA-EGTA-Mg2+ buffer and the RaRBC suspension, and measuring absorbance at 700 nm using a Beckman Coulter spectrophotometer at 15, 20, 25, 30, 35 and 40 °C (data not shown). The assay was carried out with a 1:8 dilution (75 μL of trout serum combined with 125 μL of TEA-EGTA-Mg2+ buffer and 400 μL of the RaRBC suspension) and absorbance was measured for 20 min at 35 °C. Serum aliquots were heated for 30 min at 56 °C to provide a negative control. Hemolytic complement activity (ACH50) for each sample was measured as the time (seconds) required for the initial optical density to be reduced by one-half (50% of RaRBC hemolysis by complement system, alternative pathway). 2.6. Immune-related gene expression 2.6.1. RNA extraction Total RNA was extracted from the trout spleens using TRIzol Reagent (Life Technologies, Canada Inc., Burlington, ON). Briefly, the spleens were homogenized in 400 μL of TRIzol using a motorized Kontes RNase-Free Pellet Pestle Grinder (Kimble Chase, Vineland, NJ, USA), disposable nuclease-free plastic pestles, and 1.5 mL microcentrifuge tubes (Kimble Chase). Then, an additional 400 μL of TRIzol was added, and the samples were passed through QIAshredder columns (QIAGEN, Mississauga, ON, Canada) and centrifuged at room temperature (12,000 ×g for 2 min) to pellet the insoluble material. Finally, the samples were topped up to approximately 1 mL with 200 μL of TRIzol and the extractions were completed following the manufacturer's instructions. The total RNA samples were then treated with 6.8 Kunitz units of DNaseI (RNase-Free DNase Set, QIAGEN) in the manufacturer's buffer

3

(1 × final concentration) at room temperature for 10 min to degrade any residual genomic DNA. These DNaseI-treated RNA samples were then column-purified using the RNeasy MinElute Cleanup Kit (QIAGEN), following the manufacturer's instructions. For both the crude and column-purified RNA extracts, RNA quantity was assessed using A260 NanoDrop UV spectrophotometry, RNA purity was evaluated by A260/280 and A260/230 NanoDrop UV spectrophotometry, and RNA integrity was verified using 1% agarose gel electrophoresis. 2.6.2. First strand cDNA synthesis First-strand cDNA was synthesized from 1 μg of each DNaseI-treated total RNA sample in a 20 μL reaction using random primers [250 ng (Invitrogen)] and M-MLV reverse transcriptase [200 U (Invitrogen)] with the manufacturer's first strand buffer (1× final concentration) and DTT (10 mM final concentration) at 37 °C for 50 min. 2.6.3. Primer design and quality testing for Quantitative Reverse Transcription-Polymerase Chain Reaction (QPCR) Primers for QPCR were designed using Primer3 software (http:// frodo.wi.mit.edu/primer3), and were based on cDNA sequences for the genes of interest (GOI) and the normalizer (RPLP0; 60S acidic ribosomal protein P0) that were available for rainbow trout in GenBank (see Table 2 for accession numbers). Two primer sets were synthesized (Integrated DNA Technologies, Coralville, Iowa) for cathelicidin-1, cathelicidin-2, ferritin heavy chain, and interferon regulatory factor 1 (IRF-1), three primer sets were synthesized for interleukin-1 beta (IL-1β), tumor necrosis factor-alpha 1 (TNFα-1), tumor necrosis factor-alpha 2 (TNFα-2) and RPLP0, and four primer sets were synthesized for interleukin-8 (IL-8). Each primer set for each gene was tested for quality before use. The primer test included calculating amplification efficiencies (Pfaffl, 2001) for 2 samples: a fish fed the control diet at 0 h (pre-injection) and an A. vera fed fish 24 h after ASAL injection. Briefly, a 5-point 1:3 dilution series starting with cDNA (corresponding to 10 ng of input total RNA) was performed for each sample and the reported efficiencies are an average of the 2 values. Amplification efficiencies were required to be between 80 and 100%. Melting curves were also analyzed in order to verify that the primers amplified a single product, and that there were no primerdimers or amplification in the no-template control. Lastly, the PCR products were electrophoresed on a 1.5% agarose gel, with ethidium bromide staining alongside a DNA size marker (1 kb plus ladder, Life Technologies, Canada Inc.), to verify amplicon size. The primer set that met these parameters and had the amplification efficiency closest to 100% was chosen for each gene. Primer sequences, amplification efficiencies and amplicon sizes are shown in Table 2. 2.6.4. QPCR QPCR reactions and analyses of transcript (mRNA) levels were performed using the 7500 Fast Real-Time PCR System (Life Technologies, Canada Inc.) with SYBR Green I dye chemistry. Transcript levels of the GOI were normalized to RPLP0. This gene was chosen as the endogenous control (i.e. normalizer gene) due to its relatively stable expression profile in other QPCR studies (Purcell et al., 2004), and the fact that it was stably expressed in a subset of samples from this experiment. Initially, the average fluorescence threshold cycle (CT) values for RPLP0 were analyzed (in triplicate) in two biological replicates from each group. They were: 20.66 (Initial_Control); 20.46 (Initial_Aloe); 20.34 (Aloe 3 HPI ASAL); 20.16 (Control 3 HPI ASAL); 20.10 (Aloe 3 HPI PBS); 20.61 (Control 3 HPI PBS); 20.69 (Aloe 24 HPI ASAL); 20.68 (Control 24 HPI ASAL); 20.99 (Aloe 24 HPI PBS) and 20.64 (Control 24 HPI PBS) (range: 20.10 to 20.99, or 0.89 cycles). When the experimental QPCR studies were performed for all the genes of interest with normalization to RPLP0, RPLP0 transcripts were indeed stably expressed in all samples (Supplemental Table 1). PCR amplification was performed in a 13 μl reaction using 1× Power SYBR Green PCR Master Mix (Life Technologies, Canada Inc.), 50 nM each of forward and reverse primer, and cDNA (corresponding to 5 ng

4

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9

Table 2 Primers used in the quantitative reverse transcription-polymerase chain reaction analyses. Gene of interest

Primer name

Nucleotide sequence (5′ → 3′)

Efficiency (%)

Amplicon size (bp)

GenBank acc. no.

RPLP0 (normalizer)

RPLP0 fwd RPLP0 rev Cath-1 fwd Cath-1 rev Cath-2 fwd Cath-2 rev Ferritin fwd Ferritin rev IL-1β fwd IL-1β rev IL-8 fwd IL-8 rev IRF-1 fwd IRF-1 rev TNFα-1 fwd TNFα-1 rev TNFα-2 fwd TNFα-2 rev

TGTGGTGCTCATGGGTAAAA GGTGAAGACAAAGCCCACAT CTGGAGGCAAGCAACAACCTG CTCTGGAGCATATTCTGACTTTG CTGGAGATTGGCAACACCCTC TCCGCTGTCCTTGCCTCTTC CAGAGGGGAGGGAGAATCTT TTATCAGCGCAGACCTTGTG GGAGAGGTTAAAGGGTGGCGA TGCCGACTCCAACTCCAACA AGCCAGCCTTGTCGTTGTG AGTTTACCAATTCGTCTGCTTTCC CGACATCCCTTACACCGACT TCGGGAATGAAGTCTTTTGG CTCCATCGGGGTTAATGCTA CACAGTTTGTCCCCTTCGTT GGAGGCTGTGTGGCGTTCT TGCTGACACCAGGCAAAGAG

80

121

FP322339

99

124

AY382478

99

105

AY360356

99

149

DV195169

92

106

AJ223954

99

123

AJ279069

99

128

AF332147

98

150

AJ277604

99

73

AJ401377

Cathelicidin-1 Cathelicidin-2 Ferritin heavy chain Interleukin-1β Interleukin-8 IRF-1 TNFα-1 TNFα-2

of input total RNA). The PCR program consisted of one cycle of 50 °C for 2 min, one cycle of 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min, with data collection after each 60 °C step. For each sample, the GOI and the normalizer gene (RPLP0) were run on the same plate in triplicate, and a no-template control was included. The CT values were determined using the 7500 Software Relative Quantification Study Application (Version 2.0; Life Technologies, Canada Inc.). Fluorescence thresholds were set automatically or manually to place the threshold level in the region of exponential amplification. The relative quantity (RQ) of each transcript was then determined with this software using the 2−ΔΔCT relative quantification method (Livak and Schmittgen, 2001), with amplification efficiencies incorporated. Transcript expression data are presented as mean (±1 SE) RQ values normalized to RPLP0, and are calibrated to the biological replicate with the lowest expression (this replicate assigned an RQ value = 1). When a CT value within a triplicate was greater than 0.7 cycles different from the other two technical replicate CT values, it was considered to be an outlier, discarded, and the average CT value was calculated using the remaining two CT values. 2.7. Statistical analysis Values were identified as outliers if they were N 3 or b− 3 of the studentized x predicted y, and removed from the analyses. Further, some of the data were transformed prior to statistical analysis as they failed normality (Cramer Von Mises) and/or homoscedasticity tests (Brown–Forsythe). A 2 (diets) × 2 (PBS × ASAL) × (sampling points; 3 and 24 h) factorial, followed by Duncan's post-hoc tests, was used to examine the effect of the diets on the response of parameters to ASAL vs. PBS injection. In addition, t-tests within each diet treatment, were used to test whether values at 3 and/or 24 h after ASAL and PBS were significantly different from ‘initial’ (time 0) values. P b 0.05 was used as the level of statistical significance in all analyses. Values in the text and figures are means ± 1 standard error (S.E.) of the mean.

255.7 ± 6.4 g; A. vera, 252.8 ± 6.2 g) (Fig. 1); i.e. they both grew at approx. 2.9% bwt day−1.

3.2. Innate immune response and spleen size Serum lysozyme concentration (Fig. 2) was not affected by feeding A. vera for 6 weeks, or by PBS or bacterial antigen (ASAL) injection; with values ranging from approx. 3–3.5 ng μL−1. Inclusion of A. vera in the diet also failed to influence respiratory burst activity or complement system (alternative pathway) activity (Fig. 2). However, it appears that injection with ASAL and PBS caused a small decrease in both parameters. Whole blood respiratory burst was significantly lower than initial values in ASAL injected control fish at 3 and 24 HPI (by ~7% at 3 HPI and ~10% at 24 HPI), in ASAL injected A. vera-fed fish at 24 HPI (by ~10%) and in PBS injected control fish at 24 HPI (by ~10%). Further, although the change was only significant in fish fed A. vera, complement system activity fell compared to initial (pre-injection) values by approx. 18% with ASAL and by 14% with PBS at 3 HPI before returning to values similar to initial values at 24 HPI (Fig. 2). Spleen-somatic index (SSI) was not affected by 6 weeks of feeding the control vs. the A. vera diet (values 0.14 and 0.11%, respectively) (Fig. 3). However, it appears that addition of A. vera to the diet had an

3. Results 3.1. Production traits With the exception of one fish in the A. vera dietary treatment, no mortality was recorded during the experiment. Fish in the A. vera group tended to be less aggressive, i.e. ‘calmer’, during feeding of both diets. Nonetheless, after 6 weeks of feeding at 1.5% bwt day− 1, the weight of trout in both experimental groups was similar (Control,

Fig. 1. Weight of trout fed a ‘control’ diet and one supplemented with 0.5 g kg−1 A. vera at the beginning and end of the feeding trial. Values are means ± 1 standard error (S.E.), N = 60. No significant differences were detected.

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9

5

Fig. 2. Respiratory burst activity of blood leukocytes, serum concentration of lysozyme and serum complement activity (ACH50 — alternative pathway) in trout fed a ‘control’ diet and one supplemented with 0.5 g kg−1 A. vera, at the initial (pre-injection) sampling and at 3 and 24 h after injection with ASAL or PBS. Arrows indicate a difference (P b 0.05) as compared to initial (Time 0) values, within diet. Values are means ± 1 standard error (S.E.), N = 12.

effect on post-injection spleen SSI. In contrast to fish fed the control diet, the SSI of A. vera fed fish was not significantly lower than initial values at 3 HPI. Further, SSI was significantly higher in PBS-injected A. vera fed fish at 24 HPI as compared to fish fed the control diet (values 0.106% vs. 0.063%, respectively).

3.3. Expression of immune-related genes No significant (P N 0.05) differences were observed in constitutive mRNA expression in A. vera-fed vs. control fish (Fig. 4). PBS injection only had a very minor effect on the mRNA expression of immunerelevant genes, with the only differences observed being: 1) a slight increase in ferritin heavy chain mRNA expression in fish fed the A. vera supplemented diet and sampled 3 HPI after ASAL; and 2) a small decrease in IRF-1 expression in control fed fish that were sampled 3 h HPI after PBS. Further, a significant dietary effect was only seen with PBS injection. This occurred at 24 HPI, when expression of CATH-1 was approx. 2.2 fold higher in fish fed with 0.5 g kg−1 A. vera (Fig. 4). Diet also failed to influence immune-related gene expression after the fish were injected with ASAL. However, this was not because this antigen formulation failed to stimulate the mRNA expression of these genes. Bacterial antigens (ASAL) injection resulted in a robust immune response, and an increase in the expression of all 8 selected antibacterial biomarker genes. The maximum increase in mRNA expression of these genes ranged from 2 to 10 fold for ferritin heavy chain (at 24 HPI), IRF-1 (at 24 HPI) and TNFα-1 (at 24 HPI), to ~100 fold for CATH-1 (at 24 HPI), TNFα-2 (at 3 HPI) and IL-8 (at 3 HPI) and to ~ 1500 fold for CATH-2 (at 24 HPI) and IL-1β (at 3 HPI) (Fig. 4).

4. Discussion Fig. 3. Spleen-somatic index of trout fed a ‘control’ diet and one supplemented with 0.5 g kg−1 A. vera at the initial (pre-injection) sampling, and at 3 and 24 h after injection with ASAL or PBS. Arrows indicate a difference (P b 0.05) as compared to initial (time 0) values (within diet), whereas dissimilar lower case letters indicate a difference between ASAL and PBS at the same time post-injection. Note: The ‘initial’ values for fish fed the Aloe vs. control diets, and the effect of diet at each time/injection combination, were not significantly different. Values are means ± 1 standard error (S.E.), N = 12.

4.1. Effect of A. vera on immune function The immune-modulatory properties of A. vera have been demonstrated in various animal models, including chickens (Akhtar et al., 2012), mice (Akev et al., 2007a,b), felines (Harris et al., 1991), dogs (Altug et al., 2010), human beings (Budai et al., 2013) and have mainly

6

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9

Fig. 4. mRNA expression of 8 antibacterial biomarker genes in trout fed a ‘control’ diet vs. one containing 0.5 g kg−1 A. vera when netted from their tank (constitutive/initial values), and 3 or 24 h after they were injected with PBS or ASAL. Different capital letters indicate a difference (P b 0.05) between treatments at a particular diet/injection combination, whereas dissimilar lower case letters indicate a difference between ASAL and PBS at the same time post-injection. An asterisk (*) indicates a difference between 3 and 24 h post-injection within in the same treatment. Finally, the arrows indicate a difference as compared to initial (constitutive) values, within a diet. RQs (relative quantities) were normalized to the expression of RPLP0 (60S acidic ribosomal protein P0) and calibrated to the individual with the lowest expression. Values are means ± 1 standard error (S.E.). Control N = 9, A. vera N = 8.

been attributed to acemannan (ACM; Carrisyn™) (Mcdaniel and Mcanalley, 1987); a carbohydrate consisting of β (l,4)-linked acetylated mannan subunits interspersed with O-acetyl groups. ACM has been shown to induce macrophages to produce inflammatory cytokines such as IL-1, IL-6, and TNF-α (Peng et al., 1991; Tan and Vanitha, 2004; Zhang and Tizard, 1996), and cause a dose-dependent increase in nitric oxide synthesis, mediated through macrophage mannose receptors and macrophage activation (Karaca et al., 1995). Nonetheless,

Zhang et al. (2006) also showed that dihydrocoumarin isolated from A. vera caused a dose-dependent increase in macrophage phagocytic activity, and over 75 biologically active compounds have been identified in A. vera (Reynolds and Dweck, 1999), some of which apparently have anti-inflammatory activities mediated through the down-regulation of iNOS and TNF (Talmadge et al., 2004). The effect of Aloe sp. on fish immunology/disease resistance has also been studied in several fish species. Zanuzzo et al. (2012) demonstrated

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9

that adding A. vera to the water during transport and handling increased the leukocyte respiratory burst activity of matrinxa (B. amazonicus). Pacu (Piaractus mesopotamicus) fed a diet containing 2% of A. vera for 10 days had significantly higher values for leukocyte respiratory burst, serum lysozyme concentration and complement system (alternative pathway) activity 24 h after infection with bacterium (A. hydrophila) than in control fish (Zanuzzo and Urbinati, Unpublished results). Picchietti et al. (2013) showed that LPS stimulated transcript expression of several immune related genes (IL-1β; TGF-β; THF-α; and COX-2) in gilthead sea bream (Sparus aurata) fibroblasts was significantly enhanced by concomitant exposure to 1.2 mg mL−1 of A. arborescens extract. Finally, rockfish (S. schlegeli) fed a diet supplemented with 0.5% A. vera for 6 weeks showed very low mortality (1.7%) following V. alginolyticus infection when compared to 60% in the control group (Kim et al., 1999). In contrast, the current study showed that incorporating A. vera into the diet of steelhead trout at 0.5% for 6 weeks had either no or very limited effects on all the immunological parameters tested. Our results are also in contrast to other studies which showed that medical plants are immune-modulatory in fishes (Ardo et al., 2008; Citarasu, 2010; Dugenci et al., 2003; Galina et al., 2009; Verma et al., 2013; Yin et al., 2009). However, this lack of responsiveness could be related to a number of factors: (1) Plants from different locations with variations in their chemical composition (Hamman, 2008) (e.g. level of ACM vs. dihydrocoumarins); (2) The method of extract preparation (e.g. dehydration) and incorporation into the feed. In Zanuzzo and Urbinati (Unpublished results) the A. vera gel was sprayed on the feed and allowed to dry at room temperature, whereas in the current study it was freeze dried prior to being incorporated into the feed; (3) The duration of administration. Matsuo and Miyazono (1993) showed that rainbow fed with peptidoglycan for 56 days were not protected against Vibrio anguillarum infection, whereas fish fed this compound for 28 days showed enhanced protection. There is some data which suggests that the immunomodulatory properties of A. vera attenuate with time and/ or that there is a negative feedback mechanism that returns the immune response to its previous state with prolonged exposure (Matsuo and Miyazono, 1993; Yoshida et al., 2005); (4) Species differences in the amount (%) of A. vera needed to modify immune functions could exist. However, this is not likely given the diversity of vertebrates where dose-dependent effects have been reported (Karaca et al., 1995; Zanuzzo et al., 2012; Zanuzzo and Urbinati, Unpublished results; Zhang et al., 2006); (5) Water temperature. Our study was performed at 10 °C, whereas mammals have a body temperature of ~ 37–39 °C and the rockfish, sea bream, pacu and matrinxã studies were conducted at temperatures between 20 and 28 °C, respectively. Temperature does affect immune function (Alcorn et al., 2002; Collazos et al., 1994; Jokinen et al., 2011) and the effectiveness of immunostimulants (CooK et al., 2003) and immunization (Alishahi and Buchmann, 2006; Nishizawa et al., 2011; Russell et al., 2000). Therefore, it is possible that warmer temperatures are required for A. vera to be effective in stimulating immune function. The spleen is the main immunocompetent organ, and the spleen-somatic index (SSI) has been used as an indicator of immune status in fishes (Hadidi et al., 2008). In the current study, A. vera administration also failed to have an effect on the spleen size of resting fish (i.e. pre-injection). However, it appears that it did limit the reduction in SSI post-injection, and allowed SSI to return to pre-injection values sooner (Fig. 3). The mechanism(s) responsible for this effect are unknown. 4.2. Responses to bacterial antigens (including ASAL) The immune challenge with ASAL had no effect on the trout's leukocyte respiratory burst or complement (alternative pathway) activity, or serum lysozyme concentration (Fig. 2). It is possible that the dose of ASAL used in the present study was not optimal or that one dose was not enough to alter leukocyte respiratory burst,

7

complement activity, or the serum lysozyme concentration as affected by pathogen exposure. However, this is unlikely based on the fact that our single IP dose induced large increases in the expression of all the selected immune-relevant genes (range 3 to ~1500 fold) (Fig. 4). The cathelicidins are a family of antimicrobial peptides considered to be at the forefront of the innate immune system (Tomasinsig and Zanetti, 2005). Cathelicidin sequences have been described in fish, with three cathelicidins reported in Atlantic cod and multiple cathelicidins reported in various salmonid species including rainbow trout (Chang et al., 2006; Maier et al., 2008). While some studies have suggested that cathelicidins may not play a major role in the acute phase response (Audunsdottir et al., 2012), and instead are involved in the prolonged immune response (Maier et al., 2008), others report that the peak of transcript expression occurs shortly after immunostimulation. For example, peak expression was seen 12 h after bacterial exposure in the head kidney and spleen of ayu (Plecoglossus altivelis) (Lu et al., 2011) and at 24 h in rainbow trout (Chang et al., 2005), and Feng et al. (2009) showed that cathelicidin transcript levels were signficantly up-regulated in the Atlantic cod spleen at 6, 24 (peak) and 72 HPI and in head kidney at 24 (peak) and 72 h HPI following the administration formalin-killed atypical ASAL. In the current study, we showed that mRNA expression of both cath-1 and cath-2 was elevated significantly at 3 and 24 h following ASAL injection. These results indicate that cathelicidin mRNA expression is induced early in the immune response of the steelhead trout, consistent with the majority of the data presented above. Finally, we showed that the mRNA expression of cath-2 following ASAL injection was much greater as compared to that for cath-1 (with fold changes of ~ 1500 and 46, respectively). This result is in contrast to Chang et al. (2006) who showed that while trout spleen cath-1 transcript expression was greatly elevated following ASAL (pathogenic bacteria) injection, cath-2 expression showed little (if any) response. However, it is in agreement with (Heinecke and Buchmann, 2013) who reported that rainbow trout alevins as young as 10 days post-hatch increase the transcript expression of cath-2 after Ichthyophthirius multifiliis infection. The reason(s) for this discrepancy in results between studies is not known. Tumor necrosis factors (TNFs) are pro-inflammatory cytokines, involved in cell proliferation, apoptosis, enhanced leucocyte migration, phagocytic activity and the expression of other pro-inflammatory cytokines (Zou et al., 2003). Several different isoforms of TNF have been identified in fish (Zou et al., 2002), and a few studies have described differences between TNFα-1 and TNFα-2 expression. Zou et al. (2003) reported much stronger transcript expression of TNFα-2 relative to TNFα-1 in LPS stimulated trout macrophages, and suggested based on 8 vs. 5 instability motifs in the 3′-UTR that TNFα-2 is probably down-regulated more rapidly or that higher transcription is needed to produce sufficient protein for biological activity. Laing et al. (2001) and Hirono et al. (2000) also showed that TNF-α transcript expression can be up-regulated by stimulating isolated leukocytes with LPS, phorbol myristate acetate (PMA) and trout IL-1β, with expression being maximal at 3–4 h post-stimulation. In the current study, we showed that while both paralogues were up-regulated by IP injection of bacterial antigens (ASAL), TNFα-2 mRNA expression increased by ~ 100 fold while TNFα-1 expression increased by 8 fold at 3 h, and that the expression of TNFα-2 was much higher at 3 h as compared to 24 h. Both results are in agreement with the findings of Zou et al. (2003), Laing et al. (2001) and Hirono et al. (2000). Interleukin-1β induces a cascade of effects leading to inflammation, and is responsible for increases in phagocytosis, lymphocyte proliferation and superoxide production, and induces the release of others cytokines (Huising et al., 2004). Selvaraj et al. (2006) showed that macrophages from carp (Cyprinus carpio) treated with β-glucan + LPS did not increase the transcript expression of interleukin-1β after 24 h or 48 h. These authors suggested that the induction may be transient, and hence, it was possible that expression of the transcript had peaked prior to their first sampling. This hypothesis is partially supported by

8

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9

Feng et al. (2009) and our study. Feng et al. (2009) showed that although IL-1β transcript expression was not elevated at 24 HPI, it was signficantly up-regulated in both spleen and head kidney at 2 and 6 (peak) hours after IP injection with formalin-killed atypical ASAL compared with time-matched saline injected controls. Further, while IL-1β expression was still elevated at 24 h after ASAL injection (by 50 fold) in our study, this level of expression was only one-tenth of that measured at 3 HPI. The chemokineIL-8 exerts a powerful inflammatory response that recruits neutrophils and other leukocytes to the site of infection/damage (Wang et al., 2013). We showed that IL-8 transcript expression peaked shortly after ASAL injection (Fig. 4), and this result is in agreement with Wang et al. (2013) using Grass carp (Ctenopharyngodon idellus) and A. hydrophila and Feng et al. (2009) who reported that IL-8 mRNA expression peaked in both the spleen and head kidney of Atlantic cod at 6 h after IP injection with formalin-killed atypical ASAL. Collectively, these data suggest that IL-8 mRNA expression peaks shortly after exposure to bacterial antigens/pathogens. The tight regulation of free iron maintains a balance between its beneficial and toxic effects, and is accomplished by two proteins. Transferrin is an iron carrier protein, whereas ferritin is an intracellular protein that stores and releases iron in a controlled fashion and whose expression has been shown to increase in inflammatory conditions where it deprives pathogens of needed iron (Rogers et al., 1990; Torti and Torti, 2002). Feng et al. (2009) reported a significant increase in ferritin heavy chain transcript expression in the cod spleen at 24 h poststimulation with formalin-killed atypical ASAL, and Neves et al. (2009) showed an increase in liver and brain of ferritin heavy chain transcript expression following bacterial infection with Photobacterium damselae in sea bass (Dicentrarchus labrax). In the current study, we showed that ferritin heavy chain transcript expression in the spleen of steelhead trout was up-regulated by ASAL injection at 24 h post-stimulation, in agreement with the results reported by Feng et al. (2009) for cod. Interferon regulatory factors (IRFs) are a family of transcription factors associated with viral infection, cytokine signaling, cell growth regulation and hematopoietic development (Jia and Guo, 2008; Nguyen et al., 1997), although the regulatory mechanisms in fish are not fully elucidated. Collet et al. (2003) found that trout IRF-1 gene expression was induced by DNA vaccination against viral hemorrhagic septicemia virus. However, there are only a few reports of increases in IRF-1 transcript levels in fish following bacterial stimulation. For example, Feng et al. (2009) reported a 4.6 fold up-regulation of IRF-1 transcript levels in the Atlantic cod spleen following the IP injection of formalin-killed atypical ASAL, with peak expression occurring at 24 h. The results of the present study on steelhead trout are very similar to those for the Atlantic cod, and confirm that bacterial antigens, in addition to viruses, can increase the mRNA expression of this important immune molecule. Herein, we demonstrated that all of the immune-related genes tested were up-regulated by exposure to atypical ASAL; IL1-β, IL-8 and TNFα-2 mRNA expression reaching peak levels at 3 h poststimulation, while cath-1, cath-2, ferritin heavy chain and IRF-1 all showed higher expression levels after 24 h. Further, we provide additional evidence in fishes that IRF-1 transcript can be up-regulated following exposure to bacterial antigens, and that the up-regulation of TNFα-2 and cath-2 mRNA expression is much greater than for TNFα-1 and cath-1, respectively. However, we failed to show that A. vera influenced the constitutive or ASAL-stimulated innate immune response of steelhead trout. Our results are in contrast to the limited work that has been done on other fishes (Kim et al., 1999; Picchietti et al., 2013; Zanuzzo et al., 2012; Zanuzzo and Urbinati, Unpublished results), and may indicate inter-specific differences in the response of the fish immune system to this compound, differences in the duration of exposure or dose required to elicit an immune response, or that the capacity of extracts from this succulent plant species to stimulate innate immune is temperature dependent. The answer to these questions will

require additional research, as will the determination of whether A. vera has beneficial effects when fish are exposed to live pathogens. To our knowledge no research has been completed in this area. However, recent research on sea bream shows that while the inclusion of vegetable oils in the diet does not affect the intestinal transcriptome, it modulates the transcriptomic response to infection with live Enteromyxum leei (Calduch-Giner et al., 2012). Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.aquaculture.2014.09.010. Acknowledgments We thank Danny Boyce and the staff of the Dr. Joe Brown Aquatic Research Building (JBARB) (Ocean Sciences Centre, Memorial University, NL) for assistance with fish care, and Sherry Boivin (Cedarlane Laboratories) for preparing the rabbit blood used in the complement assays. We are very grateful to Drs. Santosh Lall and Sean Tibbetts who formulated and produced the pelleted diets used in this study. This research was made possible by a scholarship from CAPES “Bolsista da Capes Proc. no. 1879-13-8”awarded to FSZ, and Natural Sciences and Engineering Research Council of Canada (NSERC) (RGPIN 2499262011) Discovery and Accelerator Supplement awards to AKG. References Akev, N., Turkay, G., Can, A., Gurel, A., Yildiz, F., Yardibi, H., Ekiz, E.E., Uzun, H., 2007a. Effect of Aloe vera leaf pulp extract on Ehrlich ascites tumours in mice. Eur. J. Cancer Prev. 16, 151–157. Akev, N., Turkay, G., Can, A., Gurel, A., Yildiz, F., Yardibi, H., Ekiz, E.E., Uzun, H., 2007b. Tumour preventive effect of Aloe vera leaf pulp lectin (Aloctin I) on Ehrlich ascites tumours in mice. Phytother. Res. 21, 1070–1075. Akhtar, M., Hai, A., Awais, M.M., Iqbal, Z., Muhammad, F., ul Haq, A., Anwar, M.I., 2012. Immunostimulatory and protective effects of Aloe vera against coccidiosis in industrial broiler chickens. Vet. Parasitol. 186, 170–177. Alcorn, S.W., Murray, A.L., Pascho, R.J., 2002. Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka). Fish Shellfish Immunol. 12, 303–334. Alishahi, M., Buchmann, K., 2006. Temperature-dependent protection against Ichthyophthirius multifiliis following immunisation of rainbow trout using live theronts. Dis. Aquat. Organ. 72, 269–273. Altug, N., Yuksek, N., Agaoglu, Z.T., 2010. Immunostimulatory effects of Aloe vera and β-glucan on cellular and humoral immune responses following vaccination with polyvalent vaccines in dogs. Kafkas Univ. Vet. Fak. 16, 405–412. Anderson, D.P., Jeney, G., 1992. Immunostimulants added to injected Aeromonas salmonicida bacterin enhance the defense mechanisms and protection in rainbow trout (Oncorhynchus mykiss). Vet. Immunol. Immunopathol. 34, 379–389. Ardo, L., Yin, G., Xu, P., Varadi, L., Szigeti, G., Jeney, Z., Jeney, G., 2008. Chinese herbs (Astragalus membranaceus and Lonicera japonica) and boron enhance the nonspecific immune response of Nile tilapia (Oreochromis niloticus) and resistance against Aeromonas hydrophila. Aquaculture 275, 26–33. Audunsdottir, S.S., Magnadottir, B., Gisladottir, B., Jonsson, Z.O., Bragason, B.T., 2012. The acute phase response of cod (Gadus morhua L.): expression of immune response genes. Fish Shellfish Immunol. 32, 360–367. Bricknell, I., Dalmo, R.A., 2005. The use of immunostimulants in fish larval aquaculture. Fish Shellfish Immunol. 19, 457–472. Budai, M.M., Varga, A., Milesz, S., Tozser, J., Benko, S., 2013. Aloe vera downregulates LPS-induced inflammatory cytokine production and expression of NLRP3 inflammasome in human macrophages. Mol. Immunol. 56, 471–479. Calduch-Giner, J.A., Sitjà-Bobadilla, A., Davey, G.C., Cairns, M.T., Kaushik, S., Pérez-Sánchez, J., 2012. Dietary vegetable oils do not alter the intestine transcriptome of gilthead sea bream (Sparus aurata), but modulate the transcriptomic response to infection with Enteromyxum leei. BMC Genomics 13, 470. Chandran, M.R., Aruna, B.V., Logambal, S.M., Michael, R.D., 2002. Immunisation of Indian major carps against Aeromonas hydrophila by intraperitoneal injection. Fish Shellfish Immunol. 13, 1–9. Chang, C.I., Pleguezuelos, O., Zhang, Y.A., Zou, J., Secombes, C.J., 2005. Identification of a novel cathelicidin gene in the rainbow trout, Oncorhynchus mykiss. Infect. Immun. 73, 5053–5064. Chang, C.I., Zhang, Y.A., Zou, J., Nie, P., Secombes, C.J., 2006. Two cathelicidin genes are present in both rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Antimicrob. Agents Chemother. 50, 185–195. Citarasu, T., 2010. Herbal biomedicines: a new opportunity for aquaculture industry. Aquacult. Int. 18, 403–414. Collazos, M.E., Ortega, E., Barriga, C., 1994. Effect of temperature on the immune system of a cyprinid fish (Tinca tinca, L). blood phagocyte function at low temperature. Fish Shellfish Immunol. 4, 231–238. Collet, B., Hovens, G.C.J., Mazzoni, D., Hirono, I., Aoki, T., Secombes, C.J., 2003. Cloning and expression analysis of rainbow trout Oncorhynchus mykiss interferon regulatory factor 1 and 2 (IRF-1 and IRF-2). Dev. Comp. Immunol. 27, 111–126.

F.S. Zanuzzo et al. / Aquaculture 435 (2015) 1–9 CooK, M.T., Hayball, P.J., Hutchinson, W., Nowak, B.F., Hayball, J.D., 2003. Administration of a commercial immunostimulant preparation, EcoActiva™ as a feed supplement enhances macrophage respiratory burst and the growth rate of snapper (Pagrus auratus, Sparidae (Bloch and Schneider)) in winter. Fish Shellfish Immunol. 14, 333–345. Demers, N.E., Bayne, C.J., 1997. The immediate effects of stress on hormones and plasma lysozyme in rainbow trout. Dev. Comp. Immunol. 21, 363–373. Djeraba, A., Quere, P., 2000. In vivo macrophage activation in chickens with Acemannan, a complex carbohydrate extracted from Aloe vera. Int. J. Immunopharmacol. 22, 365–372. Dugenci, S.K., Arda, N., Candan, A., 2003. Some medicinal plants as immunostimulant for fish. J. Ethnopharmacol. 88, 99–106. Feng, C.Y., Johnson, S.C., Hori, T.S., Rise, M., Hall, J.R., Gamperl, A.K., Hubert, S., Kimball, J., Bowman, S., Rise, M.L., 2009. Identification and analysis of differentially expressed genes in immune tissues of Atlantic cod stimulated with formalin-killed, atypical Aeromonas salmonicida. Physiol. Genomics 37, 149–163. Ferriani, V.P.L., Barbosa, J.E., Decarvalho, I.F., 1990. Serum hemolytic classical and alternative pathways of complement in infancy: age-related changes. Acta Paediatr. Scand. 79, 322–327. Galina, J., Yin, G., Ardo, L., Jeney, Z., 2009. The use of immunostimulating herbs in fish. An overview of research. Fish Physiol. Biochem. 35, 669–676. Ganguly, S., Paul, I., Mukhopadhayay, S.K., 2010. Application and effectiveness of immunostimulants, probiotics, and prebiotics in aquaculture: a review. Isr. J. Aquacult. — Bamidgeh 62, 130–138. Hadidi, S., Glenney, G.W., Welch, T.J., Silverstein, J.T., Wiens, G.D., 2008. Spleen size predicts resistance of rainbow trout to Flavobacterium psychrophilum challenge. J. Immunol. 180, 4156–4165. Hamman, J.H., 2008. Composition and applications of Aloe vera leaf gel. Molecules 13, 1599–1616. Harris, C., Pierce, K., King, G., Yates, K.M., Hall, J., Tizard, I., 1991. Efficacy of acemannan in treatment of canine and feline spontaneous neoplasms. Mol. Biother. 3, 207–213. Heinecke, R.D., Buchmann, K., 2013. Inflammatory response of rainbow trout Oncorhynchus mykiss (Walbaum, 1792) larvae against Ichthyophthirius multifiliis. Fish Shellfish Immunol. 34, 521–528. Hirono, I., Nam, B.H., Kurobe, T., Aoki, T., 2000. Molecular cloning, characterization, and expression of TNF cDNA and gene from Japanese flounder Paralychthys olivaceus. J. Immunol. 165, 4423–4427. Hori, T.S., Gamperl, A.K., Nash, G., Booman, M., Barat, A., Rise, M.L., 2013. The impact of a moderate chronic temperature increase on spleen immune-relevant gene transcription depends on whether Atlantic cod (Gadus morhua) are stimulated with bacterial versus viral antigens. Genome 56, 567–576. Huising, M.O., Stet, R.J.M., Savelkoul, H.F.J., Verburg-van Kemenade, B.M.L., 2004. The molecular evolution of the interleukin-1 family of cytokines; IL-18 in teleost fish. Dev. Comp. Immunol. 28, 395–413. Im, S.A., Oh, S.T., Song, S., Kim, M.R., Kim, D.S., Woo, S.S., Jo, T.H., Park, Y.I., Lee, C.K., 2005. Identification of optimal molecular size of modified Aloe polysaccharides with maximum immunomodulatory activity. Int. Immunopharmacol. 5, 271–279. Jia, W.Z., Guo, Q.L., 2008. Gene structures and promoter characteristics of interferon regulatory factor 1 (IRF-1), IRF-2 and IRF-7 from snakehead Channa argus. Mol. Immunol. 45, 2419–2428. Jokinen, I.E., Salo, H.M., Markkula, E., Rikalainen, K., Arts, M.T., Browman, H.I., 2011. Additive effects of enhanced ambient ultraviolet B radiation and increased temperature on immune function, growth and physiological condition of juvenile (parr) Atlantic Salmon, Salmo salar. Fish Shellfish Immunol. 30, 102–108. Karaca, K., Sharma, J.M., Nordgren, R., 1995. Nitric-oxide production by chicken macrophages activated by acemannan, a complex carbohydrate extracted from Aloe vera. Int. J. Immunopharmacol. 17, 183–188. Kim, K.H., Hwang, Y.J., Bai, S.C., 1999. Resistance to Vibrio alginolyticus in juvenile rockfish (Sebastes schlegeli) fed diets containing different doses of aloe. Aquaculture 180, 13–21. Kiron, V., 2012. Fish immune system and its nutritional modulation for preventive health care. Anim. Feed Sci. Technol. 173, 111–133. Laing, K.J., Wang, T.H., Zou, J., Holland, J., Hong, S.H., Bols, N., Hirono, I., Aoki, T., Secombes, C.J., 2001. Cloning and expression analysis of rainbow trout Oncorhynchus mykiss tumour necrosis factor-alpha. Eur. J. Biochem. 268, 1315–1322. Lim, S.J., Jang, E., Lee, S.H., Yoo, B.H., Kim, S.K., Kim, T.H., 2013. Antibiotic resistance in bacteria isolated from freshwater aquacultures and prediction of the persistence and toxicity of antimicrobials in the aquatic environment. J. Environ. Sci. Health B 48, 495–504. Lu, X.J., Chen, J., Huang, Z.A., Shi, Y.H., Lv, J.N., 2011. Identification and characterization of a novel cathelicidin from ayu, Plecoglossus altivelis. Fish Shellfish Immunol. 31, 52–57. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408. Magnadottir, B., 2006. Innate immunity of fish (overview). Fish Shellfish Immunol. 20, 137–151. Maier, V.H., Dorn, K.V., Gudmundsdottir, B.K., Gudmundsson, G.H., 2008. Characterisation of cathelicidin gene family members in divergent fish species. Mol. Immunol. 45, 3723–3730. Matsuo, K., Miyazono, I., 1993. The influence of long-term administration of peptidoglycan on disease resistance and growth of juvenile rainbow trout. Nippon Suisan Gakkaishi 59, 1377–1379. Mcdaniel, H.R., Mcanalley, B.H., 1987. Evaluation of polymannoacetate (Carrisyn) in the treatment of AIDS. Clin. Res. 35, 483a. Murray, A.L., Pascho, R.J., Alcorn, S.W., Fairgrieve, W.T., Shearer, K.D., Roley, D., 2003. Effects of various feed supplements containing fish protein hydrolysate or fish processing by products on the innate immune functions of juvenile coho salmon (Oncorhynchus kisutch). Aquaculture 220, 643–653.

9

Neves, J.V., Wilson, J.M., Rodrigues, P.N.S., 2009. Transferrin and ferritin response to bacterial infection: the role of the liver and brain in fish. Dev. Comp. Immunol. 33, 848–857. Nguyen, H., Hiscott, J., Pitha, P.M., 1997. The growing family of interferon regulatory factors. Cytokine Growth Factor Rev. 8, 293–312. Nishizawa, T., Takami, I., Yang, M., Oh, M.J., 2011. Live vaccine of viral hemorrhagic septicemia virus (VHSV) for Japanese flounder at fish rearing temperature of 21 °C instead of Poly(I:C) administration. Vaccine 29, 8397–8404. Patentstorm, 1985. Damaged fish tissue treating method and composition containing Aloe vera extract. http://www.patentstorm.us/patents/4500510/claims.html (Accessed on February 7th, 2014). Peng, S.Y., Norman, J., Curtin, G., Corrier, D., McDaniel, H.R., Busbee, D., 1991. Decreased mortality of Norman murine sarcoma in mice treated with the immunomodulator, Acemannan. Mol. Biother. 3, 79–87. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007. Picchietti, S., Bernini, C., Belardinelli, M.C., Ovidi, E., Taddei, A.R., Guerra, L., Abelli, L., Fausto, A.M., 2013. Immune modulatory effects of Aloe arborescens extract on the piscine SAF-1 cell line. Fish Shellfish Immunol. 34, 1335–1344. Polhill, R.B., Newman, S.L., Pruitt, K.M., Johnston, R.B., 1978. Kinetic assessment of alternative complement pathway activity in a hemolytic system. II. Influence of antibody on alternative pathway activation. J. Immunol. 121, 371–376. Purcell, M.K., Kurath, G., Garver, K.A., Herwig, R.P., Winton, J.R., 2004. Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoletic necrosis virus (IHNV) infection or DNA vaccination. Fish Shellfish Immunol. 17, 447–462. Reynolds, T., Dweck, A.C., 1999. Aloe vera leaf gel: a review update. J. Ethnopharmacol. 68, 3–37. Rogers, J.T., Bridges, K.R., Durmowicz, G.P., Glass, J., Auron, P.E., Munro, H.N., 1990. Translational control during the acute phase response — ferritin synthesis in response to Interleukin-1. J. Biol. Chem. 265, 14572–14578. Russell, P.H., Kanellos, T., Negrou, M., Ambali, A.G., 2000. Antibody responses of goldfish (Carassius auratus L.) to DNA-immunisation at different temperatures and feeding levels. Vaccine 18, 2331–2336. Sahoo, P.K., Kumari, J., Mishra, B.K., 2005. Non-specific immune responses in juveniles of Indian major carps. J. Appl. Ichthyol. 21, 151–155. Sakai, M., 1999. Current research status of fish immunostimulants. Aquaculture 172, 63–92. Sanderson, H., Brain, R.A., Johnson, D.J., Wilson, C.J., Solomon, K.R., 2004. Toxicity classification and evaluation of four pharmaceuticals classes: antibiotics, antineoplastics, cardiovascular, and sex hormones. Toxicology 203, 27–40. Selvaraj, V., Sampath, K., Sekar, V., 2006. Adjuvant and immunostimulatory effects of β-glucan administration in combination with lipopolysaccharide enhances survival and some immune parameters in carp challenged with Aeromonas hydrophila. Vet. Immunol. Immunopathol. 114, 15–24. Talmadge, J., Chavez, J., Jacobs, L., Munger, C., Chinnah, T., Chow, J.T., Williamson, D., Yates, K., 2004. Fractionation of Aloe vera L. inner gel, purification and molecular profiling of activity. Int. Immunopharmacol. 4, 1757–1773. Tan, B.K.H., Vanitha, J., 2004. Immunomodulatory and antimicrobial effects of some traditional Chinese medicinal herbs: a review. Curr. Med. Chem. 11, 1423–1430. Tomasinsig, L., Zanetti, M., 2005. The cathelicidins — structure, function and evolution. Curr. Protein Pept. Sci. 6, 23–34. Torti, F.M., Torti, S.V., 2002. Regulation of ferritin genes and protein. Blood 99, 3505–3516. Verma, V.K., Rani, K.V., Sehgal, N., Prakash, O., 2013. Immunostimulatory effect of artificial feed supplemented with indigenous plants on Clarias gariepinus against Aeromonas hydrophila. Fish Shellfish Immunol. 35, 1924–1931. Wang, T.T., Song, X.H., Bao, G.M., Zhao, L.X., Yu, X., Zhao, J., 2013. Molecular characterization, expression analysis, and biological effects of interleukin-8 in grass carp Ctenopharyngodon idellus. Fish Shellfish Immunol. 35, 1421–1432. Yin, G.J., Ardo, L., Thompson, K.D., Adams, A., Jeney, Z., Jeney, G., 2009. Chinese herbs (Astragalus radix and Ganoderma lucidum) enhance immune response of carp, Cyprinus carpio, and protection against Aeromonas hydrophila. Fish Shellfish Immunol. 26, 140–145. Yoshida, T., Kruger, R., Inglis, V., 1995. Augmentation of Nonspecific Protection in African Catfish, Clarias gariepinus (Burchell), by the Long-Term Oral-Administration of Immunostimulants. J. Fish Dis. 18, 195–198. Zanuzzo, F.S., Urbinati, E.C., Unpublished results. Aloe vera enhances innate immune response of pacu (Piaractus mesopotamicus) during stress and Aeromonas hydrophila infection. Zanuzzo, F.S., Biller-Takahashi, J.D., Urbinati, E.C., 2012. Effect of Aloe vera extract on the improvement of the respiratory activity of leukocytes of matrinxa during the transport stress. Rev. Bras. Zootec. 41, 2299–2302. Zhang, L.N., Tizard, I.R., 1996. Activation of a mouse macrophage cell line by acemannan: the major carbohydrate fraction from Aloe vera gel. Immunopharmacology 35, 119–128. Zhang, X.F., Wang, H.M., Song, Y.L., Nie, L.H., Wang, L.F., Liu, B., Shen, P.P., Liu, Y., 2006. Isolation, structure elucidation, antioxidative and immunomodulatory properties of two novel dihydrocoumarins from Aloe vera. Bioorg. Med. Chem. Lett. 16, 949–953. Zou, J., Wang, T., Hirono, I., Aoki, T., Inagawa, H., Honda, T., Soma, G.I., Ototake, M., Nakanishi, T., Ellis, A.E., Secombes, C.J., 2002. Differential expression of two tumor necrosis factor genes in rainbow trout, Oncorhynchus mykiss. Dev. Comp. Immunol. 26, 161–172. Zou, J., Peddie, S., Scapigliati, G., Zhang, Y., Bols, N.C., Ellis, A.E., Secombes, C.J., 2003. Functional characterisation of the recombinant tumor necrosis factors in rainbow trout, Oncorhynchus mykiss. Dev. Comp. Immunol. 27, 813–822.